Skip to main content
NCBI home page
Heliyon logoLink to Heliyon
. 2023 Mar 28;9(4):e14983. doi: 10.1016/j.heliyon.2023.e14983

Dissimilatory nitrate reduction to ammonium in four Pseudomonas spp. under aerobic conditions

Xuejiao Huang a,b,∗, Luoluo a, Deti Xie b, Zhenlun Li b
PMCID: PMC10102415  PMID: 37064473

Abstract

Dissimilatory nitrate reduction to ammonium (DNRA) has an important role in soil nitrogen retention and is considered to be constrained to anaerobic conditions. However, a recent study found that Pseudomonas putida Y-9 is capable of DNRA under aerobic conditions. In this study, four species of Pseudomonas spp. were found to produce ammonium during the nitrite reduction process under aerobic conditions, similar to the Y-9 strain. The detectable ammonium in the culture supernatant during the nitrite reduction process for each of the four strains originated intracellularly. A subsequent 15N isotope experiment showed that these four strains were able to transform 15NO2− to 15NH4+ in 3 h under aerobic conditions. The NirBD sequence in each of the four strains showed high similarity with that in the Y-9 strain (approximately 94.61%). Moreover, the nirBD sequences in the four strains and the Y-9 strain were all similar to those of other Pseudomonas spp., while they were relatively distant in terms of their phylogenetic relationship from those of other genera. Overall, these results suggest that these four strains of Pseudomonas spp. are capable of DNRA under aerobic conditions, which might be attributed to the existence of nirBD.

Keywords: Dissimilatory nitrate reduction to ammonium, Aerobic conditions, 15N-incubation experiments, Pseudomonas spp., nirBD

1. Introduction

Nitrate (NO3−) leaching from upland ecosystems is a global environmental issue, as it leads to the contamination of ground and surface water [[1], [2], [3]]. Therefore, controlling the NO3− concentration of soil is essential. Nitrogen transformation pathways involving microorganisms in soil play a major role in controlling NO3− concentrations, in addition to the active limitations of ammonium and nitrate fertilizer applications. Denitrification can effectively remove excess NO3− from soil systems, but this generally leads to nitrogen loss in the form of either nitrogen gas or the greenhouse gas nitrous oxide (N2O) [4]. For example, Putz et al. [5] reported that approximately 70%–78% of the total N2O originates from denitrification in annual cereal soils. Dissimilatory nitrate reduction to ammonium (DNRA) competes with denitrification for NO3− and reduces it to ammonium (NH4+), which can then be retained by clay minerals in the soil [6]. Pandey et al. [7] found that NO3− reduced by DNRA (2.21–3.20 μg N/g soil/day) far exceeded that reduced during denitrification (0.17–0.42 μg N/g soil/day) in low N-input rice paddies (≤25 kg urea-N/ha). DNRA has recently received increasing attention owing to its role in nitrogen retention [[8], [9], [10]]. The phenomenon of DNRA in pure culture was discovered in 1938, after which bacteria with DNRA capabilities were separated from their respective ecological environments [11,12]. As NO3− is a less productive electron acceptor than O2, the reported DNRA bacteria were mostly obligate and facultative anaerobes, such as Clostridiaceae sp., Desulfovibrionaceae sp., Myxococcaceae sp., Thiotrichaceae sp., Enterobacteriaceae sp., and Vibrionaceae sp. (Table 1). Some aerobic bacteria such as Bacillus spp. and Pseudomonas spp. are also capable of DNRA under anaerobic conditions (Table 1), although the specific mechanisms remain unclear.

Table 1.

Physiological groups of common DNRA strains [53,54].

Strict anaerobic bacteria Facultative anaerobic bacteria Aerobic bacteria
Opitutus terrae PB90-1 Escherichia coli Pseudomonas spp.
Desulfomonile tiedjei DCB-1 Shewanella loihica strain PV-4 Pseudomonas aeruginosa
Ignavibacterium album JCM 16511 Photobacterium profundum SS9 Bacillus licheniformis
Sulfurospirillum deleyianum Caldilinea aerophila DSM 14535 Bacillus macerans
Clostridium spp. Aerobacter aerogenes Bacillus subtilis
Thiobacillus denitrificans Serratia marcescens Campylobacter sputorum
Desulfovibrio desulfuricans Marivirga tractuosa DSM 4126
Desulfobulbus propionicus Anaeromyxobacter sp. Fw109-5
Desulfobacterium spp. Citrobacter sp.
Thioploca spp. Erwinia carotovora
Veillonella alcaleseens Klebsiella pneumoniae
Kuenenia stuttgartiensis Vibrio spp.
Open in a new tab

Pseudomonas spp. are ubiquitous soil microorganisms [13] that can degrade pollutants such as lead [14], mercury [15], atrazine [16], and NO3− [17]. Most Pseudomonas spp., including Pseudomonas stutzeri LS-2 [18], Pseudomonas sp. 10CFM5-1B, Pseudomonas sp. 05CF15–5C, and Pseudomonas sp. 10CFM15-6A [19], can remove NO3− through denitrification. Additionally, some Pseudomonas spp. can reduce NO3− concentrations via DNRA under anaerobic conditions [20,21]. However, in our previous study, Pseudomonas putida Y-9, isolated from paddy soil, was found to be capable of DNRA under aerobic conditions [22]. Aside from the two strains of Pseudomonas spp. preserved in our lab [23,24], Pseudomonas alcaliphila Q1-2 obtained from a lab in Sichuan, China [25] and Pseudomonas stutzeri strain XL-2 [26] isolated from Chongqing, China, have also been shown to have the same abilities. Hence, it was hypothesized that Pseudomonas spp. are capable of DNRA under aerobic conditions.

