Skip to main content
International Journal for Parasitology: Drugs and Drug Resistance logoLink to International Journal for Parasitology: Drugs and Drug Resistance
. 2023 Mar 15;22:1–8. doi: 10.1016/j.ijpddr.2023.03.003

Pantothenate biosynthesis in Toxoplasma gondii tachyzoites is not a drug target

Vanessa M Howieson a, Joy Zeng a, Joachim Kloehn b, Christina Spry a, Chiara Marchetti c, Matteo Lunghi b, Emmanuel Varesio d,e, Andrew Soper a, Anthony G Coyne c, Chris Abell c, Giel G van Dooren a,∗∗, Kevin J Saliba a,∗
PMCID: PMC10102396  PMID: 37004488

Abstract

Toxoplasma gondii is a pervasive apicomplexan parasite that can cause severe disease and death in immunocompromised individuals and the developing foetus. The treatment of toxoplasmosis often leads to serious side effects and novel drugs and drug targets are therefore actively sought. In 2014, Mageed and colleagues suggested that the T. gondii pantothenate synthetase, the enzyme responsible for the synthesis of the vitamin B5 (pantothenate), the precursor of the important cofactor, coenzyme A, is a good drug target. Their conclusion was based on the ability of potent inhibitors of the M. tuberculosis pantothenate synthetase to inhibit the proliferation of T. gondii tachyzoites. They also reported that the inhibitory effect of the compounds could be antagonised by supplementing the medium with pantothenate, supporting their conclusion that the compounds were acting on the intended target. Contrary to these observations, we find that compound SW314, one of the compounds used in the Mageed et al. study and previously shown to be active against M. tuberculosis pantothenate synthetase in vitro, is inactive against the T. gondii pantothenate synthetase and does not inhibit tachyzoite proliferation, despite gaining access into the parasite in situ. Furthermore, we validate the recent observation that the pantothenate synthetase gene in T. gondii can be disrupted without detrimental effect to the survival of the tachyzoite-stage parasite in the presence or absence of extracellular pantothenate. We conclude that the T. gondii pantothenate synthetase is not essential during the tachyzoite stage of the parasite and it is therefore not a target for drug discovery against T. gondii tachyzoites.

Keywords: Pantothenate synthetase, Pantoate β-alanine ligase, T. gondii, SW314, Pantothenate, PanC

Graphical abstract

Image 1

Highlights

  • •

    T. gondii tachyzoites do not rely on pantothenate biosynthesis for survival.

  • •

    An inhibitor of M. tuberculosis pantothenate synthetase is inactive against T. gondii.

  • •

    The MtbPS inhibitor does not inhibit the T. gondii pantothenate synthetase.

1. Introduction

Toxoplasma gondii is an apicomplexan parasite that is capable of infecting warm-blooded animals. Human infection mainly occurs by the ingestion of contaminated food or water and approximately 30% of the human population is infected globally (Tenter et al., 2000; CDC, 2021). A T. gondii infection may result in toxoplasmosis, a disease characterised by mild flu-like symptoms in otherwise healthy individuals. A primary T. gondii infection during pregnancy can harm the developing foetus and can cause congenital disease (Moncada and Montoya, 2012). Disease is caused by the tachyzoite stage of the parasite, which proliferates in nucleated cells until controlled by the immune system. Some tachyzoites can convert into a slower-growing bradyzoite stage, which persist for the lifetime of the infected host in tissue cysts that evade clearance by the immune system (Dubey et al., 1997; Jerome et al., 1998). Bradyzoites can revert back to tachyzoites in immunocompromised individuals, leading to complications, including death (Dubey et al., 1997; Tanuma et al., 2016).

The traditional treatment of toxoplasmosis in humans is a combination of pyrimethamine and sulfadiazine, a drug combination that can cause serious side effects (Alday and Doggett, 2017). A small number of additional compounds can be used, however these have been found to be less effective (Alday and Doggett, 2017). There is also evidence of parasite resistance to current treatments (Alday and Doggett, 2017). The identification of novel drug targets is therefore essential for the discovery of new, effective and safe drugs against T. gondii.

Pantothenate (vitamin B5) synthesis, and the coenzyme A (CoA) biosynthesis pathway (Fig. 1) for which pantothenate serves as the first substrate (Spry et al., 2008), have been under investigation as potential drug targets in various microorganisms, including Mycobacterium tuberculosis (Chiarelli et al., 2018; Kumar et al., 2007; Butman et al., 2020) and Staphylococcus aureus (Akinnusi et al., 2011). CoA biosynthesis, a five step, enzyme-mediated pathway (Fig. 1), is essential for organisms - CoA has been estimated to be involved in approximately 9% of all enzymatic reactions within cells (Strauss, 2010). CoA contributes to vital cellular processes, including lipid synthesis and the tricarboxylic acid cycle (Leonardi and Jackowski, 2007). The CoA biosynthesis pathway in T. gondii has only recently been investigated and shown to be critical for tachyzoite proliferation (Lunghi et al., 2022; Tjhin et al., 2021).

Fig. 1.

Fig. 1

Pantothenate biosynthesis and the CoA biosynthesis pathway. Pantothenate synthetase (PS) catalyses the condensation of β-alanine and pantoate to form pantothenate. Pantothenate is then processed by the five enzymes in the CoA biosynthesis pathway. Pantothenate kinase (PanK), produces 4'-phosphopantothenate. This is then converted to 4'-phosphopantothenoylcysteine by phosphopantothenoylcysteine synthetase (PPCS) and further metabolised into 4'-phosphopantetheine by the enzyme phosphopantothenoylcysteine decarboxylase (PPCDC). Phosphopantetheine adenylyltransferase (PPAT) catalyses the conversion of 4'-phosphopantetheine into dephospho-CoA, and, in the final step, dephospho-CoA kinase (DPCK) metabolises dephospho-CoA to yield CoA.

Many organisms, including the malaria-causing parasite Plasmodium falciparum (Saliba et al., 1998), require an exogenous supply of the vitamin pantothenate. Other organisms, such as plants (Raman and Rathinasabapathi, 2004), yeast (Olzhausen et al., 2009) and bacteria, including E. coli and M. tuberculosis (Cronan et al., 1982; Sambandamurthy et al., 2002), are capable of pantothenate biosynthesis. The final step of de novo pantothenate biosynthesis involves the condensation of β-alanine with pantoate (Fig. 1), a reaction catalysed by the enzyme pantothenate synthetase (PS) (Zheng and Blanchard, 2001), also referred to as pantoate β-alanine ligase (PBAL). In bacteria, PS is coded for by the gene panC (Cronan et al., 1982; Sambandamurthy et al., 2002). The ability of M. tuberculosis to synthesise pantothenate reduces (or potentially eliminates) the requirement for an exogenous supply of the vitamin (Sambandamurthy et al., 2002). Humans cannot synthesise pantothenate and must therefore acquire it from their diet, increasing the appeal of PS as a potential drug target.

