Polydopamine-coated biomimetic bone scaffolds loaded with exosomes promote osteogenic differentiation of BMSC and bone regeneration

Abstract

Introduction

The repair of bone defects is ideally accomplished with bone tissue engineering. Recent studies have explored the possibility of functional modification of scaffolds in bone tissue engineering. We prepared an SF-CS-nHA (SCN) biomimetic bone scaffold and functionally modified the scaffold material by adding a polydopamine (PDA) coating loaded with exosomes (Exos) of marrow mesenchymal stem cells (BMSCs). The effects of the functional composite scaffold (SCN/PDA-Exo) on BMSC proliferation and osteogenic differentiation were investigated. Furthermore, the SCN/PDA-Exo scaffolds were implanted into animals to evaluate their effect on bone regeneration.

Methods

SCN biomimetic scaffolds were prepared by a vacuum freeze-drying/chemical crosslinking method. A PDA-functionalized coating loaded with BMSC-Exos was added by the surface coating method. The physical and chemical properties of the functional composite scaffolds were detected by scanning electron microscopy (SEM), energy spectrum analysis and contact angle tests. In vitro, BMSCs were inoculated on different scaffolds, and the Exo internalization by BMSCs was detected by confocal microscopy. The BMSC proliferation activity and cell morphology were detected by SEM, CCK-8 assays and phalloidin staining. BMSC osteogenic differentiation was detected by immunofluorescence, alizarin red staining and qRT‒PCR. In vivo, the functional composite scaffold was implanted into a rabbit critical radial defect model. Bone repair was detected by 3D-CT scanning. HE staining, Masson staining, and immunohistochemistry were used to evaluate bone regeneration.

Results

Compared with the SCN scaffold, the SCN/PDA-Exo-functionalized composite scaffold had a larger average surface roughness and stronger hydrophilicity. In vitro, the Exos immobilized on the SCN/PDA-Exo scaffolds were internalized by BMSCs. The BMSC morphology, proliferation ability and osteogenic differentiation effect in the SCN/PDA-Exo group were significantly better than those in the other control groups (p < 0.05). The effects of the SCN/PDA-Exo functional composite scaffold on bone defect repair and new bone formation were significantly better than those of the other control groups (p < 0.05).

Conclusions

In this study, we found that the SCN/PDA-Exo-functionalized composite scaffold promoted BMSC proliferation and osteogenic differentiation in vitro and improved bone regeneration efficiency in vivo. Therefore, combining Exos with biomimetic bone scaffolds by functional PDA coatings may be an effective strategy for functionally modifying biological scaffolds.

Graphical abstract

Highlights

• •Combined BMSC-Exos with biomimetic bone scaffolds by functional polydopamine coatings.
• •SCN/PDA-Exo-functionalized scaffold promoted BMSC proliferation and osteogenic differentiation.
• •SCN/PDA-Exo-functionalized scaffold improves the efficiency of bone regeneration.

1. Introduction

The treatment of large bone defects caused by severe trauma, bone infection, and bone tumors remains a challenge for clinicians [1]. Although autologous bone transplantation is currently the most effective clinical treatment, it often faces challenges such as insufficient donor bone mass, additional trauma and infection [2]. Bone tissue engineering is a new discipline combining biology, chemistry, material science and other interdisciplinary fields. Its main purpose is to develop bone graft scaffold materials with excellent bone repair ability that have a wide range of potential applications in bone repair [3,4]. An ideal biomimetic bone scaffold should be biocompatible, osteogenic, mechanically strong, and antimicrobial. Most scaffolds at the early stage of preparation are often too simple to meet the various needs of bone repair processes [5,6].

To further expand the functions of scaffold materials, recent research has attempted to modify these scaffolds in a variety of ways, mainly including the use of material composites, the loading of bioactive factors, and surface modification [[7], [8], [9]]. Natural bone is composed of inorganic–organic nanocomposites. The most important inorganic component of human bone tissue is hydroxyapatite. Hydroxyapatite processed to the nanometer level (nHA) is more similar to the carbonated nanocrystals of the human bone mineral phase in structure, which makes it easier to form stable covalent bonds with organic matter, and its biological activity and mechanical properties are significantly enhanced [10,11]. Silk fibroin (SF) is a natural fibrin derived from silk that is structurally similar to type I collagen in bone [12]. SF not only has good flexibility and tensile strength but also has excellent biocompatibility and low immunogenicity. The surface of SF has a number of amino and carboxyl groups that easily modify the function of SF [13,14]. Chitosan (CS) is a type of natural basic polysaccharide similar to glycosaminoglycan in the human body. CS has excellent cell affinity and is very helpful for cell adhesion and proliferation [15,16]. In addition, the structure of CS contains amino groups with strong reactivity, and the amino groups make it easier for CS to form a compound with other materials [17,18]. In our previous study [19], the organic‒inorganic composite biomimetic scaffold SF-CS-nHA (SCN) was prepared by blending SF, CS and nHA in a specific proportion and using a vacuum freezing chemical crosslinking method. We demonstrated that the SCN scaffold performed well in terms of biocompatibility, physical properties, and chemical properties but lacked osteogenic inducibility.