In this investigation, DNRA capabilities were investigated in eight bacterial species (with strain Y-9 as a positive control) under aerobic conditions, using isotopic and molecular methods. The results of this study will improve our understanding of the DNRA pathway under aerobic conditions and could provide theoretical support for technical research on NO3− removal and nitrogen retention in soil.

2. Materials and methods

2.1. Microorganisms and culture media

The bacteria used in this study were P. putida Y-9 (Genbank No. KP410740) [27], P. taiwanensis J (Genbank No. KY927411) [28], P. tolaasii Y-11 (Genbank No. KP410741) [23], P. plecoglossicida Y-1 (Genbank No. KY927413) [29], Arthrobacter nicotianae D51 (Genbank No. KY927402) [30], and Arthrobacter arilaitensis Y-10 (Genbank No. KP410739) [31], all of which were isolated from the long-term flooded paddy soil in Guizhou province, China. Additionally, Serratia marcescens QZB-1 (Genbank No. MZ182358) [32] was isolated from lateritic red soil in Guangxi Province, China, and P. putida P (Genbank No. CCTCC AB 2014017) was purchased from the China Center for Type Culture Collection (CCTCC).

Denitrification medium (DM) [22] was used to evaluate the nitrite (NO2−) transformation abilities of these bacteria. The medium comprised 7.0 g K2HPO4, 3.0 g KH2PO4, 5.13 g CH3COONa, 0.10 g MgSO4•7H2O, 0.493 g NaNO2, and 0.05 g FeSO4•7H2O per liter (pH = 7.2). Our previous study found that the NO3− assimilation pathway in bacteria might interfere with the study of DNRA [33]. Nevertheless, there was almost no assimilation of NO2− observed in the short time (1 h) when NO2− was used as a substrate [22]. Consequently, NO2− is used as the substrate instead of NO3− to reduce the effects of NO3− assimilation [34]. Furthermore, Luria–Bertani (LB) medium was used for bacterial enrichment, and it contained 10 g NaCl, 10 g tryptone, and 5 g yeast extract per liter (pH 7.0–7.2). Conical flasks (250 mL capacity) containing 100 mL of medium were autoclaved for 30 min at 121 °C.

2.2. Ammonium production capacity of the strains

Experiments were performed to quantify NH4+ accumulation during NO2− reduction by eight bacteria, and Y-9 was used as a positive control. A single colony of each of the eight strains was cultured in 100 mL of LB medium at 15 °C for 36 h at 150 rpm. Subsequently, the culture medium was centrifuged at 4000 rpm for 8 min at 15 °C. The resultant pellet was then washed with sterilized water and inoculated in 100 mL of DM; the initial cell optical density at 600 nm (OD600) was approximately 0.3–0.5. The cultures were incubated at 15 °C under aerobic conditions of 150 rpm, and the concentration of dissolved oxygen in the cultures was maintained at 4–8 mg/L. The samples were periodically withdrawn from these systems to determine their OD600 as well as the concentrations of NO2− and NH4+. The influence of chloramphenicol (200 mg/L), which can inhibit bacterial growth [35], on NH4+ production during NO2− reduction with the strains was investigated. The cells were incubated in DM medium both with and without chloramphenicol at 15 °C in a rotary shaker at 150 rpm. The samples were periodically withdrawn from the system to determine the NH4+ concentration.

2.3. Determining the location of ammonium production

To further explore the location of NH4+ production, the intracellular and extracellular nitrogen transformation characteristics of the strains that produced NH4+ in NO2−-containing medium were examined. The strains that could produce NH4+ in the DM were grown in LB medium to the logarithmic phase of growth, and then transferred to DM medium for further cultivation; the initial OD600 was maintained at approximately 0.3–0.6. The control test was performed without inoculation. The culture medium was sampled to determine the OD600 and then centrifuged at 8000 rpm for 5 min. The supernatant was used to measure the concentrations (mg/L) of NO3−, NO2−, and NH4+ in the extracellular liquid. The pellet was washed twice with sterilized water and then broken in a cell fragmentation apparatus (MPFastPrep-24, USA) to detect the concentrations of NO3−, NO2−, and NH4+ within the cells.

2.4. 15N-incubation experiments

To further verify the NO2− reduction pathway in the strains that could produce NH4+, 15N-incubation experiments were performed. The strains were first activated in 100 mL of LB medium at 150 rpm and 15 °C for 36 h. Then, the bacterial suspension was inoculated into a 100 mL DM medium containing 100 mg/L NO3−. Finally, the cells in the logarithmic growth phase were washed with sterilized water and inoculated in 100 mL of DM medium containing 15 atom% Na15NO2 (Shanghai Chemical Research Institute Co., Ltd, China), and subsequently incubated for 3 h [22]. The above method was used to determine whether the NH4+ detected in the supernatant was caused by the death of the strains. Chloramphenicol (200 mg/L), which has the ability to avoid the assimilation of the generated NH4+ by strain Y-9 [22,34], was added to the Na15NO2 medium to inhibit bacterial growth in this study. All experiments were conducted at 15 °C and 150 rpm (the concentration of dissolved oxygen in the cultures was maintained between 4 and 8 mg/L). Non-seeded samples were used as controls. The samples were removed from the system after incubation to measure the OD600, the concentration and abundance of 15NH4+, 15NO3−, and 15NO2− in the supernatant, and abundance of 15N in the cells.

