Skip to main content
Poultry Science logoLink to Poultry Science
. 2023 Jan 13;102(4):102496. doi: 10.1016/j.psj.2023.102496

Dietary protocatechuic acid ameliorates ileal mucosal barrier injury and inflammatory response and improves intestinal microbiota composition in Yellow chickens challenged with Salmonella typhimurium

Xiaoyan Cui *,†,1, Sheng Zhang †,1, Shouqun Jiang †, Zhongyong Gou †, Yibing Wang †,2
PMCID: PMC10102437  PMID: 36736141

Abstract

Salmonella typhimurium (ST) is a common foodborne pathogen that severely affects the health of humans and livestock. Protocatechuic acid (PCA) has been shown to possess anti-inflammatory and anti-bacterial functions. Chickens were used to investigate the effect of PCA on the gut health infected with ST. A total of one hundred eighty, 1-d-old birds were randomly allocated into 3 treatments, each with 6 replicates per treatment and 10 chicks per replicate. Broiler chicks in the control and ST treatment were fed a basal diet, and birds in the PCA+ST treatment received the basal diet with 600 mg/kg PCA. On d 14 and 16 of the trial, broilers in ST and PCA+ST treatments received an oral dose of ST, while broilers in CON received an equal amount of PBS. The data were analyzed by the one-way ANOVA. Dietary PCA increased (P < 0.05) final body weight, average daily gain, and feed to gain ratio in ST-challenged Yellow broilers. Protocatechuic acid significantly alleviated ST-induced intestinal mucosal injury reflected in the decreased (P < 0.05) plasma activity of diamine oxidase and ileal apoptosis, with increased (P < 0.05) ileal villus height and villus height/crypt depth. Protocatechuic acid treatment significantly decreased (P < 0.05) ST-induced proinflammatory cytokine (Interleukin-1β, Interleukin-6, Tumor necrosis factor-α, and Interferon-β) content in ileum. Meanwhile, PCA treatment significantly increased (P < 0.05) the transcript abundances of claudin 1 (CLDN1), zonula occludens-1 (ZO-1), and mucin 2 (MUC2) in ileum, all related to the intestinal barrier in ST-challenged Yellow broilers. Additionally, PCA also increased (P < 0.05) the diversity and richness of the cecal microflora as reflected by reduced (P < 0.05) abundance of Bacteroidota, Proteobacteria and Escherichia-Shigella, and increased (P < 0.05) abundance of Firmicutes and Lactobacillus in ST-challenged Yellow broilers. These findings indicate that PCA relieves ST-induced loss weight, intestinal barrier injury, inflammatory response, and improves intestinal microbiota composition in Yellow broilers.

Key words: protocatechuic acid, Salmonella typhimurium, chicken, inflammation, gut microbiota

INTRODUCTION

Some of the most common diseases occurring in poultry are those caused by Salmonella. Salmonellosis is associated with foodborne outbreaks from contaminated poultry products (Finstad et al., 2012; Als et al., 2018). For human food safety, here we use chickens to explore measures and methods to defend against Salmonella infection. Most chicks infected by Salmonella remain asymptomatic for long periods, but they had reduced growth performance and increased mortality (Cox et al., 2011). Specifically, Salmonella facilitates the entry of enteric pathogenic bacteria into intestinal epithelial cells (Cossart and Sansonetti, 2004). Because of the strict ban of in-feed antibiotics, the industry is paying attention to controlling Salmonella disease with antibiotic-free feeds.

Protocatechuic acid (PCA, 3,4-hydroxybenzoic acid), is a natural phenolic acid often found at high concentrations in vegetables and fruits. It is one of the main metabolites of compound polyphenols (Tanaka et al., 1995). Studies have found that PCA is easily absorbed by animals and humans (Song et al., 2020). Protocatechuic acid has a variety of biological activities, including antioxidant (Reis et al., 2010), anti-inflammatory (Yan et al., 2004), antibacterial (Pacheco-Ordaz et al., 2018), and antiapoptotic (Adedara et al., 2019) responses. In vitro, it has been reported that PCA effectively and dose-dependently inhibited the growth of Salmonella typhimurium (ST) DT104 in apple juice and ground beef (Chao and Yin, 2009). Wang et al. (2019) recently reported that a diet supplemented with PCA effectively improves the growth performance, antioxidant capacity, gut immune function and the structure of gut microbiota in yellow feathered broilers. Hu et al. (2020) reported that PCA attenuated oxidative stress, intestinal barrier damage, inflammation, and intestinal flora disturbance in piglets induced by LPS challenge. These effects suggested that PCA had the potential to be used as an alternative to antibiotics to protect against ST infection in poultry production. The potential effect of PCA on Salmonella infection is unknown.