Polydopamine (PDA) is a natural mucin secreted by mussels. Forming covalent and noncovalent bonds (such as π bonds, van der Waals bonds, and hydrogen bonds) on material surfaces enables PDA to adhere to almost all types of inorganic and organic material surfaces effectively and stably [20,21]. Additionally, after adsorbing on a material surface, PDA can be oxidized in a weakly alkaline environment and rapidly crosslinked to form a polymer, which can be used as an intermediate medium to continue to efficiently and stably adsorb bioactive factors to realize the functional modification of scaffold materials [22,23]. Zhang and Lu et al. found that polydopamine-modified SF membranes significantly promote wound healing based on rat skin wound models [24]. Kao et al. used polydopamine for the surface modification of calcium silicate and demonstrated that mesenchymal stem cells could differentiate osteogenically when exposed to these surface-modified composites [25]. PDA, as an efficient adhesion coating, has been gradually applied in the surface modification of metal materials, nanomaterials, polymers and so on, which sufficiently demonstrates its advantages [26,27].

Exosomes (Exos) are nanoscale vesicles secreted by cells with a diameter of 50–150 nm that carry active molecules such as various functional proteins, lipids, and coding and noncoding RNAs of the source cells. Exos are important mediators of intercellular material and signal transmission, and Exos participate in various biological processes, such as cell differentiation, immune regulation, and tissue regeneration [28,29]. According to two recent studies, Exos derived from bone mesenchymal stem cells (BMSCs) can promote the osteogenic differentiation of BMSCs. Lu et al.found that BMSC-derived Exos promote angiogenesis and osteogenesis in vivo by releasing miR-29a [30]. A study conducted by Yang et al. demonstrated that BMSC-derived Exos improve osteoblast activity in osteoporotic mice through the lncRNA MALAT1 [31]. The Exo plasma membrane is rich in cholesterol, sphingomyelin, phosphatidylserine and other bioactive substances. Under the protection of these bioactive substances, Exos cannot be degraded and diluted by the external environment to achieve the stable and efficient transport of intracapsular material [32]. Additionally, BMSC-Exos exhibit low immunogenicity, no tumorigenicity, and long-term stability [33]. These excellent biological activities of BMSC-Exos make them promising for potential application in bone tissue engineering.

In this study, we prepared the biomimetic scaffold SCN and functionally modified the scaffold material by adding a polydopamine (PDA) coating loaded with BMSC-Exos. The effects of the functional composite scaffold (SCN/PDA-Exo) on BMSC proliferation and osteogenic differentiation were investigated. Furthermore, the SCN/PDA-Exo functional composite scaffolds were implanted into animals to evaluate their effects on bone defect repair. We present the following article in accordance with the ARRIVE reporting checklist.

2. Methods and materials

Schematic illustration of the study was shown in Fig. 1.

Fig. 1.

Schematic illustration of the study was shown in Fig. 1.

2.1. Preparation and characterization of PDA/SCN scaffolds

According to our previous methods [19], SCN scaffolds were prepared by vacuum freezing/chemical crosslinking. One gram of SF powder (Aladdin, China) was added to 10 mL of ternary solution consisting of CaCl₂ (Aladdin, China), H₂O, and ethanol (Aladdin, China) at a molar ratio of 1:8:2 and magnetically stirred at 80 °C for 1 h. The solution was then transferred to a dialysis bag with a molecular weight cutoff of 3500 D (Biosharp, China) and dialyzed for 2 days against tap water and 1 day against deionized water. Afterwards, the concentration of SF solution was diluted to 4% with ultrapure water. Chitosan (Aladdin, China) was mixed with 2% acetic acid and magnetically stirred at a speed of 300 r/min at 100 °C for 1 h until complete dissolution. The concentration of CS solution was then diluted to 4% with ultrapure water. nHA (Aladdin, China) was mixed in ultrapure water and magnetically stirred at room temperature to obtain suspensions with concentrations of 4%. Subsequently, the SF solution, CS solution, and nHA suspension were mixed at a volume ratio of 1:1:1 via magnetic stirring. The mixture was imported into a column mold groove and frozen at −80 °C for 24 h. The scaffolds were subsequently shaped into cylinders in a vacuum dryer (Thermo Fisher Scientific, Waltham, MA, USA) for 24 h. The dried scaffolds were then immersed in a solution containing 75% methanol (Aladdin, China) and 1 mol/L NaOH (Aladdin, China) at a volume ratio of 1:1 for crosslinking at 4 °C for 24 h. Subsequently, the scaffolds were ultrasonically cleaned with ultrapure water three times and dried under vacuum for another 24 h for secondary shaping. The dried scaffolds were then immersed in a cross-linking agent containing 50 mmol/L 1-ethyl-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC, Aladdin, China) and 20 mmol/L N-hydroxysuccinimide (NHS, Aladdin, China) and cross-linked at 4 °C for 24 h. After ultrasonic cleaning, the scaffolds were vacuum-dried for 24 h for final shaping. The preparation of the SCN scaffolds was thus completed. Dopamine hydrochloride powder (Aladdin, China) was dissolved in 10 mM Tris-HCl buffer (pH 8.5) (Tianjin Kemiou Chemical Reagent, China) and stirred by magnetic force for 1 h to prepare a Tris-polydopamine solution with a concentration of 4 mg/mL. The SCN scaffolds were soaked in Tris-polydopamine solution for 24 h at room temperature (25 °C) and cleaned three times with deionized water. The scaffolds were sterilized with ethylene oxide (3.6 kg/m³, 50 °C, 60% RH) for 8 h. The preparation of the SCN/PDA scaffold was thus completed. Thereafter, the scaffolds were sputtered with gold using a sputter-coater (Polaron E5600, USA), and the microstructure of the scaffold by observed by scanning electron microscopy (SEM, SU8220, Hitachi, Japan, working voltage 5.0 kV), and the average pore size was measured. Energy dispersive spectroscopy (EDS, SU8220, Hitachi, Japan) was used to detect the surface chemical composition of the scaffold materials, and atomic force microscopy (AFM, Dimension Icon, Bruker, Germany) was used to detect the scaffold surface roughness. The maximum compressive strengths and compressive modulus of the scaffolds were tested by a material mechanics testing machine (UTM, AGS-X, Shimadzu, Japan, preload force of 0.1 N, loading rate of 2.00 mm/min). The modified liquid displacement method was used to measure the scaffold porosities. The scaffold surface hydrophilicity was measured by a contact angle tester (VCA 2000, SZ-CAMA1, China). Scaffolds with smaller contact angles have stronger hydrophilicity.