2.5. Amplification and analysis of the nirBD in the bacteria

In our previous study, nirBD in P. putida Y-9 was amplified and was able to catalyze the reduction of NO2− to NH4+ [22]. The PROSITE information of the NirBD proteins revealed N-glycosylation, N-myristoylation, and nitrite and sulfite reductase iron-sulfur/siroheme-binding sites (Table S1). Notably, the nitrite and sulfite reductase iron-sulfur/siroheme-binding sites were associated with the reduction of NO2− to NH4+ catalyzed by nitrite reductase [36]. Thus, this activity may explain why NirBD in strain Y-9 could catalyze NO2− reduction to NH4+. In this study, to determine whether the nirBD genes existed in the strains that could produce NH4+ under aerobic conditions, nirBD fragments from these strains were amplified and analyzed. Genomic DNA was extracted from each strain and purified using a BioSpin bacteria genomic DNA extraction kit (Merck Bioscience, India). Five primers (Table 2) were used for nirBD (related to NH4+ production) amplification. The PCR products were then separated on a 2% agarose gel and purified using a BioSpin gel extraction kit (BioFlux). This purified product was subsequently cloned into the pMD®20-T vector (Takara, Liaoning, China) and then sequenced by Beijing TsingKe Biotech Co., Ltd. Sequence alignment and multiple alignments were performed using multiple sequence alignment tool(http://multalin.toulouse.inra.fr/multalin/).

Table 2.

Sequences of primers used for nirBD amplification.

Primers Sequences
W619–F CTACGGCTACGACCAACTGG
W1472-R GCAGGGTGTCGTAGTAACTGTTGT
W1275–F ACATGTCGACCAAGCTCAAGCTG
W2015-R AGTAGGTGCCGTTTTTCTGCATG
W1716–F AGCAGGTATTCGAGCACGAACTG
W2511-R CGTACCAGGGTTTCGTCGTCC
W2409–F CCACCGACAAAGGCTGGAAC
W3150-R TCTTCCAGGCACTCACCACTCT
W91–F AAATCTGAAAACCTGTGGAGACC
W2110-R GATCTTGGTGTACAGGTCGTACTTC
Open in a new tab

2.6. Analytical methods

The OD600 of the samples was determined from the absorbance at 600 nm using a spectrophotometer. The dissolved oxygen concentration was measured using a portable hand-held dissolved oxygen meter. The abundance of 15NH4+, 15NO3−, and 15NO2− in the supernatant and 15N in the cells was all analyzed by Shanghai Chemical Research Institute Co., Ltd. using an isotope mass spectrometer (A001Nu and A002MAT271) [22]. The NH4+, NO3−, and NO2− concentration in the supernatant was determined using indophenol blue, hydrochloric acid photometry, and the N-(1naphthalene)-diaminoethane spectrophotometry method, respectively [37].

2.7. Statistical analyses and graphical work

Each experiment had three replicates. The obtained data were analyzed using Microsoft Excel 2010 and SPSS Statistics 19. The results are presented as the means ± standard deviation (SD) of the mean. One-way ANOVA was used to determine the statistical significance of all variants and p < 0.05 was considered statistically significant.

3. Results and discussion

3.1. Ammonium production capacity of eight bacteria under aerobic conditions

The accumulation of NH4+ during NO2− reduction by the eight bacteria used in this investigation is shown in Fig. 1. NH4+ was detectable in the supernatant after incubating four strains of Pseudomonas spp. (Y-1, Y-11, J, and P) in an NO2−-containing medium, similar to the Y-9 strain culture system. However, there was no NH4+ accumulation during NO2− reduction by the Arthrobacter spp. strains or S. marcescens QZB-1 (Fig. 1b). Similar results have also been reported for A. arilaitensis Y-10 incubated in 10 mg/L NO2− medium [31]. Our previous study showed that NH4+ in the supernatant originated from DNRA of strain Y-9 under aerobic conditions [22]. Therefore, the similar NH4+ accumulation characteristics between the four Pseudomonas spp. strains and the Y-9 strain indicates that these four strains may also be capable of DNRA under aerobic conditions. All strains grew relatively slowly (Fig. 1a) and were accompanied by a reduction of NO2−. Moreover, the accumulation of NH4+ declined after incubating the four strains of Pseudomonas spp. for 40–60 min (Fig. 1b), which may have been due to NH4+ assimilation. The concentration of NH4+ continuously increased during the culture process with chloramphenicol, whereas it increased and then decreased in the DM medium without chloramphenicol (Fig. 2). The observed phenomena clarified that the four Pseudomonas spp. were able to produce NH4+ during the NO2− reduction process, which was then consumed through assimilation.

Fig. 1.

Fig. 1

Open in a new tab

Growth(a) and ammonium production(b) characteristics of eight strains in nitrite containing medium under aerobic conditions. Values are means ± SD for triplicates.(“Y-1” represents “P. plecoglossicida Y-1”; “Y-9” represents “P. putida Y-9”; “Y-11” represents “P. tolaasii Y-11”; “J” represents “P. taiwanensis J”; “P” represents “P. putida P”; “D51” represents “Arthrobacter nicotianae D51”; “Y-10” represents “Arthrobacter arilaitensis Y-10”); “QZB-1” represents “Serratia marcescens QZB-1″

Fig. 2.

Fig. 2

Open in a new tab

Ammonium production characteristics of five strains in nitrite containing medium with or without chloramphenicol. Values are means ± SD for triplicates.(“Y-1” represents “P. plecoglossicida Y-1”; “Y-9” represents “P. putida Y-9”; “Y-11” represents “P. tolaasii Y-11”; “J” represents “P. taiwanensis J”; “P” represents “P. putida P”).

