KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-Human CD20-Alexa Fluor 700 (Clone 2H7) | BD Biosciences | Cat#560631; RRID: AB_1727447 |
| Goat Anti-Human IgG-HRP | Southern Biotech | Cat#2040-05; RRID: AB_2795644 |
| HCV Antibody AP33 | Clayton et al., 2002 | N/A |
| HCV Antibody AR3C | Law et al., 2008 | N/A |
| HCV Antibody AT12-007 | Merat et al., 2016 | N/A |
| HCV Antibody AT13-021 | Merat et al., 2016 | N/A |
| HCV Antibody HC33.8 | Keck et al., 2013 | N/A |
| HCV Antibody HC84.27 | Keck et al., 2012 | N/A |
| HCV Antibody HEPC-3 | Bailey et al., 2017 | N/A |
| IgG1 isotype control antibody MGO-53 | Wardemann et al., 2003 | N/A |
| Monoclonal anti-HCV E2 patient-derived antibodies | This paper | N/A |
| Monoclonal anti-HIV patient-derived antibodies | This paper | N/A |
| PE Mouse Anti-human IgG (clone G18-145) | BD Biosciences | Cat#555787; RRID: AB_396122 |
| StrepMAB-Classic Oyster 645 conjugate | IBA Lifesciences | Cat#2-1555-050; RRID: |
| HIV-1 Antibody 4E10 | Laboratories of P.W.H.I. Parren and D. Burton; The Scripps Research Institute, La Jolla, California | N/A |
| Bacterial and virus strains | ||
| E. coli DH5α | Thermo Fisher | Cat#18263012 |
| HCVcc strain “1b Con” (Con1/1b/R2a ) | Bankwitz et al., 2021 | Gen Bank (E1/E2 sequence): AJ238799.1 |
| HCVcc strain “1b J4” (J4/1b/R2a ) | Bankwitz et al., 2021 | Gen Bank (E1/E2 sequence): AF054247.1 |
| HCVcc strain “2a” (JcR-2a ) | Bankwitz et al., 2021 | Gen Bank (E1/E2 sequence): NC_009823.1 |
| HCVcc strain “2b” (J8/2b/R2a ) | Bankwitz et al., 2021 | Gen Bank (E1/E2 sequence): JQ745651.1 |
| HCVcc strain “4a” (ED43/4a/R2a ) | Bankwitz et al., 2021 | Gen Bank (E1/E2 sequence): NC_009825.1 |
| HCVcc strain “5a” (SA13/5a/R2a ) | Bankwitz et al., 2021 | Gen Bank (E1/E2 sequence): MH427311.1 |
| HCVcc strain “1a.H77” (H77c/1a/R2a ) | Bankwitz et al., 2021 | Gen Bank (E1/E2 sequence): NC_038882.1 |
| HCVcc strain “2a-3” (2a-3/2a/R2a ) | Bankwitz et al., 2021 | Gen Bank (E1/E2 sequence): KM361734.1 |
| HCVcc strain “2b-4” (2b-4/2b/R2a ) | Bankwitz et al., 2021 | Gen Bank (E1/E2 sequence): KM361730.1 |
| HCVcc strain “2b-5” (2b-5/2b/R2a ) | Bankwitz et al., 2021 | Gen Bank (E1/E2 sequence): KM361731.1 |
| HCVcc strain “2k” (2k/2k/R2a ) | Bankwitz et al., 2021 | Gen Bank (E1/E2 sequence): AB031663.1 |
| HCVcc strain “2r” (2r/2r/R2a ) | Bankwitz et al., 2021 | Gen Bank (E1/E2 sequence): JF735115.1 |
| HCVcc strain “3a” (S52/3a/R2a ) | Bankwitz et al., 2021 | Gen Bank (E1/E2 sequence): GU814264.1 |
| Chemicals, peptides, and recombinant proteins | ||
| ABTS solution | Thermo Fisher | Cat#002024 |
| Adenosine triphosphate | Roche (Sigma Aldrich) | Cat#000000011140965001 |
| Bovine Serum Albumin Fraction V (BSA) | Carl Roth | Cat#8076.3 |
| Branched Polyethylenimine, 25 kDa | Sigma Aldrich | Cat#408727; CAS: 9002-98-6 |
| Cardiolipin | Sigma Aldrich | Cat#C0563 |
| Colenterazine | PJK Biotech | Cat#102171 |
| Cytidine triphosphate | Roche (Sigma Aldrich) | Cat#000000011140922001 |
| DAPI | Thermo Fisher | Cat#D1306; CAS: 581-88-4 |
| DMEM, high glucose | Gibco (Thermo Fisher) | Cat#41965039 |
| DMSO | Sigma Aldrich | Cat#D2650; CAS: 67-68-5 |
| dNTP Mix | Thermo Fisher | Cat#R1122 |
| DTT | Sigma Aldrich | Cat#GE17-1318-01 CAS: 3483-12-3 |
| Fetal bovine serum (FBS) | Sigma Aldrich | Cat#F9665 |
| Fetal bovine serum (FBS), HCVcc assay tested | Capricorn Scientific | Cat#FBS-11A, Lot#CP16-1515 |
| FreeStyle Expression Medium | Thermo Fisher | Cat#12338001 |
| Guanosine triphosphate | Roche (Sigma Aldrich) | Cat#000000011140957001 |
| HEPES | Gibco (Thermo Fisher) | Cat#15630-080 |
| Histopaque-1077 | Sigma Aldrich | Cat#H8889 |
| Human insulin | Sigma Aldrich | Cat#I9278 |