2.2. Extraction, identification and internalization of BMSC-exos into cells

Procell (Cat. No. CP-Rb007, Wuhan, China) supplied the rabbit BMSCs used in this study. For Exo isolation, third-generation BMSCs were cultured at 37 °C for 48 h in 10% α-MEM (Solarbio, China) with Exo-depleted fetal bovine serum (FBS, Gibco, Australia). Subsequently, BMSC-conditioned medium was obtained and centrifuged sequentially at 300×g for 10 min at 4 °C, at 2000×g for 10 min at 4 °C, and at 10,000×g for 30 min at 4 °C to remove cellular debris, and the supernatant was reserved each time. The supernatants were cleaned by washing using a 0.22-mm filter sterilizer followed by centrifugation for 90 min at 4 °C and 100,000×g. We then obtained Exo pellets, resuspended them in PBS, and stored them at −80 °C. The morphology of BMSC-Exos was observed by transmission electron microscopy (TEM, JEM-1400FLASH, JEOL, Japan). Nanoparticle tracking analysis (NTA, Zeta View PMX 110, Particle Metrix, Germany) was used for particle size analysis. To determine the concentration of exosomal proteins, we used the BCA Protein Assay Kit (Solarbio, China), and the OD values were measured at 562 nm. The expression of specific marker molecules in the Exos was detected by Western blotting. The primary antibodies used were as follows: CD9 (Abcam, ab236630), CD63 (Abcam, ab134045), and TSG 101 (Abcam, ab125011). The 5 μL green-fluorescent dye PKH67 (D0031, Solarbio, China) was added to the 1 mL diluted exosome suspension at room temperature. After 5 min incubation, 1 mL FBS was applied to terminate the staining. Afterwards, BMSCs were incubated with the PKH67-positive exosomes. Following 4% paraformaldehyde fixation for 15 min at room temperature (25 °C), DAPI staining (C0065, Solarbio, China) was performed, and phalloidin (Actin-Tracker Red-594, Beyotime, China) was used to stain the cytoskeleton. The internalization of BMSC-Exos into cells was observed by a confocal laser scanning microscope (Leica TCS SP8, Germany) after coculture for 6 h, 12 h, and 24 h.

2.3. Coculture of functionalized scaffolds loaded with exos and BMSCs

We prepared SCN/PDA or SCN scaffolds with a diameter of 5 mm and a thickness of 1 mm. In a previous study [34], For the immobilization of exosomes, SCN/PDA or SCN scaffolds were immersed in 1.8 μg/μL Exo solution (300 μL/scaffold) for 12 h at 4 °C to adsorbed Exos. Afterwards, the compound materials were incubated in PBS at 37 °C, and the supernatants were collected at predetermined time intervals of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10 days to measure the release of Exos. After 10 days, the supernatants continued to be collected daily until no exosomes release was detected to measure the total absorption of Exos in the scaffolds. The amounts of exosomes released were measured using BCA Protein Assay Kit (Solarbio, China). The total absorption of Exos was calculated by the cumulative amounts of exosomes released. Subsequently, 12-well plates were filled with scaffolds, and the scaffolds were seeded with third-generation BMSCs (2 × 10⁵ cells/well). α-MEM (Solarbio, China) with 10% FBS (Gibco, Australia) was added, and the scaffolds and BMSCs were cocultured at 37 °C and 5% CO₂. Based on the different scaffold components, the samples were divided into four groups: (A) the SCN group, (B) the SCN/PDA group, (C) the SCN-Exo group, and (D) the SCN/PDA-Exo group. Using 4% paraformaldehyde, the cells were fixed after 24 h of coculture at room temperature (25 °C). The internalization of Exos immobilized on scaffolds by BMSCs was observed by confocal microscopy (using the same fluorescent staining method described previously).

2.4. Scaffold cytotoxicity and BMSC proliferation

After 24 h of coculture of the scaffolds and BMSCs, the samples were fixed with 4％paraformaldehyde at room temperature (25 °C), dehydrated with alcohol, dried, and sputter-coated with gold. The adhesion of BMSCs to the scaffolds and the BMSC morphology were then observed by SEM. After 3 days of coculture in 12-well plates, a combination of calcein and PI (C2015S, Beyotime, China) was used to distinguish between live and dead cells and thus investigate the scaffold cytotoxicity. The numbers of living and dead cells were counted under a fluorescence microscope (IX53, Olympus, Japan). To measure the proliferation of BMSCs on the scaffolds, a 96-well plate was filled with scaffolds with a diameter of 2 mm and a thickness of 1 mm. BMSCs were seeded at a density of 2 × 10⁴ cells/well. BMSC proliferation was detected by CCK-8 assays on the 1st, 3rd, and 7th days of coculture.