The T. gondii genome includes a gene predicted to code for a PS, termed herein as TgPS (TGME49_265870). A 2014 study by Mageed et al., found that potent inhibitors of the M. tuberculosis PS (Hung et al., 2009, 2016) inhibited the growth of the T. gondii tachyzoites in a manner that could be antagonised by increasing the pantothenate concentration in the culture medium by 12.5-fold. This was consistent with the inhibitors targeting pantothenate biosynthesis in the parasite and with TgPS activity being essential to T. gondii during the tachyzoite stage. This led the authors to suggest that TgPS was a potential drug target (Mageed et al., 2014).

In this study we have reinvestigated the importance of pantothenate biosynthesis in T. gondii during the tachyzoite stage. Consistent with a recent study (Lunghi et al., 2022), we show that T. gondii tachyzoite proliferation is unaffected by knockdown or knockout of TgPS, in both the presence and absence of extracellular pantothenate. We have also retested one of the M. tuberculosis PS inhibitors (SW314) previously shown by Mageed et al. (2014) to inhibit T. gondii tachyzoite proliferation. We found no activity against TgPS as well as no impact on parasite proliferation, despite the compound inhibiting the M. tuberculosis pantothenate synthetase in vitro and gaining access to the T. gondii parasite cytosol.

2. Materials and methods

2.1. Plasmid preparation and confirmation of genetic modifications

2.1.1. TgPS knockdown

To produce an anhydrotetracycline (ATc)-regulatable TgPS knockdown line, we replaced the native promoter of TgPS with an ATc-regulated promoter, simultaneously introducing a 3×HA tag at the 5′ end of the TgPS open reading frame. We first amplified the 3′ flank of the TgPS gene with the primers 5′-GATCACCGGTATGGAAACTCGCCACTCGCTCG and 5′- GATCGGGCCCCTCGCCTTCTGCCTGTCTGCC. The resulting PCR product was digested with AgeI and NotI and ligated into the XmaI and NotI sites of the vector pPR2-HA3 (Katris et al., 2014). We next amplified the 5′ flank of TgPS with the primers 5′- GACTTTAATTAACGTAGCCACATTCTTGCGTTCG and 5′-GATCATGCATAAGACAGCGAAACGACGCACG. This PCR product was digested with PacI and NsiI and ligated into the equivalent sites of the pPR2-HA3 vector containing the 3′ TgPS flank. The resultant vector was digested with PacI, transfected into TATi/Δku80 strain parasites (Sheiner et al., 2011), and selected on 1 μM pyrimethamine. Clonal parasites were screened for successful integration of the ATc-regulatable promoter by PCR of genomic DNA with the primers 5′-CGTTCTGCCGCTGGGTAAG and 5′-GCTGTCTCTGCACTTACATGTTGC to detect the presence of the native locus and the primers 5′-ACGCAGTTCTCGGAAGACG and 5′-GCTGTCTCTGCACTTACATGTTGC to detect the presence of the modified locus. We termed the resulting ATc-regulatable strain rHA3-TgPS.

2.1.2. TgPS knockout

To produce a TgPS knockout line, an insertion mutation was generated in the TgPS open reading frame. We first generated a vector expressing a single guide (sg) RNA targeting the region in the open reading frame of TgPS. The pSAG1::Cas9-U6::sgUPRT vector (Addgene plasmid # 54467 (Shen et al., 2014)) was modified using Q5 mutagenesis with the forward primer 5′-GCGGCCGGGGCTTGGAAGACGTTTTAGAGCTAGAAATAGCAAG (PS-specific sgRNA underlined) and the Universal Reverse primer (5′-AACTTGACATCCCCATTTAC) as described previously (Shen et al., 2014). This vector was transfected into TATi/Tomato strain parasites (Parker et al., 2019). Successful frameshift mutations were confirmed by direct sequencing with forward primer 5′- GAGAAATCGAAGATGTGGGAAC and reverse primer 5′-GTGTGTCTCGATCCTTTTCACA. We termed the resultant strain ΔTgPS.

2.1.3. Parasite and host cell culture

Unless otherwise indicated, T. gondii parasites were cultured in human foreskin fibroblasts (HFF cells) as previously described (Jacot et al., 2020). Parasites were cultured in Dulbecco's modified Eagle's medium (DMEM) or Roswell Park Memorial Institute (RPMI) 1640, both supplemented with 1% (v/v) foetal calf serum, 50 units/ml penicillin, 50 μg/ml streptomycin, 10 μg/ml gentamicin, 0.25 μg/ml amphotericin b, and, in DMEM, an additional 0.2 mM L-glutamine. Where relevant, ATc was added to cultures at a final concentration of 0.5 μg/ml, with ethanol (0.025% v/v) added as a vehicle control in matched conditions.

Pantothenate-free media: Pantothenate-free DMEM was used to generate some of the data shown in Fig. 2. This was prepared by adding all the standard components of DMEM but excluding pantothenate (which is normally added to a final concentration of 16.8 μM). Where experiments required pantothenate, the pantothenate-free medium was supplemented with 16.8 μM of pantothenate. Commercially produced pantothenate-free RPMI 1640 was used to generate some of the data shown in Fig. 2, Fig. 3. Where experiments required pantothenate-free medium in addition to normal pantothenate and/or excess pantothenate medium, the pantothenate-free medium was supplemented with either 16.8 μM or 210 μM, respectively, as described in the Mageed et al. (2014) study.

Fig. 2.