3.2. Four strains of Pseudomonas spp. were found to be capable of DNRA under aerobic conditions

The intracellular and extracellular nitrogen transformation characteristics of these four strains in the NO2−-containing medium are shown in Fig. 3. The extracellular NO2− decrease was accompanied by the growth of cells when these four strains were incubated in NO2− medium for 1 h (Fig. 3a, b, c). Moreover, NO2− and NH4+ were detected intracellularly after 1 h (Fig. 3b, c, d), which was similar to the results of the Y-9 strain. Furthermore, the NH4+ intracellular concentration was significantly higher than the extracellular concentration, except in the Y-1 culture system (p < 0.05, Fig. 3d). The NO3− intracellular and extracellular concentration was undetectable (data no shown). Moreover, Nrt, which catalyzes extracellular NO2− transport to intracellular regions, was found in these four strains according to the results of the genome-wide scan analysis. All the results appeared that NO2− was initially absorbed into the intracellular regions of these four strains, before being transformed to NH4+. The same NO2− conversion pathway was previously clarified for the Y-9 strain [22].

Fig. 3.

Fig. 3

Open in a new tab

Strains growth and their intracellular and extracellular nitrogen after incubation in nitrite medium (“Y-1” represents “P. plecoglossicida Y-1”; “Y-9” represents “P. putida Y-9”; “Y-11” represents “P. tolaasii Y-11”; “J” represents “P. taiwanensis J”; “P” represents “P. putida P”). (a) the OD600;(b) the NO2− concentration at 0 h; (c) the NO2− concentration at 1 h; (d) the NH4+ concentration at 1 h. Data are represented as mean, and different letters indicate significant differences between intracellular and extracellular nitrogen at p < 0.05.

DNRA, as well as nitrate assimilation and then mineralization by microorganisms, can transform NO2− to NH4+ [22], although there is no NH4+ overflow during assimilation [38,39]. In this study, 15NH4+ in the supernatant of the culture systems of the four strains was detected and accompanied by a decrease in NO2− (Fig. 4b, d), with levels reaching more than 5 atom%, except in the Y-1 culture system (Fig. 4d). This data suggests that these four strains may have transformed NO2− to NH4+. Moreover, according to the results described in section 3.1, there was a gradual increase in the NH4+ concentration after adding chloramphenicol, which contrasted with the phenomenon that the NH4+ concentration gradually decreased after rising without adding chloramphenicol. This result indicates that chloramphenicol had some degree of inhibition to the assimilation of the generated NH4+ by these four strains, which was similar to our previous study for the Y-9 strain [34]. Thus, in this study, chloramphenicol was added to the Na15NO2 medium to inhibit the growth of the strains, thereby avoiding the assimilation of 15NO2−. We observed that the OD600 of the four strains was maintained at 0.3–0.4 (Fig. 4a), and the 15N abundance in the cells of the four strains and the Y-9 strain was maintained below 2 atom% (Fig. 4c), indicating the inhibition of 15NO2− assimilation and then mineralization. Hence, the detected 15NH4+ in the supernatant was likely obtained through DNRA. In addition, the 15NO3− concentration in the supernatant was undetectable and its level remained at 0 (data no shown). The above results clarified that the DNRA process occurred in the four strains of Pseudomonas spp. under aerobic conditions.

Fig. 4.

Fig. 4

Open in a new tab

Strains growth and the 15N content and isotopic ratios after incubation in 15NO2− medium (“Y-1” represents “P. plecoglossicida Y-1”; “Y-9” represents “P. putida Y-9”; “Y-11” represents “P. tolaasii Y-11”; “J” represents “P. taiwanensis J”; “P” represents “P. putida P”). (a) the OD600; (b) the NO2− content and 15NO2− isotopic ratios; (c) the 15N isotopic ratios in bacteria; (d) the NH4+ content and 15NH4+ isotopic ratios. Data are represented as mean, and different letters indicate significant differences between different strains at p < 0.05.

3.3. nirBD was found in the four Pseudomonas spp. strains, similar to the Y-9 strain

The NirBD protein typically functions as a nitrite assimilation reductase [40,41]. Several previous studies have found that NirBD could also catalyze NO2− reduction to NH4+ during DNRA [42,43]. Furthermore, our previous study showed that NirBD in the Y-9 strain could catalyze the process of NO3− assimilation and DNRA [22]. Further analysis showed that this may have been because NirBD had the nitrite and sulfite reductase iron-sulfur/siroheme-binding site (Table S1). In this study, nirBD was identified in the four Pseudomonas spp. strains based on the gene amplification data, and its whole sequence was subsequently obtained. The sequential arrangement of nirBD across the four strains was similar to that of nirBD in the Y-9 strain, with a similarity of approximately 98%. Additionally, the similarity of NirBD between the four strains and the Y-9 strain reached 94% (Fig. S1). These results illustrate that the DNRA by the four Pseudomonas spp. under aerobic conditions may have been controlled by nirBD.