2.5. Osteogenic differentiation of BMSCs

The scaffolds (a diameter of 5 mm and a thickness of 1 mm) were placed in 12-well plates. BMSCs were seeded in 12-well plates at a density of 2 × 10⁵ cells/well, and osteogenic induction medium (10% FBS, 100 IU/mL penicillin/streptomycin, 10 mM β-glycerophosphate, 10 nM dexamethasone, 50 μg/mL ascorbic acid) was added. After 7 days of coculture of the scaffolds and BMSCs, alkaline phosphatase (ALP) expression was detected in cells using an ALP staining kit (P0321 M, Beyotime, China). After 21 days of coculture, calcium deposition in the cells was detected using an Alizarin Red staining kit (C0148S, Beyotime, China). The expression levels of Runx2 and Col-1 were detected by immunofluorescence after 7 and 14 days of coculture, respectively. Briefly, the cells were fixed with 4% paraformaldehyde, permeabilized with 0.1% Triton X-100 (ST795, Solarbio, China), blocked with 5% BSA Blocking Buffer (SW3015, Solarbio, China) at room temperature (25 °C), and incubated with Runx-2 (Abcam, ab76956) or Col-1 (GeneTex, GTX26308) overnight at 4 °C. The cells were then incubated with the fluorescent secondary antibody (Beyotime, China) for 1 h. DAPI (C0065, Solarbio, China) was used to stain the nuclei, and phalloidin (Actin-Tracker Green-488, Beyotime, China) was used to stain the cytoskeleton. All incubation procedures were protected from light. The 12-well plate was replaced with a 6-well plate under the same conditions and grouping, and BMSCs were seeded in 6-well plates at a density of 2 × 10⁵ cells/well. After 14 days of coculture of the scaffolds and BMSCs, TRIzol was used to extract total RNA from the cells. Purified RNA was reverse transcribed into cDNA using PrimerScriptTM RT Master Mix (TaKaRa, Japan) under standard conditions in accordance with the manufacturer's instructions. qRT‒PCR was then performed using a SYBR PreMix Ex Taq (Tli RNaseH Plus) kit in an ABI7500 real-time quantitative PCR system to detect the osteogenic gene expression of Runx2, Col-1, OCN and BMP-2 in cells. Relative gene expression levels were calculated using the 2^-ΔΔCT method relative to GAPDH. The primer sequences are given in Table 1.

Table 1.

Primers used for RT‒PCR.

Gene	Forward	Reverse
Runx2	TGACCAGCAGGCAGGAAACA	TCTCACAGCATCCTACGCCG
COL-1	TTGGTGTGGCGTCCATGAGT	ACACGCAGCTGGTCAGACAT
OCN	AGTCTGGCAGAGGCTCAGGTAC	GGTCAGGTGGTTGTAGGCTTGG
BMP-2	CTGAACTCCACTAATCATGC	ACAACCTTTTCATTCTCGTC
GAPDH	CGAGCTGAACGGGAAACTCA	CCCAGCATCGAAGGTAGAGG

2.6. Surgical procedure of the radial defect model

Approval for all experimental procedures was obtained from the animal ethics committee of our university (IRB No. 2021-4-154). Twenty-four New Zealand white rabbits (aged 5–6 months and weighing 4.0 ± 0.30 kg) were anesthetized with xylazine hydrochloride (intramuscular injection, 0.025 mL/kg). Based on previous studies [35,36] on the radial critical defect model, a longitudinal incision was made on the lateral aspect of the right radius. Subcutaneous tissue and muscle were bluntly separated to expose the radius. Then, a microvibrating saw was used to create a 15-mm-long, 3-mm-diameter cylindrical bone defect in the middle of the radius. The rabbits were randomly divided into 4 groups: (A) blank control group, (B) SCN scaffold group, (C) SCN/PDA scaffold group, and (D) SCN/PDA-Exo scaffold group. The rabbits in each group were implanted with the corresponding scaffold materials. The surgical incision was closed, and gentamicin was injected subcutaneously to prevent infection.

2.7. Radiographic and histopathological assessment

A 3D thin-slice computed tomography (CT) (Brilliance iCT, Philips, Netherlands) scan was performed on all rabbits at 12 weeks postoperatively. The QCT Pro system (Image Analysis QCT, Mindways, USA) was used to calculate the bone mineral density (BMD) of the right radius. The animals were sacrificed with an overdose of xylazine hydrochloride (intramuscular injection, 0.25 mL/kg) at 12 weeks postoperatively. The soft tissue of the right radius was stripped. The radius was sequentially fixed with 4% polyformaldehyde, decalcified with EDTA, gradient dehydrated with ethyl alcohol, embedded in paraffin, and sectioned. The thickness of the sagittal sections was 5 μm. Hematoxylin-eosin (H&E) staining and Masson's trichrome staining were performed for histological assessment and new bone formation detection. The expression of Col-1 (GeneTex, GTX26308) and CD31 (Abcam, ab213175) was detected by immunohistochemistry.

2.8. Statistical analysis

Each experiment was replicated at least 4 times. The experimental data are presented as the means±standard deviations (SDs). Two groups were compared using Student's t tests, and multiple groups were compared by one-way analysis of variance (ANOVA). The statistical analyses were performed with SPSS 18.0 software (SPSS, Inc., Chicago, IL, USA). Semiquantitative analyses were conducted with Image-Pro Plus 6.0. Statistical significance was defined as a P value < 0.05.