Fig. 2

Proliferation of T. gondii tachyzoites is unaffected when cultured in medium lacking pantothenate. TgPS is located in the parasite nucleus and is dispensable for tachyzoite proliferation. A. Plaque assays showing zones of cell clearance in the HFF monolayers caused by T. gondii parasites cultured in medium containing (left) or lacking (right) pantothenate (16.8 μM; the standard concentration present in DME culture medium). Dialysed FBS was used in the culture medium to ensure that pantothenate was not introduced into the medium via the serum. B. Parasite proliferation over a period of five days maintained in medium lacking pantothenate (white circles) or containing excess pantothenate (210 μM; black circles). Data are averaged from four independent experiments, each carried out in triplicate. Only positive or negative error bars (SEM) are shown for clarity. C. Western blot analysis of lysates prepared from parasites expressing HA-tagged TgPS. The predicted molecular mass of HA3-TgPS is 88 kDa. D. Immunofluorescence assay of rHA3-TgPS parasites probed with anti-HA antibodies (red), antibodies against the plasma membrane protein P30 (green), and the nuclear dye DAPI (blue). DIC, differential interference contrast image of a four-cell vacuole. Scale bar, shown in the merged image, is 2 μm. E. Western blot of proteins extracted from rHA3-TgPS parasites cultured for 0–2 days on ATc, and probed with anti-HA antibodies to detect PS of HA3-TgPS parasites or anti-GRA8 antibodies as a loading control. F. Plaque assays measuring proliferation of rHA3-TgPS parasites in the presence or absence of ATc and maintained in culture medium containing or lacking pantothenate (16.8 μM). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

Fig. 3.

Fig. 3

SW314 does not inhibit proliferation of T. gondii wild-type or ΔTgPS tachyzoites. A. SW314 activity against proliferation of wild-type (left) and ΔTgPS (right) T. gondii tachyzoites maintained in culture medium containing (white circles) and lacking (black circles) extracellular pantothenate (210 μM). Dialysed FBS was used in the culture medium to ensure that pantothenate was not introduced into the medium via the serum. Data are averaged from three independent experiments, each carried out in triplicate. Error bars represent SEM. For clarity, only positive or negative error bars are shown. Inset shows the structure of compound SW314. B. The effect of pyrimethamine against wild-type parasites in the absence (white circles, IC50 = 0.32 ± 0.01 μM) and presence of pantothenate (black circles, IC50 = 0.33 ± 0.03 μM; CI = −0.09064 to 0.1080 μM). C. The effect of SW314 on the activity of heterologously-expressed and purified MtbPS. Data are averaged from two independent experiments, each carried out in triplicate. Error bars represent range/2.

Experiments shown in Fig. 2 were generated using dialysed Foetal Bovine Serum (dFBS; Sigma-Aldrich, catalogue number F0392, which is assumed to be pantothenate-free) instead of the standard fetal calf serum. dFBS (Pan Biotech P30-2102; 10,000 Da exclusion size membrane) was also used in the liquid chromatography-mass spectrometry (LC-MS) experiments described below – and was previously shown not to contain detectable levels of pantothenate as measured by gas chromatography-mass spectrometry (GC-MS) (Lunghi et al., 2022).

2.1.4. Parasite proliferation assays

Plaque assays were carried out for wild-type and rHA3-TgPS parasite lines. Plaque assays were performed as previously described (Jacot et al., 2020). rHA3-TgPS parasites were incubated for 9 days in the presence or absence of ATc, and either in the presence or absence of pantothenate, then stained with a Crystal Violet solution (Hucker's formulation, Fronine).

Fluorescent parasite proliferation assays were performed by monitoring proliferation of tdTomato-expressing parasites as previously described (Rajendran et al., 2017; Gubbels et al., 2003). Optical bottom 96-well plates containing confluent HFF host cells were washed twice with pantothenate-free DMEM medium before the assay. Medium lacking pantothenate, or containing normal (16.8 μM final concentration) or high (210 μM final concentration) levels of pantothenate, and/or containing serial dilutions of potential inhibitors (pyrimethamine or SW314), were added to the wells. Wells were seeded with 2,000 parasites (TATiΔku80 or ΔTgPS lines), and plates were incubated at 37 °C in a 5% CO2 humidified incubator. Fluorescence was measured (excitation/emission, 540/590 nm) twice a day for 5–7 days with a FLUOstar OPTIMA Microplate Reader (BMG LABTECH). Fluorescence from wells seeded with parasites and treated with a pyrimethamine concentration (5 μM) that completely inhibits parasite proliferation was subtracted as the background fluorescence from all the other wells. The resulting data were then plotted and a sigmoidal curve was fitted to the data to identify the day in which the parasites were in mid-exponential growth. The readings on that day were then used to generate dose-response curves.

2.1.5. Microscopy

To determine the subcellular localisation of the HA-tagged TgPS protein, immunofluorescence assays were performed as previously described (van Dooren et al., 2008). Infected host cells were fixed and permeabilised, then incubated in rat anti-HA (1:100 dilution; Sigma clone 3F10) and mouse anti-p30 (1:500 dilution; Abcam clone TP3) primary antibodies. The secondary antibodies used were Alexa Fluor 488 goat anti-rat (1:200 dilution; Thermo Fisher Scientific, catalogue number A-11006) and Alexa Fluor546 goat anti-mouse (1:500 dilution; Thermo Fisher Scientific, catalogue number A-11030). The nucleus was stained with 4′,6-diamidino-2-phenylindole (DAPI). Immunofluorescence images were acquired on a DeltaVision Elite system (GE Healthcare) using an inverted Olympus IX71 microscope with a 100 × UPlanSApo oil immersion lens (Olympus) paired with a Photometrics CoolSNAP HQ2 camera. Images taken on the DeltaVision setup were deconvolved using SoftWoRx Suite 2.0 software. Images were adjusted linearly for contrast and brightness.

2.1.6. Western blotting

Western blotting was carried out as described by van Dooren et al. (2008). Proteins were separated by SDS-PAGE then transferred to a nitrocellulose membrane. This membrane was probed using rat anti-HA (1:250 dilution; Sigma clone 3F10) and mouse anti-GRA8 (1:50,000 dilution (Carey et al., 2000);) primary antibodies. The membrane was probed with goat anti-rat (Abcam, catalogue number ab97057) and goat anti-mouse (Abcam, catalogue number ab6789) IgG conjugated to horseradish peroxidase, both at 1:5000 dilutions. To visualise proteins, the membrane was treated with enhanced chemiluminescence (ECL) Plus western blotting substrate (Pierce) and exposed to autoradiography film.

2.1.7. Synthesis of SW314

SW314 was synthesised and purified as described previously (Hung et al., 2016). The synthesis was carried out in the same laboratory that synthesised the SW314 supplied to Mageed et al. (2014), but was undertaken by a different individual.