Both nirBD and nrfA have been shown to catalyze the DNRA pathway. nirBD can catalyze both assimilatory and dissimilatory reductions of NO2− [44,45]. In contrast, nrfA only catalyzes the reduction of NO2− to NH4+. Furthermore, the abundance of nrfA has been found to be positively correlated with DNRA under a low C/N ratio [7,46]. Thus, nrfA has been widely used as a marker gene for DNRA and is found in many groups of bacteria capable of DNRA, such as Anaeromyxobacter sp., Caldimicrobium sp., Nitrospira sp., Pelobacter sp., Geobacter sp., and Candidatus Brocadia sp. [[47], [48], [49]], under anaerobic conditions. However, nrfA is rarely found in Pseudomonas spp., according to the NCBI data. Intriguingly, the sequence of nirBD in P. putida Y-9 showed a highly significant relationship with that of different Pseudomonas spp. (>99%), but a relatively distant phylogenetic relationship with the sequences from other genera (Fig. 5). Moreover, the P. alcaliphila strain MBR (EU307111), which is capable of DNRA under anaerobic conditions [20,21], had no nirBD according to the NCBI data. Hence, these results further clarify that nirBD in Pseudomonas spp. may play an important role in the control of the DNRA pathway under aerobic conditions.

Fig. 5.

Fig. 5

Open in a new tab

Phylogenetic tree of the strains base on the nirBD gene homology.

The results showed that the four strains of Pseudomonas spp. were capable of DNRA under aerobic conditions, similar to the Y-9 strain. Considering that Pseudomonas spp. are widely distributed in the soil [50], DNRA by Pseudomonas spp. under aerobic conditions will likely play a crucial role in NO3− removal and nitrogen retention in the surface soil. However, there is also an abundance of denitrifying microorganisms in the soil, which reduce NO3− to nitrogen gas through denitrification, resulting in nitrogen loss [51,52]. Therefore, measures should be taken to strengthen DNRA whilst downregulating the denitrification process in the surface soil, thereby reducing the risk of nitrogen loss from soil, and promoting the efficient use of nitrogen fertilizers by crops.

4. Conclusion

Pseudomonas plecoglossicida Y-1, P. tolaasii Y-11, P. taiwanensis J, and P. putida P were capable of DNRA under aerobic conditions, similar to the P. putida Y-9, probably because they shared the same nirBD sequence. However, elucidating the function of nirBD in aerobic DNRA will require further investigation. Furthermore, the possibility of more strains capable of DNRA under aerobic conditions should also be explored.

Author contribution statement

Xuejiao Huang: Conceived and designed the experiments; Performed the experiments; Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data; Wrote the paper. Luo Luo: Performed the experiments; Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data. Deti Xie: Conceived and designed the experiments; Contributed reagents, materials, analysis tools or data. Zhenlun Li: Conceived and designed the experiments; Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data; Wrote the paper.

Data availability statement

Data will be made available on request.

Declaration of interest’s statement

The authors declare no competing interests.

Acknowledgements

This work was supported financially by the National Natural Science Foundation of China (42107333) and Guangxi Natural Science Foundation of China (2022GXNSFBA035606).

Footnotes

Appendix A

Supplementary data to this article can be found online at https://doi.org/10.1016/j.heliyon.2023.e14983.

Appendix A. Supplementary data

The following is the Supplementary data to this article.

Multimedia component 1
mmc1.doc (73KB, doc)