3. Results

3.1. Characterization of SCN/PDA scaffolds

SEM showed that the SCN scaffold was a homogeneous network with a three-dimensional structure. After adding the PDA coating, the SCN/PDA scaffold surface was coated with PDA, and the surface was rougher (Fig. 2A). The average pore sizes of the SCN and SCN/PDA scaffolds were 136.12 ± 17.53 μm and 131.17 ± 13.24 μm, respectively. The average porosities were 84.71 ± 3.14% and 80.21 ± 2.15%, respectively, and the average compression modulus was 0.67 ± 0.13 MPa and 0.72 ± 0.21 MPa, respectively. The compressive strengths were 5.83 ± 0.34 MPa and 6.24 ± 0.41 MPa, respectively. No significant difference in the average pore size, average porosity, average compression modulus or average compression strength was observed (P > 0.05) (Fig. 2B). AFM detection indicated that the SCN/PDA scaffolds had a rougher surface morphology and higher average roughness than the SCN scaffolds alone (P < 0.05) (Fig. 2C and E). The static contact angles of the SCN and SCN/PDA scaffolds were 115.8 ± 8.5°and 99.0 ± 5.7°, respectively (P < 0.05). This results indicated that the SCN/PDA scaffolds were more hydrophilic than the SCN scaffolds (Fig. 2D and F). According to the EDS analysis, the two scaffolds contained carbon, nitrogen, oxygen and high levels of calcium and phosphorus, which are required for bone mineralization. Compared with the SCN scaffolds, the SCN/PDA scaffolds contained a higher proportion of nitrogen, which was caused by the introduction of the surface amine groups in PDA. These findings indicate that PDA successfully adhered onto the scaffold surface (Fig. 2G and H).

Fig. 2.

Scaffold characterization. (A) SEM image of the scaffold. (B) Relevant characterization parameters of the scaffold. (C and E) Surface roughness of the scaffold analyzed by atomic force microscopy (AFM). (D and F) The scaffold surface hydrophilicity was measured by a contact angle tester. (G and H) Energy dispersive spectrometry (EDS) analysis of the scaffold. SEM: scanning electron microscopy.

3.2. Extraction, identification and internalization of BMSC-exos into cells

The BMSC-Exos had a cup-shaped morphology with a lipid membrane structure, as evidenced by TEM (Fig. 3A). The mean particle size of the BMSC-Exos was 125.2 ± 5.3 nm (Fig. 3B). The extracted BMSC-Exo protein concentration was 1.87 ± 0.12 μg/μL. CD9, CD63 and TSG 101 are characteristic proteins expressed in BMSCS-Exos. According to the Western blot analysis, CD9, CD63, and TSG 101 were expressed in the BMSCS-Exos (Fig. 3C). The BMSCS-Exos were internalized and absorbed by BMSCs over time, as evidenced by confocal microscopy (Fig. 3D).

Fig. 3.

Characterization of BMSC-Exos. (A) Transmission electron microscopy (TEM) images of Exos isolated from BMSCs. (B) Particle size analysis of BMSC-Exos. (C) Western blot analysis of the exosomal surface markers CD9, CD63 and TSG 101 in BMSC-Exos. CD9, CD63 and TSG 101 were expressed in both bands. (D) Internalization of BMSC-derived Exos into BMSCs. Exos were stained with the green dye PKH67, and nuclei were stained with the blue dye DAPI. Scale bars = 20 μm.

3.3. Coculture of functionalized scaffolds loaded with exos and BMSCs

On the 3rd day, based on the live/dead staining results, the four groups exhibited a high percentage of viable cells and a low percentage of dead cells (Fig. 4A). No significant difference in cell viability was detected (P > 0.05) (Fig. 4B), indicating that the scaffold material had no obvious cytotoxicity. According to the CCK-8 results, on the 3rd and 7th days, the proliferation of cells in the SCN/PDA-Exo group was significantly higher than that in the other three groups (P < 0.01) (Fig. 4C). The results of exosomes immobilization on scaffold revealed that the total amount of adsorbed exosomes was 263.8 ± 17.2 μg (the absorption rate = 47.53 ± 6.41%) on each SCN/PDA scaffold and 121.4 ± 21.6 μg (the absorption rate = 23.14 ± 4.58%) on each SCN scaffold. There was a significant difference between the two groups (P < 0.01). The results from the analysis of the sustained release of Exos revealed that the Exos loaded onto the SCN scaffold began to release rapidly on the 2nd day, and no Exos were detected on the 5th day (Fig. 4D). In contrast, the sustained release of Exos on SCN/PDA scaffolds was obvious, and no Exos were detected until the 21st day (Fig. 4E). BMSCs successfully adhered to the SCN and SCN-PDA scaffolds, and the BMSC morphology was characterized by a long spindle shape and clumped growth, as evidenced by SEM after 24 h of coculture (Fig. 4F). The analysis of the of internalization of BMSC-Exos showed that only a small amount of BMSC-Exos was adsorbed onto the scaffold because the SCN-Exo group had no PDA coating. Therefore, only a small amount of BMSC-Exos was internalized and absorbed by BMSCs (Fig. 4G). In the SCN/PDA-Exo group, the BMSC-Exos immobilized on the SCN/PDA scaffolds were successfully internalized and absorbed by BMSCs after 24 h of coculture, as evidenced by confocal microscopy (Fig. 4G).

Fig. 4.