2.1.8. MtbPS enzyme assay

M. tuberculosis pantothenate synthetase was overexpressed in E. coli using the pET30-PanC expression vector previously generated by Wang and Eisenberg (2003). Overexpression was carried out as described elsewhere (Hung et al., 2016), except that expression was performed overnight at 25 °C. Purification was performed according to the method reported by Hung et al. (2016), with minor modifications. Cell pellets were resuspended in a lysis buffer composed of 50 mM sodium phosphate (pH 8.0), 500 mM NaCl, 10 mM imidazole and 1 x EDTA-free cOmplete Protease Inhibitor Cocktail (Roche). Thereafter, the cells were lysed using an Avestin Emulsiflex High Pressure Homogeniser. Insoluble material was removed from the lysate by centrifugation at 35,000×g for 30 min. The cell lysate was then loaded onto a 5 mL HisTrap FF column (GE Healthcare), which had been pre-equilibrated with lysis buffer. The column was washed with lysis buffer, before MtbPS was eluted from the column by increasing the imidazole concentration to 500 mM over 20 column volumes. The eluate was concentrated to ≤10 mL and injected onto a Superdex-200 Hiload 26/60 column previously equilibrated with 50 mM Tris (pH 7.6), 150 mM NaCl, 5 mM MgCl2. The protein was concentrated to ≥10 mg/mL, then divided into aliquots, flash frozen, and stored at −80 °C.

MtbPS activity was measured by coupling the formation of AMP to the oxidation of NADH using three other enzymes, myokinase, pyruvate kinase and lactate dehydrogenase, as done previously (Hung et al., 2016; Zheng and Blanchard, 2001). The decrease in absorbance of NADH at 340 nm was measured using a FLUOstar OPTIMA Microplate Reader (BMG LABTECH). Assays were performed essentially as described by Hung et al. (2016), at a temperature of 25 °C, and in clear 96-well plates. Reactions were composed of 50 mM HEPES, pH 7.6, 50 mM NaCl, 5 mM MgCl2, 1.5 mM potassium phosphoenolpyruvate, 100 nM MtbPS, 0.2 mM NADH, 25 U/ml pyruvate kinase, 25 U/ml myokinase, 30 U/ml lactate dehydrogenase, 4 mM pantoate, 4 mM β-alanine, 0.32 mM ATP, and the inhibitor in dimethylsulfoxide (DMSO; final concentration 10%, v/v). The pantoate for the reaction was prepared by dissolving pantolactone (130 mg, 1.0 mmol) in a solution of NaOH (1 M, 1 ml) and incubating at room temperature for 2 h (King et al., 1974). Wells lacking inhibitor, but containing a corresponding concentration of DMSO, served as uninhibited reaction controls, and wells lacking pantoate, β-alanine and ATP, served as no reaction controls. Assays, which were performed in duplicate, were initiated by mixing equal volumes of a solution containing the enzymes, with a solution containing the MtbPS substrates and inhibitor/DMSO. In each assay, the initial change in absorbance over time was determined from the first 6–37 min of the reaction. The average initial change in absorbance over time determined for the ‘no reaction’ control wells was subtracted from the initial rates determined for all other wells. The corrected reaction rates were thereafter expressed as a percentage of the average (corrected) initial rate determined for the uninhibited control wells. Using Prism (version 9), the data were fitted with straight lines.

2.1.9. In situ SW314 uptake and activity experiment

RHΔku80 strain T. gondii parasites were incubated in standard DME medium (Gibco, 41,965,039) supplemented with 5% FCS and 40 μg/ml gentamicin or in pantothenate-free DME medium (custom made based on Gibco, 41,965,039) and supplemented with 5% dFBS (Pan Biotech P30-2102; 10,000 Da exclusion size membrane). The pantothenate-free medium was supplemented with 0.8 mM pantoate (Sigma, 16682) and 0.8 mM 13C3/15N-β-alanine (Cambridge Isotope Laboratories, CNLM-3946). SW314 was added at the desired concentration from a 200 mM stock in DMSO. Following 40 h of growth in the indicated medium, the medium was gently aspirated and freshly egressing parasites rinsed with 5 ml ice-cold phosphate-buffered saline (PBS) to quench the metabolism. All subsequent steps were carried out on ice, or at 4 °C for centrifugations. Intact host cells were scraped from the dish, parasites were released from host cells by passing the cell suspension three times through a 26 G needle, and host cell debris was removed by filtering the cell solution through a filter membrane (3 μm exclusion size, Millipore, TSTP04700). The filter was rinsed with an additional 10 ml ice-cold PBS to maximize the yield of parasites. Parasites (108 cells) were pelleted by centrifugation (2,200 g, 10 min, 4 °C) and washed twice more with ice-cold PBS, before removing all residual PBS and storing parasite pellets at −80 °C.

Metabolites were extracted by adding 120 μl ultrapure water:acetonitrile (1:4) containing 80 μM 13C6/15N isoleucine (Cambridge Isotope Laboratories, CNLM-562) as an internal standard and vortexing samples vigorously. Insoluble material was pelleted (21,000 g, 6 min, 4 °C) and 100 μl from the supernatant transferred to mass spectrometry glass vials with inserts and stored at −80 °C until the day of the analysis. Samples were analysed by hydrophilic interaction ultra high performance liquid chromatography mass spectrometry (HILIC UHPLC-MS) using a ThermoFisher Scientific Q Exactive Plus coupled to an UltiMate 3000 RSLC. The UHPLC system was equipped with a BEH Amide column (150 mm × 2.1 mm ID, 1.7 μm particles) and its 5 mm VanGuard cartridge (Waters). Mobile phases and Mass Spectrometry (MS) conditions were as described previously (Lunghi et al., 2022). The deprotonated ions of SW314 (m/z 469.0687) and pantothenate (m/z 218.1034) were detected in negative electrospray ionisation mode, eluting at 0.96 and 1.55 min, respectively. Data was viewed using Xcalibur (ThermoFisher Scientific) and converted to mzML format using ProteoWizard MSConvert (version 3.0) (Chambers et al., 2012). Labelling was determined by measuring the pantothenate isotopologue abundance using El-Maven (M0-M7) (Agrawal, 2019; Clasquin et al., 2012) and expressed as percent labelling following correction for natural abundance (Zamboni et al., 2009).

2.1.10. Data analysis and statistics

Values are presented as means ± standard errors of the means (SEM) unless otherwise indicated. Linear regression, nonlinear regression, 95% confidence intervals (CI) analyses of the difference between the means, and two-sided student t-tests were carried out using Prism version 9 (Graphpad, Inc).