References

  • 1.Qin S.Q., Quan Z., Ma J., Chen X., Shi Y., Huang B. Regulating nitrate excess in lettuce-planted greenhouse soil with available carbon addition through irrigation. Environ. Sci. Pollut. Res. 2019;26(19):19241–19249. doi: 10.1007/s11356-019-05125-x. [DOI] [PubMed] [Google Scholar]
  • 2.Lin D.R., Huang Y.C., Zhao J.J., Wu Z.J., Liu S.L., Qin W., et al. Evaluation of seed nitrate assimilation and stimulation of phenolic-linked antioxidant on pentose phosphate pathway and nitrate reduction in three feed-plant species. BMC Plant Biol. 2020;20(1):267. doi: 10.1186/s12870-020-02453-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Vidal E.A., Alvarez J.M., Araus V., Riveras E., Brooks M.D., Krouk G., et al. Nitrate in 2020: Thirty years from transport to signaling networks. Plant Cell. 2020;32(7):2094–2119. doi: 10.1105/tpc.19.00748. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Stein L.Y., Klotz M.G. The nitrogen cycle. Curr. Biol. 2016;26(3):R94–R98. doi: 10.1016/j.cub.2015.12.021. [DOI] [PubMed] [Google Scholar]
  • 5.Putz M., Schleusner P., Rütting T., Hallin S. Relative abundance of denitrifying and DNRA bacteria and their activity determine nitrogen retention or loss in agricultural soil. Soil Biol. Biochem. 2018;123:97–104. doi: 10.1016/j.soilbio.2018.05.006. [DOI] [Google Scholar]
  • 6.Denk T.R.A., Mohn J., Decock C., Lewicka-Szczebak D., Harris E., Butterbach-Bahl K., et al. The nitrogen cycle: a review of isotope effects and isotope modeling approaches. Soil Biol. Biochem. 2017;105:121–137. doi: 10.1016/j.soilbio.2016.11.015. [DOI] [Google Scholar]
  • 7.Pandey A., Suter H., He J.Z., Hu H.W., Chen D.L. Dissimilatory nitrate reduction to ammonium dominates nitrate reduction in long-term low nitrogen fertilized rice paddies. Soil Biol. Biochem. 2019;131:149–156. doi: 10.1016/j.soilbio.2019.01.007. (in Chinese) [DOI] [Google Scholar]
  • 8.Shan J., Zhao X., Sheng R., Xia Y.Q., ti C.P., Quan X.F., et al. Dissimilatory nitrate reduction processes in typical Chinese paddy soils: rates, relative contributions, and influencing factors. Environ. Sci. Technol. 2016;50(18):9972–9980. doi: 10.1021/acs.est.6b01765. [DOI] [PubMed] [Google Scholar]
  • 9.Friedl J., De Rosa D., Rowlings D.W., Grace P.R., Müller C., Scheer C. Dissimilatory nitrate reduction to ammonium (DNRA), not denitrification dominates nitrate reduction in subtropical pasture soils upon rewetting. Soil Biol. Biochem. 2018;125:340–349. doi: 10.1016/j.soilbio.2018.07.024. [DOI] [Google Scholar]
  • 10.Qin S.P., Yu L.P., Yang Z.J., Li M.Y., Clough T., Nicole W.M., et al. Electrodes donate electrons for nitrate reduction in a soil matrix via DNRA and denitrification. Environ. Sci. Technol. 2019;53(4):2002–2012. doi: 10.1021/acs.est.8b03606. [DOI] [PubMed] [Google Scholar]
  • 11.Woods D.D. The reduction of nitrate to ammonia by Clostridium welchii. Biochem. J. 1938;32(11):2000–2012. doi: 10.1042/bj0322000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Wang C.R., Zheng C.X., Zhang M.M., Wu Q.F., He T.X. Research progress in ammonium production from microbial dissimilatory reduction of nitrate and nitrite. Acta Microbiol. Sin. 2022:1–14. doi: 10.13343/j.cnki.wsxb.20220665. (in Chinese) [DOI] [Google Scholar]
  • 13.Silby M.W., Winstanley C., Godfrey S.A.C., Levy S.B., Jackson R.W. Pseudomonas genomes: diverse and adaptable. FEMS Microbiol. Rev. 2011;35(4):652–680. doi: 10.1111/j.1574-6976.2011.00269.x. [DOI] [PubMed] [Google Scholar]
  • 14.Li D.D., Xu X.J., Yu H.W., Han X.R. Characterization of Pb2+ biosorption by psychrotrophic strain Pseudomonas sp. I3 isolated from permafrost soil of Mohe wetland in Northeast China. J. Environ. Manag. 2017;196:8–15. doi: 10.1016/j.jenvman.2017.02.076. [DOI] [PubMed] [Google Scholar]
  • 15.Chen J.Q., Dong J., Chang J.J., Guo T.T., Yang Q.C., Jia W., et al. Characterization of an Hg(II)-volatilizing Pseudomonas sp. strain, DC-B1, and its potential for soil remediation when combined with biochar amendment. Ecotoxicol. Environ. Saf. 2018;163:172–179. doi: 10.1016/j.ecoenv.2018.07.071. [DOI] [PubMed] [Google Scholar]
  • 16.Tonelli Fernandes A.F., Braz V.S., Bauermeister A., Rizzato Paschoal J.A., Lopes N.P., Stehling E.G. Degradation of atrazine by Pseudomonas sp. and Achromobacter sp. isolated from Brazilian agricultural soil. Int. Biodeterior. Biodegrad. 2018;130:17–22. doi: 10.1016/j.ibiod.2018.03.011. [DOI] [Google Scholar]
  • 17.Manasa K.G., Reddy R.S., Triveni S. Isolation and characterisation of Pseudomonas fluorescens isolates from different rhizosphere soils of Telangana. J. Pharmacogn. Phytochem. 2017;6(3):224–229. [Google Scholar]
  • 18.Li S., Li X.M., Li F.B. Fe(II) oxidation and nitrate reduction by a denitrifying bacterium, Pseudomonas stutzeri LS-2, isolated from paddy soil. J. Soils Sediments. 2018;18(4):1668–1678. doi: 10.1007/s11368-017-1883-1. [DOI] [Google Scholar]