Consequently, the present study was undertaken to explore the protective effect of PCA on the maintenance of intestinal health in broilers challenged with ST. In this study, the growth performance, ileal barrier function, morphological structure, apoptosis and inflammatory response, as well as microbiota composition in cecal contents are documented. The findings could be expected to provide reference information and a basis for using PCA in poultry production.

MATERIALS AND METHODS

Animal Experimental Design

This study was approved by the Animal Care and Use Committee of Guangdong Academy of Agricultural Sciences (Guangzhou, PRC). Female slow-growing yellow broilers were used. A total of one hundred eighty, 1-d-old birds were randomly allocated into 3 treatments, each with 6 replicates per treatment and 10 chicks per replicate. Broiler chicks in the control group (CON) and ST-challenged treatment were fed a basal diet, and birds in the PCA + ST treatment received the basal diet with 600 mg/kg PCA. On d 14 and 16 of the trial, broilers in ST and PCA + ST treatments received an oral dose of ST (109 CFU), while broilers in CON received an equal amount of PBS.

High purify protocatechuic acid (>97%) was purchased from Sigma-Aldrich (St. Louis, MO). Salmonella typhimurium was a gift from Professor Weifen Li in Zhejiang University.

Diets and Chicken Husbandry

The diets were formulated as recommended by Chinese Nutrient Requirements of Yellow Chickens (2020). Details of ingredient composition and calculated nutrient levels of the basal diets are given in Table 1. The crude protein concentrations in the diet were determined using the association of official analytical chemists (1990) methods. The calcium concentrations of the diet were determined by potassium permanganate method (SAC, 2018a), and total phosphorus contents of the diet were measured by colorimetric method of molybdovanadate (SAC, 2018b).

Table 1.

Composition and nutrient levels of the basal diet.

Ingredients % Nutrient levels2 %
Corn 59.2 Metabolic energy/(MJ/kg) 11.9
Soybean meal 31.0 Crude protein 21.3
Corn gluten 3.0 Calcium 0.9
Soybean oil 2.3 Phosphorus 0.7
CaHPO4 1.8 Non-phytate phosphorus 0.4
Limestone 0.9 Lysine 1.2
DL-Methionine (99%) 0.1 Methionine 0.4
L-Lysine HCL (78%) 0.2
NaCl 0.3
Zeolite powder 0.2
Premix1 1.0
Total 100.0
1

Premix provided as previously described (Wang et al., 2021b). Protocatechuic acid was added in the premix to provide a final content of 600 mg/kg DM.

2

Crude protein, calcium and phosphorus were measured values, while the others were calculated.

The 18-d experiment was carried out in the testing farm of Institute of Animal Science, Guangdong Academy of Agricultural Sciences. Birds were raised in cages (100 cm × 50 cm × 50 cm). Water and diets were provided ad libitum. The light cycle with incandescent bulbs was 23L:1D for the first 3 d, 21L:3D from d 4 to d 10, and 18L:6D from d 11 to d 18. Each bird was weighed on d 1 and d 18 of the trial. The final body weight (BW), average daily gain (ADG), average daily feed intake (ADFI) and feed to gain ratio of broilers from d 1 to d 18 were calculated on a per replicate basis.

Sample Collection

At the end of the trial (d 18), after feed-withdrawal overnight, 2 chicks close to average BW per replicate were electrically stunned and exsanguinated. Five ml jugular blood was collected, and plasma samples were obtained after centrifuging (1,000 × g, 10 min, 4°C) for determination of diamine oxidase (DAO) activity. After opening lengthwise, mid-ileal segments were rinsed with sterile saline and portions were fixed by immersion in 4% paraformaldehyde. The mucosa was collected by gentle scraping of additional portions of the ileum, then snap-frozen in liquid N2 and kept at −80°C for ELISA testing and quantitative PCR. The whole cecum was collected for flora analysis.

Salmonella Translocation to Liver and Spleen

Samples of liver and spleen were collected aseptically and then homogenized in PBS. Serial dilutions of homogenates were coated on SS (Salmonella selection) agar plates. The CFUs of S. typhimurium were quantified by visual counting of micro-colonies.

Activity of Diamine Oxidase

Commercial kits (A088-1-1, Nanjing Jiancheng Institute of Bioengineering, Nanjing, China) and a spectrophotometer (Spectra Max M-5, Molecular Devices, San Jose, CA) were used to determine the activity of DAO.