3. Results and discussion

To investigate if intracellular T. gondii tachyzoites can proliferate without exogenous pantothenate, we initially measured T. gondii parasite proliferation using plaque assays. Plaques, cleared areas in the host cell monolayer, are formed as a result of several lytic cycles that parasites progress through and include invasion, intracellular proliferation and egress and lead to destruction of the host cells. Plaque size can be correlated with parasite proliferation and the ability to invade and egress. T. gondii parasites were incubated for 8–10 days in the presence or absence of pantothenate in the culture medium. We found that the sizes of plaques under both conditions were indistinguishable (Fig. 2A). As a more quantitative means of testing whether T. gondii parasites can proliferate in the absence of exogenous pantothenate (i.e. culture medium lacking pantothenate), we undertook a fluorescence proliferation assay. We cultured tdTomato-expressing parasites (Parker et al., 2019) in medium lacking or containing pantothenate for five days, and determined well fluorescence daily as a measure of parasite proliferation. T. gondii tachyzoite proliferation rates were similar, irrespective of whether parasites were cultured in the presence or absence of exogenous pantothenate (Fig. 2B). A similar observation was noted by Mageed et al. (2014; although the relevant data were not presented in their manuscript) and, more recently, by Lunghi et al. (2022). The data in Fig. 2A and B are consistent with T. gondii tachyzoites not requiring a supply of pantothenate in the culture medium. It has been recently shown that pantothenate kinase, the CoA biosynthesis pathway enzyme that converts pantothenate to 4′-phosphopantothenate (Fig. 1), is essential for T. gondii tachyzoite proliferation (Lunghi et al., 2022; Tjhin et al., 2021). This is consistent with the parasites requiring a source of pantothenate. Tachyzoites must therefore either synthesise pantothenate and/or salvage sufficient pantothenate from the extracellular medium or from CoA degradation in the host cell (Naquet et al., 2020).

T. gondii parasites encode a candidate pantothenate synthase enzyme (TGME49_265870). To assess whether TgPS is important for parasite proliferation, we replaced the native promoter of TgPS with a regulatable promoter that allows inducible suppression of TgPS transcription by the addition of anhydrotetracycline (ATc). An N-terminal 3 × HA-tag was simultaneously introduced into the TgPS open reading frame to enable detection of the protein. We refer to these transgenic parasites as rHA3-TgPS. Western blotting revealed that the resulting HA3-TgPS protein had a molecular mass close to the predicted mass of 88 kDa (Fig. 2C). Immunofluorescence microscopy indicated that the HA3-TgPS protein localises to the parasite nucleus (Fig. 2D). A similar localisation pattern for TgPS has recently been reported with a different tag (Lunghi et al., 2022). To determine the extent of HA3-TgPS protein knockdown upon the addition of ATc, we incubated rHA3-TgPS parasites in the presence of ATc over two days. The addition of ATc led to a considerable decrease in the abundance of HA3-TgPS within one day of ATc addition, and the protein was essentially undetectable after 2 days (Fig. 2E). To determine whether the decrease in the expression of TgPS affected parasite proliferation, we carried out plaque assays to compare parasite proliferation in the presence or absence of ATc, and in the presence or absence of extracellular pantothenate (16.8 μM). Knockdown of HA3-TgPS did not affect the number or size of plaques present following a 9-day incubation in either the presence or absence of pantothenate. Overall, the data in Fig. 2E and F are consistent with TgPS not being essential for parasite proliferation during the parasite's intracellular tachyzoite stage, irrespective of whether pantothenate is present or not.

The knockdown of HA3-TgPS protein upon addition of ATc (Fig. 2), although substantial, might be insufficient to fully deplete the TgPS protein. We therefore cannot rule out the possibility that residual TgPS is sufficient to synthesise enough pantothenate to allow parasite proliferation. As an alternative approach to test the importance of TgPS for parasite proliferation, we used CRISPR/Cas9 genome editing to generate a parasite strain in which the TgPS open reading frame was disrupted, generating a TgPS ‘knockout’ strain, termed ΔTgPS, which has a 51 bp insertion in exon 3, as confirmed by Sanger Sequencing (Fig. S1). This insertion introduces a stop codon into the PS coding sequence, which in turn leads to a truncation of the PS open reading frame and resulting protein (Fig. S1).

We generated the ΔTgPS parasites in a background strain expressing tdTomato red fluorescent protein, enabling a quantitative, fluorescence-based measurement of parasite proliferation. To assess the importance of TgPS for tachyzoite proliferation, we cultured ΔTgPS parasites in the presence or absence of excess pantothenate (210 μM) over a period of five days and measured proliferation using the fluorescence proliferation assay. We found that there was no difference in proliferation of ΔTgPS parasites cultured in the absence or presence of pantothenate (Fig. S1). This is consistent with our TgPS knockdown data (Fig. 2F), and supports the recent observation by Lunghi et al. (2022) that TgPS is dispensable for T. gondii parasite proliferation during the tachyzoite stage.

It is difficult to reconcile our data (Fig. 2 and Fig. S1) and those of Lunghi et al. (2022) on the dispensability of TgPS for tachyzoite proliferation with those presented in the Mageed et al. (2014) paper. Mageed et al. found that a number of M. tuberculosis PS inhibitors (Hung et al., 2009, 2016) were effective inhibitors of T. gondii tachyzoite proliferation in vitro, some with sub-micromolar IC50 values. Mageed et al. (2014) also found that the anti-Toxoplasma effect of the compounds could be substantially antagonised by increasing the extracellular concentration of pantothenate, consistent with the compounds inhibiting parasite proliferation by inhibiting TgPS. Since our results, and those of Lunghi et al. (2022), indicate that TgPS is dispensable for tachyzoite proliferation, we set out to re-visit the data presented in the Mageed et al. (2014) study using one of the MtbPS inhibitors (SW314; Fig. 3A) used in their study.

To assess the effect of SW314 against T. gondii tachyzoites, we measured the proliferation of ΔTgPS and wild-type tdTomato-expressing parasites over a period of 5–7 days, with increasing concentrations of SW314 and using culture medium containing or lacking pantothenate (210 μM). We observed no effects on parasite proliferation at any of the tested concentrations of SW314 (Fig. 3A), the highest of which was almost 300 times the IC50 value previously reported by Mageed et al. (2014). As a positive control, we measured parasite proliferation in the presence of the anti-Toxoplasma agent pyrimethamine, observing a potent inhibition of proliferation in both WT and ΔTgPS parasites, similar to those reported previously (Radke et al., 2018). In a similar experiment, Mageed et al. (2014) found an 8-fold decrease in the effectiveness of pyrimethamine when the parasites were maintained in the presence of a high concentration of pantothenate. In our hands there was no difference in pyrimethamine inhibition of the proliferation of both ΔTgPS and wild-type parasites in the presence and absence of a supply of pantothenate (210 μM) in the culture medium (Fig. 3B and Fig. S2).