Coculture of functionalized scaffolds loaded with Exos and BMSCs. (A) Live/dead staining of BMSCs at 3 days. Scale bars = 200 μm. (B) Percentage of living BMSCs (n = 4). (C) Proliferation of BMSCs determined by CCK-8 (n = 4). (D–E) In vitro Exo release kinetics in PBS from SCN/Exo and SCN/PDA-Exo scaffolds. (F) SEM image of BMSCs on the scaffold after 24 h of coculture. The red asterisk represents BMSCs. Scale bars = 50 μm. (G) Exos immobilized on functionalized scaffolds internalized by BMSCs after 24 h of coculture. The cytoskeleton was stained with the red dye phalloidin, and nuclei were stained with the blue dye DAPI. Scale bars = 20 μm ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001.

3.4. Osteogenic differentiation of BMSCs

The results from the immunofluorescence analysis showed that the expression of Runx2 in the SCN/PDA-Exo group after 7 days of osteoinduction was significantly higher than that in the other three groups (P < 0.01), and that of the SCN-Exo group was significantly higher than that of the SCN and SCN/PDA groups (P < 0.05) (Fig. 5A and C). The expression of Col-1 in the SCN/PDA-Exo group after 14 days of osteoinduction was significantly higher than that in the other three groups (P < 0.01). Moreover, that of the SCN-Exo group was significantly higher than that of the SCN and SCN/PDA groups (P < 0.05) (Fig. 5B and D). According to the ALP and Alizarin red staining results, the depth and area of the SCN/PDA-Exo group were significantly higher than those of the other three groups (P < 0.05), and those of the SCN-Exos group were significantly higher than those of the SCN and SCN/PDA groups (P < 0.05) (Fig. 5E, F, 5G). According to the qRT‒PCR results, among the four groups, Runx2, Col-1, OCN, and BMP-2 expression was highest in the SCN/PDA-Exo group after 14 days of osteoinduction (P < 0.01). The expression level in the SCN-Exo group was significantly higher than that in the SCN and SCN/PDA groups (P < 0.05) (Fig. 5H–K).

Fig. 5.

Effects of different scaffolds on BMSC osteogenic differentiation. (A–B) Expression levels of Runx2 and Col-1 detected by immunofluorescence on the 7th and 14th days of osteoinduction, respectively. Scale bars = 100 μm. (C–D) Semiquantitative fluorescence results of the expression of Runx-2 and Col-1 (n = 4). (E) ALP and Alizarin red staining images of BMSCs under a microscope after 7 days and 21 days of osteoinduction, respectively. Scale bars = 100 μm. (F–G) Quantitative results of ALP and Alizarin red staining (n = 4). (H–K) Gene expression of Runx-2, OCN, Col-1, and BMP-2 after 14 days of osteoinduction (n = 4). ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001.

3.5. In vivo

All the experimental animals recovered well with no wound infection, and no death was recorded. As shown in Fig. 6A, the results of the 3D-CT scan of the blank control group 12 weeks after surgery showed no significant new bone formation but a significant bone defect area, and the medullary cavity was occluded. In the SCN and SCN/PDA scaffold groups, the bone defect area was partially repaired, but a few bone defect areas were still observed. These groups showed a lower bone mineral density and partial obstruction of the bone marrow cavity compared with normal bone tissue. In the SCN/PDA-Exo scaffold group, a significant difference was not observed between the repaired bone defect area and the normal bone tissue, whereas the bone marrow cavity was basically completely recanalized and the bone cortex was continuous. According to the H&E and Masson's trichrome staining results, the scaffold material had been degraded and absorbed in the four groups at 12 weeks after surgery. In the blank control group, no significant new bone formation or trabecular bone formation was observed, and the bone defect area was filled with a large amount of fibrous tissue. In the SCN and SCN/PDA scaffold groups, some new bone was observed, but the arrangement of new bone trabeculae was disordered. In the SCN/PDA-Exo scaffold group, a large amount of new bone had formed, more vascular lumen was observed around the new bone, the trabeculae were arranged neatly, and some trabeculae had formed woven bone (Fig. 6B). In the SCN/PDA-Exo scaffold group, the rate of new bone formation was significantly higher than that in the other three groups (P < 0.01), whereas that in the SCN and SCN/PDA scaffold groups was significantly higher than that in the blank control group (P < 0.05) (Fig. 6E). The BMD in the SCN/PDA-Exo scaffold group was higher than that in the other three groups (P < 0.05), whereas that in the SCN and SCN/PDA scaffold groups was significantly higher than that in the blank control group (P < 0.05) (Fig. 6D). The mechanical strength of bone is enhanced by type I collagen (Col-I), and the CD31 protein plays an important role in angiogenesis. Compared with the other three groups, the SCN/PDA-Exo scaffold group showed significantly higher Col-I and CD31 expression in the 12th week (P < 0.05), as observed by immunohistochemistry (Fig. 6C, F, 6G).

Fig. 6.

Radiographic and histopathological assessment. (A) 3D-CT reconstruction and sagittal image at 12 weeks. (B) Hematoxylin–eosin (H&E) staining and Masson's trichrome staining at 12 weeks. H&E staining scale bars = 200 μm. Masson's trichrome staining scale bars = 100 μm. (C) Immunohistochemistry of Col-1 and CD31 at 12 weeks. Col-1 scale bars = 50 μm; CD31 scale bars = 20 μm. (D) Bone mineral density (BMD) of the radial bone defect area quantified by 3D-CT (n = 6). (E) New bone formation area quantified by Masson's trichrome staining (n = 6). (F–G) Expression of COL-1 and CD31 quantified by immunohistochemistry (n = 6). ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001.