  • 19.Nie Y.X., Li L., Isoda R., Wang M.C., Hatano R., Hashidoko Y. Physiological and genotypic Characteristics of nitrous oxide (N2O)-emitting Pseudomonas species isolated from dent corn Andisol farmland in Hokkaido, Japan. Microb. Environ. 2016;31(2):93–103. doi: 10.1264/jsme2.ME15155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Su W.T., Zhang L.X., Li D.P., Zhan G.Q., Qian J.W., Tao Y. Dissimilatory nitrate reduction by Pseudomonas alcaliphila with an electrode as the sole electron donor. Biotechnol. Bioeng. 2012;109(11):2904–2910. doi: 10.1002/bit.24554. [DOI] [PubMed] [Google Scholar]
  • 21.Zhang W.J., Zhang Y., Su W.T., Jiang Y., Su M., Gao P., et al. Effects of cathode potentials and nitrate concentrations on dissimilatory nitrate reductions by Pseudomonas alcaliphila in bioelectrochemical systems. J. Environ. Sci. 2014;26(4):885–891. doi: 10.1016/S1001-0742(13)60460-X. [DOI] [PubMed] [Google Scholar]
  • 22.Huang X.J., Weisener C.G., Ni J.P., He B.H., Xie D.T., Li Z.L. Nitrate assimilation, dissimilatory nitrate reduction to ammonium, and denitrification coexist in Pseudomonas putida Y-9 under aerobic conditions. Bioresour. Technol. 2020;312 doi: 10.1016/j.biortech.2020.123597. [DOI] [PubMed] [Google Scholar]
  • 23.He T.X., Li Z.L., Sun Q., Xu Y., Ye Q. Heterotrophic nitrification and aerobic denitrification by Pseudomonas tolaasii Y-11 without nitrite accumulation during nitrogen conversion. Bioresour. Technol. 2016;200:493–499. doi: 10.1016/j.biortech.2015.10.064. [DOI] [PubMed] [Google Scholar]
  • 24.Ye Q., Li K.L., Li Z.L., Xu Y., He T.X., Tang W.H., et al. Heterotrophic nitrification-aerobic denitrification performance of strain Y-12 under low temperature and high concentration of inorganic nitrogen conditions. Water. 2017;9(11):835. doi: 10.3390/w9110835. [DOI] [Google Scholar]
  • 25.Liu J., Li D.P., Liu Q., Tao Y., He X.H., Wang X.M., et al. Identification of dissimilatory nitrate reduction to ammonium bacterium and biomineralization. J. Sichuan Univ. 2008;45(3):651–655. (in Chinese) [Google Scholar]
  • 26.Zhao B., Cheng D.Y., Tan P., An Q., Guo J.S. Characterization of an aerobic denitrifier Pseudomonas stutzeri strain XL-2 to achieve efficient nitrate removal. Bioresour. Technol. 2018;250:564–573. doi: 10.1016/j.biortech.2017.11.038. [DOI] [PubMed] [Google Scholar]
  • 27.Huang X.J., Xu Y., He T.X., Jia H.J., Feng M., Xiang S.D., et al. Ammonium transformed into nitrous oxide via nitric oxide by Pseudomonas putida Y-9 under aerobic conditions without hydroxylamine as intermediate. Bioresour. Technol. 2019;277:87–93. doi: 10.1016/j.biortech.2019.01.040. [DOI] [PubMed] [Google Scholar]
  • 28.He T.X., Ye Q., Sun Q., Cai X., Ni J.P., Li Z.L., et al. Removal of nitrate in simulated water at low temperature by a novel psychrotrophic and aerobic bacterium, Pseudomonas taiwanensis strain. J, Biomed Res. Int. 2018 doi: 10.1155/2018/4984087. 2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Xiang S.D., Li Z.L., Ye Q., He T.X., Xu Y., Huang X.J., et al. Isolation and identification of cold-tolerance aerobic denitrifier Pseudomonas plecoglossicida Y-1. Desalination Water Treat. 2020;181:321–329. doi: 10.5004/dwt.2020.25132. [DOI] [Google Scholar]
  • 30.Cai X., Li K.L., He T.X., Wang Y.X., Zhang X., Xie E.Y., et al. Characteristics of heterotrophic nitrifying and aerobic denitrifying Arthrobacter nicotianae D51 strain in the presence of copper. Water. 2019;11(3):434. doi: 10.3390/w11030434. [DOI] [Google Scholar]
  • 31.He T.X., Xie D.T., Li Z.L., Ni J.P., Sun Q. Ammonium stimulates nitrate reduction during simultaneous nitrification and denitrification process by Arthrobacter arilaitensis Y-10. Bioresour. Technol. 2017;239:66–73. doi: 10.1016/j.biortech.2017.04.125. [DOI] [PubMed] [Google Scholar]
  • 32.Wang M.S., Jiang D.H., Huang X.J., Li S.H., Zhang Y., Huang J.L., et al. Isolation, identification and characterization of a Serratia marcescens with high selenite reduction efficiency. Soils. 2022;54(2):314–319. doi: 10.13758/j.cnki.tr.2022.02.014. (in Chinese) [DOI] [Google Scholar]
  • 33.Huang X.J., Jiang D.H., Ni J.P., Xie D.T., Li Z.L. Removal of ammonium and nitrate by the hypothermia bacterium Pseudomonas putida Y-9 mainly through assimilation. Environ. Technol. Innovat. 2021;22 doi: 10.1016/j.eti.2021.101458. [DOI] [Google Scholar]
  • 34.Huang X.J., Tie W.Z., Xie D.T., Li Z.L. Low C/N ratios promote dissimilatory nitrite reduction to ammonium in Pseudomonas putida Y-9 under aerobic conditions. Microorganisms. 2021;9:1524. doi: 10.3390/microorganisms9071524. 2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Tiedje J.M., Denitrifiers . first ed. Soil science society of America journal; Madison, WI, USA: 1994. Methods of Soil Analysis; pp. 245–267. [DOI] [Google Scholar]
  • 36.Campbell W.H., Kinghorn J.R. Functional domains of assimilatory nitrate reductases and nitrite reductases. Trends Biochem. Sci. 1990;15(8):315–319. doi: 10.1016/0968-0004(90)90021-3. [DOI] [PubMed] [Google Scholar]
  • 37.State environmental protection administration of China . Environmental science press; Beijing, China: 2002. Standard Methods for the Examination of Water and Wastewater; pp. 254–279. [Google Scholar]