One possibility for the discrepancy between our study and that of Mageed et al. (2014) is that our stock of SW314 had degraded. To test whether our SW314 remained active, we tested its ability to inhibit MtbPS activity in an in vitro assay. SW314 was found to be an effective inhibitor of the MtbPS enzyme, with an IC50 of 0.47 ± 0.20 μM (Fig. 3C and Fig. S3), in line with previously published data (Hung et al., 2016). This observation is consistent with the compound being intact and active.

Finally, we tested the ability of SW314 to inhibit TgPS in situ. Lunghi et al. recently demonstrated that T. gondii tachyzoites take up exogenous pantoate and β-alanine and synthesise pantothenate in a TgPS-dependent manner (Lunghi et al., 2022). Using stable isotope-labelled β-alanine (13C3/15N-β-alanine), synthesised pantothenate (M+4, labelled) can be distinguished from pre-existing or salvaged pantothenate (M0, unlabelled). If SW314 inhibits TgPS, a reduction of pantothenate synthesis in the presence of SW314 is expected, in a concentration-dependent manner. To test this, we incubated T. gondii tachyzoites, shortly after invasion, in pantothenate-free medium supplemented with dFBS, pantoate and 13C3/15N-β-alanine, as well as different concentrations of SW314, ranging from 0.1 to 20 μM. After 40 h, the metabolism of freshly egressing parasites was quenched, parasites harvested, metabolites extracted and analysed by LC-MS. Prior to the analysis of parasite extracts, a standard of SW314 was analysed by HILIC-UHPLC-MS and was readily detected at 0.96 min retention time at m/z 469.0687 in negative mode. This represents the deprotonated ion consistent with the calculated accurate mass of 470.0759. We readily detected SW314 in extracts of parasites that had been washed after being treated with the compound (Fig. 4A), indicating that the parasites can take up the compound and further validating that the compound remained intact. As expected, the compound was not detected in untreated samples, while very low signal and considerable signal were detected parasites were treated with 1 and 10 μM, respectively. We found that in situ synthesis of labelled pantothenate from 13C3/15N-β-alanine and pantoate (Fig. 4B) was not reduced in the presence of SW314, at any of the concentrations tested (Fig. 4C), consistent with the compound not inhibiting TgPS.

Fig. 4.

Fig. 4

SW314 does not inhibit pantothenate biosynthesis in situ in T. gondii RH tachyzoites. A. T. gondii tachyzoites were incubated with 13C3/15N-β-alanine in pantothenate-free DMEM for 40 h in the absence (top) or presence (bottom) of SW314 (20 μM) and metabolites from freshly egressed parasites extracted and analysed by HILIC-UHPLC-MS. The extracted ion chromatogram peak at 0.96 min represents the deprotonated ion [M−H]− of SW314 in negative mode (m/z 469.0687), which is absent in untreated parasites. B. Scheme showing the incorporation of labelled atoms from β-alanine into pantothenate in a PS-dependent manner. C. Percentage labelling in parasite-derived pantothenate in the absence, or presence of 0.1–20 μM SW314 and supplemented with pantoate as well as stable isotope labelled β-alanine (13C3/15N-β-alanine). Parasites not labelled with 13C3/15N-β-alanine are included as an unlabelled control. Data represent the mean of three independent biological replicates processed on the same day. Error bars represent SD. p-value comparing labelled sample and unlabelled control (two-sided student t-test) is given. Comparisons of labelled samples treated with different concentrations of SW314 were not significantly different from the untreated labelled samples (p-value>0.28).

It is unclear why we have not been able to reproduce the effect of SW314 on tachyzoite proliferation as observed by Mageed et al. (2014). Although the SW314 provided to Mageed et al. and used by us in this study was synthesised in the same lab (albeit by different team members), it is possible that an impurity or breakdown product was responsible for the anti-Toxoplasma activity observed by Mageed et al. However, in our view, the fact that Mageed et al. found that the inhibitory activity could be antagonised by added pantothenate to the culture medium makes it unlikely (although not impossible) that the activity was due to an impurity or breakdown product. It should also be noted that we were unable to demonstrate an antagonistic effect of added pantothenate on the anti-tachyzoite effect of pyrimethamine. This observation argues in favour of a more systematic effect rather than one that can be explained by an impurity in the SW314 stock used by Mageed et al.

Although the phosphorylation of pantothenate is essential for the proliferation of T. gondii during its tachyzoite stage (Tjhin et al., 2021), and T. gondii has the ability to synthesise pantothenate ((Lunghi et al., 2022) and Fig. 4B)), we have shown in this study that T. gondii tachyzoites are able to survive without TgPS, even in the absence of an extracellular supply of pantothenate (presumably because they can salvage sufficient pantothenate from the host cells). These data are consistent with a study by Lunghi et al. (2022), who found that TgPS was dispensable for tachyzoite proliferation and instead contributed to the development of the latent tissue cyst stage of the parasite. Our findings indicate that SW314 does not inhibit TgPS, and, further, that TgPS is not a viable drug target during the tachyzoite stage of the parasite.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgements

VMH was supported by a Research Training Program scholarship from the Australian Government. CS was funded by an NHMRC Overseas Biomedical Fellowship (1016357). This work was, in part, supported by a Discovery Grant (DP150102883) from the Australian Research Council to GGvD. AGC, CM and CA would like to thank Bill and Melinda Gates Foundation HIT-TB (OPP1024021) for funding. We are grateful to Professor Dominique Soldati-Favre (University of Geneva) for helpful comments on the manuscript.

Footnotes

Appendix A

Supplementary data to this article can be found online at https://doi.org/10.1016/j.ijpddr.2023.03.003.

Contributor Information

Giel G. van Dooren, Email: giel.vandooren@anu.edu.au.

Kevin J. Saliba, Email: kevin.saliba@anu.edu.au.