4. Discussion

The modification of scaffold functionalization has become a popular research topic in tissue engineering in recent years. At present, a number of studies have been devoted to the loading of growth factors with osteogenic activity on biomimetic bone scaffolds to improve the osteogenic inducibility of scaffolds [13,27,34-,37]. In this study, we prepared an SCN biomimetic scaffold and functionally modified the scaffold material by adding a polydopamine coating loaded with BMSC-Exos. The SCN/PDA-Exo-functionalized composite scaffold showed both biocompatibility and osteogenic inducibility, promoted BMSC proliferation and osteogenic differentiation in vitro and improved bone defect repair efficiency in vivo.

The surface modification of tissue engineering scaffolds can improve the scaffold hydrophilicity and mechanical strength and facilitate the introduction of functional molecules [38,39]. Many methods are used for surface modification, such as irradiation, ion beam implantation, surface chemical grafting, UV illumination, and plasma methods. However, these methods have some limitations in terms of biological scaffold preparation. Irradiation can change physical and chemical material properties [38]. The plasma and ion beam implantation methods are less stable [40]. The chemical reactions in surface grafting processes are complex, and organic solvents are needed [41]. Polydopamine is a natural mucin secreted by mussels and tends to stick to any surface. After adhesion, PDA will further undergo a crosslinking polymerization reaction and form a layer of PDA coating on material surfaces [27]. The rich phenolic hydroxyl functional groups in PDA coatings easily undergo Michael addition reactions with protein molecules containing amino and sulfhydryl groups [42]. PDA can be used as a bridge between scaffold materials and functional molecular scaffolds to efficiently introduce functional molecules into scaffolds to realize the functional modification of scaffold materials. A study conducted by Shim et al. demonstrated that modifying graphene oxide with a PDA coating can activate the MAPK signaling pathway to promote the osteogenic differentiation of pluripotent embryonic stem cells [43]. Li et al. used PLGA/PDA-coated scaffolds loaded with hASCS-derived Exos and found that these scaffolds promoted BMSC osteogenic differentiation in vitro and rat skull defect repair in vivo [34]. In this study, the SCN/PDA scaffolds retained the excellent properties of the original SCN scaffolds, such as high porosity, suitable pore size and excellent mechanical strength. Furthermore, the surface of the SCN/PDA scaffold was rougher, which is more conducive to stem cell adhesion and aggregation. The PDA coating increased the cell affinity of the scaffold material. Therefore, the SCN/PDA scaffold had excellent biocompatibility and promoted BMSC proliferation.

There are many growth factors with osteogenic activity, such as BMP-2, BMP-9, and OGP. However, this type of exogenous growth factor often easily produces obvious local rejection reactions, and it is difficult to achieve an effective local sustained release effect [44]. Although some metal elements, such as Ag and titanium, have good osteogenic inducibility and poor biocompatibility and cannot easily degrade in vivo, which limits their application [45]. Bone tissue engineering commonly uses BMSCs as stem cells [46]. However, similar to stem cell therapies, BMSCs also have the problems of limited source, difficulty in maintaining stemness during in vitro expansion, and low survival rate in local tissue damage [47]. BMSC-Exos are nanoscale vesicles with membrane structures secreted by BMSCs. They carry a variety of functional proteins, coding and noncoding RNA, DNA and other important active molecules of BMSCs and are involved in BMSC cytological behavior and several biological bone metabolism processes [48]. BMSC-Exos can be stably preserved after extraction. The bioactive molecules in BMSCS-Exos can be protected by lipid membranes and can be directly taken up by target cells to exert biological effects [49]. Furthermore, the BMSC-Exo concentration can be quantified and controlled easily [50]. These advantages indicate that BMSC-Exos have potential applications in bone tissue engineering. However, when free BMSC-Exos are used for osteogenic induction, it is difficult to achieve the sustained release effect in vivo [28,34]. Compared free BMSC-Exos, immobilization of BMSC-Exos on tissue-engineered scaffolds may be advantageous for osteogenic induction [37,51]. Xu et al. combined BMSC-Exos with Ti6Al4V scaffolds, and the resulting scaffolds promoted BMSC osseointegration by activating the BMP/Smad signaling pathway compared free BMSC-Exos group [37]. Wang et al.utilized acellular fish scale scaffolds loaded with BMSC-Exos, resulting in enhanced BMSC osteogenic differentiation and promoting the repair of mouse calvarial defects compared free BMSC-Exos group [51]. In the present study, we prepared SCN/PDA-Exo-functionalized scaffolds by PDA coating loaded with BMSC-Exos. The results of the analysis of sustained BMSC-Exo release on the scaffold showed that the BMSC-Exos on the SCN scaffold had an obvious burst release effect because the BMSC-Exos were simply physically adsorbed onto the SCN. In contrast, BMSC-Exos adhered to the surface of the SCN/PDA scaffold through the interface crosslinking of the PDA coating such that its sustained release effect was significantly increased. Furthermore, we also observed that most of the Exos adhering to the PDA coating could be directly internalized and absorbed by BMSCs on the SCN/PDA scaffold, which may indicate that PDA coating-loaded BMSCS-Exos are a simple and efficient functional modification method.