| KLH | Sigma Aldrich | Cat#H8283 |
| L-Glutamine | Gibco (Thermo Fisher) | Cat#25030024 |
| LPS from E. coli | Sigma Aldrich | Cat#L2637 |
| MEM NEAA | Gibco (Thermo Fisher) | Cat#11140-050 |
| NOVA Lite Hep-2 ANA Kit | Inova Diagnostics / Werfen | Cat#066708100 |
| Penicillin-Streptomycin | Gibco (Thermo Fisher) | Cat#15140122 |
| Platinum Taq Green Hot Start DNA Polymerase | Thermo Fisher | Cat#11966034 |
| Protein G Sepharose 4 Fast Flow | GE Life Sciences | Cat#17061805 |
| Q5 Hot Start High Fidelity DNA Polymerase | NEB | Cat#M0493L |
| Recombinant HCV E2 protein pT1056 (GT 2b) | This paper | N/A |
| RNaseOUT | Thermo Fisher | Cat#10777019 |
| Rnasin | Promega | Cat#N2515 |
| RQ1 RNase-free DNase I | Promega | Cat#M6101 |
| Spermidine | Sigma Aldrich | Cat#S2626-1G CAS: 124-20-9 |
| SuperScript IV Reverse Transcriptase | Thermo Fisher | Cat#18090050 |
| T4 DNA Polymerase | New England Biolabs | Cat#M0203L |
| T7 RNA Polymerase | Promega | Cat#P2075 |
| Uridine triphosphate | Roche (Sigma Aldrich) | Cat#000000011140949001 |
| Critical commercial assays | ||
| CD19 MicroBeads, human | Miltenyi Biotec | Cat#130-050-301 |
| EZ-Link sulfo-NHS-biotin | Thermo Fisher | A39256 |
| RNA cleanup kit | Machery Nagel | Cat#740948.5 |
| Deposited data | ||
| HCV antibody heavy and light chain sequences | This paper | GenBank: OL704862 - OL705481 |
| NGS data of IgG repertoires | This paper | NCBI SRA: SAMN23561202- SAMN23561205 |
| 1198_05_G10-E2ecto structure | This paper | PDB: 7RFB |
| 1382_01_H05-E2ecto structure | This paper | PDB: 7RFC |
| Matlab code for machine learning | This paper | DOI: 10.5281/zenodo.5713270 |
| Experimental models: Cell lines | ||
| HEK 293-6E cell line | National Research | NRC file 11565 |
| Council Canada (NRC) | ||
| Huh 7.5 cell line | Blight et al., 2002 | RRID: CVCL_7927 |
| Huh 7.5.1 cell line | Zhong et al., 2005 | RRID: CVCL_E049 |
| Experimental models: Organisms/strains | ||
| None | N/A | N/A |
| Oligonucleotides | ||
| Random Hexamer Primer | Thermo Fisher | Cat#SO142 |
| Single cell PCR Primers | Kreer et al., 2020a | N/A |
| SLIC heavy chain reverse primer (GGGTGCCAGGGGGAAGACCGATGGGCCCTTGGTCGAGGC) | Kreer et al., 2020b | N/A |
| SLIC kappa chain reverse primer (CTCATCAGATGGCGGGAAGATGAAGACAGATGGTGCAGCCACCGTACG) | Kreer et al., 2020b | N/A |
| SLIC lambda chain reverse primer (GAAGCTCCTCACTCGAGGGYGGGAACAGAGTG) | Kreer et al., 2020b | N/A |
| VH1-69 genotyping primer fwd (AGGAAGGGATCCTGGTTT) | Adapted from Pappas et al. (2014) | N/A |
| VH1-69 genotyping primer rev (GATGTGGGTTTTCACACTGTGT) | Adapted from Pappas et al. (2014) | N/A |
| Recombinant DNA | ||
| Human antibody expression vector IgG1 | Tiller et al., 2008 | Avaliable through Addgene as plasmid #80795 |
| Human antibody expression vector Ig kappa | Tiller et al., 2008 | Avaliable through Addgene as plasmid #80796 |
| Human antibody expression vector Ig lambda | Tiller et al., 2008 | Avaliable through Addgene as plasmid #99575 |
| Plasmids encoding HCVcc strains (see section Bacterial and Virus Strains for details) | Bankwitz et al., 2021 | N/A |
| Software and algorithms | ||
| Adobe Illustrator CC 2018 | Adobe | NA |
| FlowJo 10.5.3 | FlowJo, LLC | NA |
| Geneious R10 and Geneious Prime | Geneious | RRID: SCR_010519 |
| IgBlast | National Library of Medicine; Ye et al., 2013 | RRID: SCR_002873 |
| Prism 7 | GraphPad | RRID: SCR_002798 |
| Python 3.6.8 | Python Software Foundation; https://www.python.org/ | RRID: SCR_008394 |
| Other | ||
| Amicon MWCO 30 kDa | Merck Millipore | Cat#Z677108 |
| FACSAria Fusion | BD | N/A |
| Microscope DMI3000 B | Leica | N/A |
| Pierce High Sensitivity Streptavidin-HRP | Thermo Fisher | Cat#21130 |