Appendix A. Supplementary data

The following is the Supplementary data to this article:

Multimedia component 1
mmc1.docx (414.8KB, docx)

References

  1. Agrawal S. In: High-Throughput Metabolomics. Methods in Molecular Biology. D’Alessandro A., editor. Humana; New York: 2019. EL-MAVEN: a fast, robust, and user-friendly mass spectrometry data processing engine for metabolomics. [DOI] [PubMed] [Google Scholar]
  2. Akinnusi T.O., Vong K., Auclair K. Geminal dialkyl derivatives of N-substituted pantothenamides: synthesis and antibacterial activity. Bioorg. Med. Chem. 2011;19:2696–2706. doi: 10.1016/j.bmc.2011.02.053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Alday P., Doggett J. Drugs in development for toxoplasmosis: advances, challenges, and current status. Drug Des. Dev. Ther. 2017;11:273–293. doi: 10.2147/DDDT.S60973. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Butman H.S., Kotzé T.J., Dowd C.S., Strauss E. Vitamin in the crosshairs: targeting pantothenate and coenzyme A biosynthesis for new antituberculosis agents. Front. Cell. Infect. Microbiol. 2020;10 doi: 10.3389/fcimb.2020.605662. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Carey K.L., Donahue C.G., Ward G.E. Identification and molecular characterization of GRA8, a novel, proline-rich, dense granule protein of Toxoplasma gondii. Mol. Biochem. Parasitol. 2000;105:25–37. doi: 10.1016/s0166-6851(99)00160-7. [DOI] [PubMed] [Google Scholar]
  6. CDC . Centers for Disease Control and Prevention; 2021. Toxoplasmosis [Online]cdc.gov/dpdx/toxoplasmosis Available: (Accessed 17 January 2021) [Google Scholar]
  7. Chambers M.C., Maclean B., Burke R., Amodei D., Ruderman D.L., Neumann S., Gatto L., Fischer B., Pratt B., Egertson J., Hoff K., Kessner D., Tasman N., Shulman N., Frewen B., Baker T.A., Brusniak M.-Y., Paulse C., Creasy D., Flashner L., Kani K., Moulding C., Seymour S.L., Nuwaysir L.M., Lefebvre B., Kuhlmann F., Roark J., Rainer P., Detlev S., Hemenway T., Huhmer A., Langridge J., Connolly B., Chadick T., Holly K., Eckels J., Deutsch E.W., Moritz R.L., Katz J.E., Agus D.B., Maccoss M., Tabb D.L., Mallick P. A cross-platform toolkit for mass spectrometry and proteomics. Nat. Biotechnol. 2012;30:918–920. doi: 10.1038/nbt.2377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chiarelli L.R., Mori G., Orena B.S., Esposito M., Lane T., De Jesus Lopes Ribeiro A.L., Degiacomi G., Zemanová J., Szádocka S., Huszár S., Palčeková Z., Manfredi M., Gosetti F., Lelièvre J., Ballell L., Kazakova E., Makarov V., Marengo E., Mikusova K., Cole S.T., Riccardi G., Ekins S., Pasca M.R. A multitarget approach to drug discovery inhibiting Mycobacterium tuberculosis PyrG and PanK. Sci. Rep. 2018;8:3187. doi: 10.1038/s41598-018-21614-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Clasquin M.F., Melamud E., Rabinowitz J.D. LC-MS data processing with maven: a metabolomic analysis and visualization engine. Current Protocols in Bioinformatics. 2012;37 doi: 10.1002/0471250953.bi1411s37. 14.11.1-14.11.23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cronan J.E., Jr., Littel K.J., Jackowski S. Genetic and biochemical analyses of pantothenate biosynthesis in Escherichia coli and Salmonella typhimurium. J. Bacteriol. 1982;149:916–922. doi: 10.1128/jb.149.3.916-922.1982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Dubey J.P., Speer C.A., Shen S.K., Kwok O.C.H., Blixt J.A. Oocyst-induced murine toxoplasmosis: life cycle, pathogenicity, and stage conversion in mice fed Toxoplasma gondii oocysts. J. Parasitol. 1997;83:870–882. [PubMed] [Google Scholar]
  12. Gubbels M.-J., Li C., Striepen B. High-throughput growth assay for Toxoplasma gondii using yellow fluorescent protein. Antimicrob. Agents Chemother. 2003;47:309–316. doi: 10.1128/AAC.47.1.309-316.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hung A.W., Silvestre H.L., Wen S., Ciulli A., Blundell T.L., Abell C. Application of fragment growing and fragment linking to the discovery of inhibitors of Mycobacterium tuberculosis pantothenate synthetase. Angew. Chem. Int. Ed. 2009;48:8452–8456. doi: 10.1002/anie.200903821. [DOI] [PubMed] [Google Scholar]
  14. Hung A.W., Silvestre H.L., Wen S., George G.P.C., Boland J., Blundell T.L., Ciulli A., Abell C. Optimization of inhibitors of Mycobacterium tuberculosis pantothenate synthetase based on group efficiency analysis. ChemMedChem. 2016;11:38–42. doi: 10.1002/cmdc.201500414. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Jacot D., Lourido S., Meissner M., Sheiner L., Soldati-Favre D., Striepen B. In: Toxoplasma gondii. third ed. WEISS L.M., KIM K., editors. Academic Press; 2020. Chapter 20 - genetic manipulation of Toxoplasma gondii. [Google Scholar]
  16. Jerome M.E., Radke J.R., Bohne W., Roos D.S., White M.W. Toxoplasma gondii bradyzoites form spontaneously during sporozoite-initiated development. Infect. Immun. 1998;66:4838–4844. doi: 10.1128/iai.66.10.4838-4844.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Katris N.J., van Dooren G.G., Mcmillan P.J., Hanssen E., Tilley L., Waller R.F. The apical complex provides a regulated gateway for secretion of invasion factors in Toxoplasma. PLoS Pathog. 2014;10 doi: 10.1371/journal.ppat.1004074. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. King H.L., Dyar R.E., Wilken D.R. Ketopantoyl Lactone and Ketopantoic Acid Reductases: characterization of the reactions and purification of two forms of ketopantoyl lactone reductase. J. Biol. Chem. 1974;249:4689–4695. [PubMed] [Google Scholar]
  19. Kumar P., Chhibber M., Surolia A. How pantothenol intervenes in Coenzyme-A biosynthesis of Mycobacterium tuberculosis. Biochem. Biophys. Res. Commun. 2007;361:903–909. doi: 10.1016/j.bbrc.2007.07.080. [DOI] [PubMed] [Google Scholar]