Zhang et al. found that BMSC-Exos could recruit endogenous BMSCs and promote BMSC proliferation [52], which was consistent with our study. The CCK-8 results showed that SCN/PDA-Exo promoted BMSC proliferation. The SCN/PDA scaffold components promoted cell adhesion, whereas the Exos increased the bioactivity and cell affinity of the scaffold components, providing a good microenvironment for cell proliferation. ALP is a phosphatase secreted by osteoblasts at the early stage of osteogenesis and is one of the markers of early osteogenic differentiation [53]. At the late stage of osteogenic differentiation, a large number of osteoblasts are mineralized, calcium salts are deposited, and calcium nodules are formed [54]. ALP and Alizarin red staining were used to detect the effects of early and late osteogenic differentiation, respectively. In comparison to the other three groups, the SCN/PDA-Exo group showed significantly higher cell mineralization and deeper ALP staining (P < 0.05). These results may indicate that the SCN/PDA-Exo-functionalized scaffold could promote BMSC osteogenic differentiation at both the early and late stages of osteogenesis and maintain the continuity of osteogenic induction. Furthermore, we evaluated the effect of the SCN/PDA-Exo-functionalized scaffold on BMSC osteogenic differentiation at different time periods by detecting the expression of osteogenic-related genes and proteins in BMSCs. Runx-2 is an initiation transcription factor associated with osteogenic differentiation that is highly expressed at the early stage of osteogenesis [55]. The COL-1 protein is involved in the regulation of phenotypic maturation and cell proliferation of osteoblasts and is expressed at the early and middle stages of osteogenesis [56]. OCN is a bone matrix protein and a specific marker protein of osteoblasts that plays an important role in bone remodeling and is often expressed at the late stage of osteogenesis [55]. BMP-2 is directly involved in the proliferation, migration, and mineralization of osteoblasts and is expressed throughout the osteogenic stage [57]. A study conducted by Wang et al. showed that the expression of Col-1, Runx-2 and OCN in BMSCs was significantly upregulated by PCL membrane scaffolds loaded with BMSC-Exos [58]. Zhai et al. found that stem cell Exos loaded with Ti scaffolds can activate the PI3K/Akt and MAPK signaling pathways through upregulated osteogenic miRNAs, resulting in the promotion of BMP-2 and Col-1 expression in BMSCs [59]. In the present study, the immunofluorescence results showed that Runx-2 protein was highly expressed in the cytoplasm and nucleus of BMSCs in the SCN/PDA-Exo group on the 7th day of osteogenic induction, indicating that SCN/PDA-Exos promoted the early osteogenic differentiation of BMSCs. On the 14th day of osteogenic induction, the expression of Col-1 protein in the cytoplasm of BMSCs in the SCN/PDA-Exo group was significantly higher than that in the other three groups. Moreover, the qPCR results showed that the expression of genes related to early, middle and late osteogenic differentiation was upregulated in the SCN/PDA-Exo group. These findings demonstrated the continuity of BMSC osteogenic induction by SCN/PDA-Exos at the gene and protein levels.

Although SCN/PDA-Exo promotes BMSC proliferation and osteogenic differentiation in vitro, it is necessary to further verify the biological activity of SCN/PDA-Exo scaffolds by animal experiments due to the obvious differences between the in vivo and in vitro environments and the complexity of the in vivo environment. Animal bone defect models are often used to evaluate the in vivo osteogenic properties of materials. In the present study, SCN/PDA-Exo-functionalized three-dimensional porous columnar scaffolds simulated the structural characteristics of bone trabeculae to a certain extent. After implantation in radial defect areas, BMSC-Exos were slowly released and continued to induce BMSC proliferation and osteogenic differentiation. Twelve weeks after surgery, the scaffold materials in the four groups were basically completely degraded with no obvious residues, indicating the good biocompatibility and degradability of the scaffold materials. Twelve weeks after surgery, in the SCN/PDA-Exo group, no significant difference was found between the repaired bone defect area and the normal bone tissue, the bone cortex was continuous, the medulla-cavity recalculation was good, and the bone repair effect was significantly better than that in the other three groups, indicating that the SCN/PDA-Exo scaffold improved the bone defect repair efficiency. Osteogenesis and angiogenesis are two cooperative biological processes, and the good integration of new bone and new blood vessels is the premise of complete repair of bone defects [29]. Qi et al. found that Exo treatment with stem cells could promote angiogenesis and bone defect repair in rat skull defect models, and the Exo treatment concentration was positively correlated with the new blood vessel areas [60]. Kang et al. demonstrated that stem cell Exos play a dual role in promoting bone and angiogenesis [61]. These findings are consistent with our study. The H&E and Masson's trichrome staining results showed that large areas of new bone had formed and that there was a large amount of neovascularization in the trabecula of the new bone in the SCN/PDA-Exo group. Furthermore, the Col-1 protein associated with bone formation and the CD31 protein associated with angiogenesis were both highly expressed in the SCN/PDA-Exo group. These results may indicate that SCN/PDA-Exos can simultaneously repair bone defects and promote angiogenesis in vivo. However, the specific mechanism is unclear and needs further study.

5. Conclusion

In this study, we found that the SCN/PDA-Exo-functionalized composite scaffold promoted BMSC proliferation and osteogenic differentiation in vitro and improved bone regeneration efficiency in vivo. Therefore, combining Exos with biomimetic bone scaffolds by functional PDA coatings may be an effective strategy for functionally modifying biological scaffolds.

Ethical statement

Approval for all the animal procedures was obtained from the Animal Ethics Committee of Zunyi Medical University (IRB No. 2021-4-154).

Availability of data and material

The analyzed data sets generated during the present study are available from the corresponding author on reasonable request.

Funding

This work was supported by the Science and Technology Fund Project of Guizhou Province, China (gzwjkj2020-1-129, ZK2023-491).

Author contributions

Yi Zhou and Shuiqin Zhang conceptualized and designed the study. All authors researched, collated, and wrote this paper.

Declaration of competing interest

The authors declare that they have no conflict of interest.