  • 38.Yang S., Wu S.J., Cai Y.J., Zhou W.Z., Zhu T.B., Wang Y., et al. The synergetic and competitive mechanism andthe dominant factors of dissimilatory nitrate reduction processes:a review. Acta Ecol. Sin. 2016;36(5):1224–1232. doi: 10.5846/stxb201407181464. (in Chinese) [DOI] [Google Scholar]
  • 39.Kuypers M.M.M., Marchant H.K., Kartal B. The microbial nitrogen-cycling network. Nat. Rev. Microbiol. 2018;16(5):263–276. doi: 10.1038/nrmicro.2018.9. [DOI] [PubMed] [Google Scholar]
  • 40.Tiffert Y., Supra P., Wurm R., Wohlleben W., Wagner R., Reuther J. The Streptomyces coelicolor GlnR regulon: identification of new GlnR targets and evidence for a central role of GlnR in nitrogen metabolism in actinomycetes. Mol. Microbiol. 2008;67(4):861–880. doi: 10.1111/j.1365-2958.2007.06092.x. [DOI] [PubMed] [Google Scholar]
  • 41.Fischer M., Schmidt C., Falke D., Sawers R.G. Terminal reduction reactions of nitrate and sulfate assimilation in Streptomyces coelicolor A3(2): identification of genes encoding nitrite and sulfite reductases. Res. Microbiol. 2012;163(5):340–348. doi: 10.1016/j.resmic.2012.05.004. [DOI] [PubMed] [Google Scholar]
  • 42.Sun Z.Y., Lv Y.K., Liu Y.X., Ren R.P. Removal of nitrogen by heterotrophic nitrification-aerobic denitrification of a novel metal resistant bacterium Cupriavidus sp. S1. Bioresour. Technol. 2016;220:142–150. doi: 10.1016/j.biortech.2016.07.110. [DOI] [PubMed] [Google Scholar]
  • 43.Yukioka Y., Tanahashi T., Shida K., Oguchi H., Ogawa S., Saito C., et al. A role of nitrite reductase (NirBD) for NO homeostatic regulation in Streptomyces coelicolor A3(2) FEMS Microbiol. Lett. 2017;364(1):fnw241. doi: 10.1093/femsle/fnw241. [DOI] [PubMed] [Google Scholar]
  • 44.Oliveira H.C., Salgado I., Sodek L. Nitrite decreases ethanol production by intact soybean roots submitted to oxygen deficiency. Plant Signal. Behav. 2013;8(4) doi: 10.4161/psb.23578. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Wang X.G., Tamiev D., Alagurajan J., DiSpirito A.A., Phillips G.J., Hargrove M.S. The role of the NADH-dependent nitrite reductase, Nir, from Escherichia coli in fermentative ammonification. Arch. Microbiol. 2019;201(4):519–530. doi: 10.1007/s00203-018-1590-3. [DOI] [PubMed] [Google Scholar]
  • 46.Li X.F., Sardans J., Albert G.G., Asensio D., Vallicrosa H., Josep P. Nitrogen reduction processes in paddy soils across climatic gradients: Key controlling factors and environmental implications. Geoderma. 2020;368 doi: 10.1016/j.geoderma.2020.114275. [DOI] [Google Scholar]
  • 47.Li Q.X., Bu C.N., Ahmad H.A., Guimbaud C., Gao B.Y., Qiao Z.M., et al. The distribution of dissimilatory nitrate reduction to ammonium bacteria in multistage constructed wetland of Jining, Shandong, China. Environ. Sci. Pollut. Res. 2021;28(4):4749–4761. doi: 10.1007/s11356-020-10709-z. [DOI] [PubMed] [Google Scholar]
  • 48.Yuan H.Z., Jia B.C., Zeng Q.F., Zhou Y.W., Wu J., Wang H.X., et al. Dissimilatory nitrate reduction to ammonium (DNRA) potentially facilitates the accumulation of phosphorus in lake water from sediment. Chemosphere. 2022;303(1) doi: 10.1016/j.chemosphere.2022.134664. [DOI] [PubMed] [Google Scholar]
  • 49.Zhang T., Zhuang X.M., Ahmad S., Lee T.H., Cao C.B., Ni S.Q. Investigation of dissimilatory nitrate reduction to ammonium (DNRA) in urban river network along the Huangpu River, China: rates, abundances, and microbial communities. Environ. Sci. Pollut. Res. 2022;29(16):23823–23833. doi: 10.1007/s11356-021-17475-6. [DOI] [PubMed] [Google Scholar]
  • 50.Lopes L.D., Davis E.W., Ii, Pereira e Silva M.d.C., Weisberg A.J., Bresciani L., Chang J.H., et al. Tropical soils are a reservoir for fluorescent Pseudomonas spp. biodiversity. Environ. Microbiol. 2018;20(1):62–74. doi: 10.1111/1462-2920.13957. [DOI] [PubMed] [Google Scholar]
  • 51.Li X.X., Sørensen P., Olesen J.E., Petersen S.O. Evidence for denitrification as main source of N2O emission from residue-amended soil. Soil Biol. Biochem. 2016;92:153–160. doi: 10.1016/j.soilbio.2015.10.008. [DOI] [Google Scholar]
  • 52.Senbayram M., Well R., Bol R., Chadwick D.R., Jones D.L., Wu D. Interaction of straw amendment and soil NO3− content controls fungal denitrification and denitrification product stoichiometry in a sandy soil. Soil Biol. Biochem. 2018;126:204–212. doi: 10.1016/j.soilbio.2018.09.005. [DOI] [Google Scholar]
  • 53.Tao Y.L., Wen D.H. Dissimilatory nitrate reduction to ammonium: the potential and impacts in estuarine regions. Microbiol. China. 2016;43(1):172–181. doi: 10.13344/j.microbiol.china.150288. [DOI] [Google Scholar]
  • 54.Pandey C.B., Kumar U., Kaviraj M., Minick K.J., Mishra A.K., Singh J.S. DNRA: a short-circuit in biological N-cycling to conserve nitrogen in terrestrial ecosystems. Sci. Total Environ. 2020;738 doi: 10.1016/j.scitotenv.2020.139710. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Multimedia component 1
mmc1.doc (73KB, doc)

Data Availability Statement

Data will be made available on request.

Articles from Heliyon are provided here courtesy of Elsevier

RESOURCES