  20. Leonardi R., Jackowski S. Biosynthesis of pantothenic acid and coenzyme A. EcoSal Plus. 2007;2:2. doi: 10.1128/ecosalplus.3.6.3.4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Lunghi M., Kloehn J., Krishnan A., Varesio E., Vadas O., Soldati-Favre D. Pantothenate biosynthesis is critical for chronic infection by the neurotropic parasite Toxoplasma gondii. Nature Commun. 2022;13:345. doi: 10.1038/s41467-022-27996-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Mageed S.N., Cunningham F., Hung A.W., Silvestre H.L., Wen S., Blundell T.L., Abell C., Mcconkey G.A. Pantothenic acid biosynthesis in the parasite Toxoplasma gondii: a target for chemotherapy. Antimicrob. Agents Chemother. 2014;58:6345–6353. doi: 10.1128/AAC.02640-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Moncada P.A., Montoya J.G. Toxoplasmosis in the fetus and newborn: an update on prevalence, diagnosis and treatment. Expert Rev. Anti-infect. Ther. 2012;10:815–828. doi: 10.1586/eri.12.58. [DOI] [PubMed] [Google Scholar]
  24. Naquet P., Kerr E.W., Vickers S.D., Leonardi R. Regulation of coenzyme A levels by degradation: the ‘ins and outs. Prog. Lipid Res. 2020;78 doi: 10.1016/j.plipres.2020.101028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Olzhausen J., Schübbe S., Schüller H.-J. Genetic analysis of coenzyme A biosynthesis in the yeast Saccharomyces cerevisiae: identification of a conditional mutation in the pantothenate kinase gene CAB1. Curr. Genet. 2009;55:163–173. doi: 10.1007/s00294-009-0234-1. [DOI] [PubMed] [Google Scholar]
  26. Parker K.E.R., Fairweather S.J., Rajendran E., Blume M., Mcconville M.J., Bröer S., Kirk K., van Dooren G.G. The tyrosine transporter of Toxoplasma gondii is a member of the newly defined apicomplexan amino acid transporter (ApiAT) family. PLoS Pathog. 2019;15 doi: 10.1371/journal.ppat.1007577. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Radke J.B., Burrows J.N., Goldberg D.E., Sibley L.D. Evaluation of current and emerging antimalarial medicines for inhibition of Toxoplasma gondii growth in vitro. ACS Infect. Dis. 2018;4:1264–1274. doi: 10.1021/acsinfecdis.8b00113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Rajendran E., Hapuarachchi S.V., Miller C.M., Fairweather S.J., Cai Y., Smith N.C., Cockburn I.A., Bröer S., Kirk K., van Dooren G.G. Cationic amino acid transporters play key roles in the survival and transmission of apicomplexan parasites. Nat. Commun. 2017;8 doi: 10.1038/ncomms14455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Raman S.B., Rathinasabapathi B. Pantothenate synthesis in plants. Plant Sci. 2004;167:961–968. [Google Scholar]
  30. Saliba K.J., Horner H.A., Kirk K. Transport and metabolism of the essential vitamin pantothenic acid in human erythrocytes infected with the malaria parasite Plasmodium falciparum. J. Biol. Chem. 1998;273:10190–10195. doi: 10.1074/jbc.273.17.10190. [DOI] [PubMed] [Google Scholar]
  31. Sambandamurthy V.K., Wang X., Chen B., Russell R.G., Derrick S., Collins F.M., Morris S.L., Jacobs W.R. A pantothenate auxotroph of Mycobacterium tuberculosis is highly attenuated and protects mice against tuberculosis. Nat. Med. 2002;8:1171–1174. doi: 10.1038/nm765. [DOI] [PubMed] [Google Scholar]
  32. Sheiner L., Demerly J.L., Poulsen N., Beatty W.L., Lucas O., Behnke M.S., White M.W., Striepen B. A systematic screen to discover and analyze apicoplast proteins identifies a conserved and essential protein import factor. PLoS Pathog. 2011;7 doi: 10.1371/journal.ppat.1002392. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Shen B., Brown K.M., Lee T.D., Sibley L.D., Weiss L.M. Efficient gene disruption in diverse strains of Toxoplasma gondii using CRISPR/CAS9. mBio. 2014;5 doi: 10.1128/mBio.01114-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Spry C., Kirk K., Saliba K.J. Coenzyme A biosynthesis: an antimicrobial drug target. FEMS Microbiol. Rev. 2008;32:56–106. doi: 10.1111/j.1574-6976.2007.00093.x. [DOI] [PubMed] [Google Scholar]
  35. Strauss E. In: Comprehensive Natural Products II: Chemistry and Biology. MANDER L., LUI H.-W., editors. Elsevier Ltd; Oxford: 2010. Coenzyme A biosynthesis and enzymology. [Google Scholar]
  36. Tanuma J., Lee K.H., Haneuse S., Matsumoto S., Nguyen D.T., Nguyen D.T.H., Do C.D., Pham T.T., Nguyen K.V., Oka S. Incidence of AIDS-defining opportunistic infections and mortality during antiretroviral therapy in a cohort of adult HIV-infected individuals in hanoi, 2007-2014. PLoS One. 2016;11 doi: 10.1371/journal.pone.0150781. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Tenter A.M., Heckeroth A.R., Weiss L.M. Toxoplasma gondii: from animals to humans. Int. J. Parasitol. 2000;30:1217–1258. doi: 10.1016/s0020-7519(00)00124-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Tjhin E.T., Howieson V.M., Spry C., van Dooren G.G., Saliba K.J. A novel heteromeric pantothenate kinase complex in apicomplexan parasites. PLoS Pathog. 2021;17 doi: 10.1371/journal.ppat.1009797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. van Dooren G.G., Tomova C., Agrawal S., Humbel B.M., Striepen B. Toxoplasma gondii Tic20 is essential for apicoplast protein import. Proc. Natl. Acad. Sci. USA. 2008;105:13574–13579. doi: 10.1073/pnas.0803862105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Wang S., Eisenberg D. Crystal structures of a pantothenate synthetase from M. tuberculosis and its complexes with substrates and a reaction intermediate. Protein Sci. 2003;12:1097–1108. doi: 10.1110/ps.0241803. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Zamboni N., Fendt S.-M., Rühl M., Sauer U. 13C-based metabolic flux analysis. Nat. Protoc. 2009;4:878–892. doi: 10.1038/nprot.2009.58. [DOI] [PubMed] [Google Scholar]
  42. Zheng R., Blanchard J.S. Steady-state and pre-steady-state kinetic analysis of Mycobacterium tuberculosis pantothenate synthetase. Biochemistry. 2001;40:12904–12912. doi: 10.1021/bi011522+. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Multimedia component 1
mmc1.docx (414.8KB, docx)

Articles from International Journal for Parasitology: Drugs and Drug Resistance are provided here courtesy of Elsevier

RESOURCES