Hematoxylin and Eosin Staining and TUNEL Assay

Fixed ileal samples were dehydrated, embedded in paraffin and sectioned (5 μm) by standard procedures. Dewaxed sections were mounted and stained with hematoxylin and eosin (H&E) by Wuhan Service Biotechnology Co., Ltd. (Wuhan, China) for histopathological analysis. The height of villi, and depth of adjacent crypts were determined microscopically with a Panoramic Scanner (P-MIDI P250, 3D Histech, Budapest, HUN), and the ratio of villus height to crypt depth was calculated.

The TdT-mediated dUTP Nick-End Labeling (TUNEL) assay, as described earlier (Wang et al., 2021a), was determined by Wuhan Service Biotechnology Co., Ltd. (Wuhan, China). Images were captured using a fluorescence microscope (Nikon Eclipse C1, Tokyo, Japan) and imaging system (Nikon DS-U3).

Inflammatory Factors in Ileal Mucosa

Commercial ELISA kits (Jiangsu Meimian Industrial Co., Ltd, Zhangjiagang, China) and the spectrophotometer mentioned above were used to determine the contents of Interleukin-1β (IL-1β) (MM36910O1), IL-6 (MM-0521O1), IL-8 (MM-0768O1), Tumor necrosis factor-α (TNF-α) (MM-0938O1), Interferon-β (IFN-β) (MM34122O1) and Interferon-γ (IFN-γ) (MM-0520O1) in ileal mucosa, the ELISA was performed as previously described (Wang et al., 2019).

Quantitative PCR

RNA from ileal mucosa was extracted using Trizol reagent and reverse transcribed using PrimeScript II cDNA synthesis Kit (D6210A, Takara, Tokyo, Japan). The real-time PCR were performed as previously described (Wang et al., 2021c). The primer sequences of transcripts for the intestinal mucosal barrier and immune genes are given in Table 2.

Table 2.

Primers sequences used for real-time PCR.

Gene Primer sequence (5’ to 3’) GenBank ID
CLDN1 F: GAGGATGACCAGGTCAAGAAG
R: TGCCCAGCCAATGAAGAG
NM_001013611.2
OCLN F: TCATCCTGCTCTGCCTCATCT
R: CATCCGCCACGTTCTTCAC
NM_205128.1
ZO-1 F: CCAAAGACAGCAGGAGGAGA
R: TGGCTAGTTTCTCTCGTGCA
NM_040680628.1
MUC2 F: CATTCAACGAGGAGAGCTGC
R: TTCCTTGCAGCAGGAACAAC
NM_040673077.1
MLCK F: AAGAAATACAGCCTACCATCCA
R: GCCTTCACGCACAACAACT
NM_001322361.3
β-actin F: GAGAAATTGTGCGTGACATCA
R: CCTGAACCTCTCATTGCCA
NM_205518.1

CLDN1, claudin 1; MLCK, myosin light-chain kinase; MUC2, mucin 2; OCLN, occludin; ZO-1, zonula occludens-1.

Microflora Analysis

Bacterial genomic DNA was extracted from the cecal contents of 6 broilers from each treatment using the TIANamp DNA kit (DP121221, Tiangen Biotech Co. Ltd., Beijing, China). The 16S rDNA V3 and V4 regions were amplified using forward primers: 5’-CCTACGGGNGGCWGCAG-3’ and reverse primers: 5’-GACTACHVGGGTATCTAATCC-3’, and sequencing was performed on the Illumina MiSeq platform (Illumina Inc., San Diego, CA). Library construction and Illumina MiSeq sequencing were performed as previously described (Wang et al., 2021c), by Shanghai Majorbio Bio-pharm Technology Co., Ltd., (Shanghai, China).

Statistical Analysis

The data were analyzed by the one-way ANOVA and means were compared by Tukey tests using SPSS 17.0. Results are presented as means with SEM, and differences were considered significant at P < 0.05.

RESULTS

Growth Performance

As shown in Table 3, ST infection decreased (P < 0.05) the final BW, ADG and increased (P < 0.05) feed to gain ratio. Compared with broilers in ST, supplementation with PCA increased (P < 0.05) the final BW, ADG, and decreased (P < 0.05) feed to gain ratio.

Table 3.

Effect of protocatechuic acid (PCA) on growth performance of Salmonella typhimurium-challenged (ST) broiler chicks from 1 to 18 d of age.

Variables1 CON ST PCA + ST SEM2 P value
1–14 d
 BWd 1, g 28.00 28.03 28.06 0.02 0.680
 BWd 14, g 132.82 132.43 136.99 1.01 0.136
 ADG, g/d 7.48 7.48 7.78 0.07 0.114
 ADFI, g/d 13.19 13.19 13.26 0.11 0.958
 F/G 1.75 1.75 1.70 0.01 0.171
15∼18 d
 BWd 18, g 177.22b 163.91c 188.58a 2.11 <0.001
 ADG, g/d 11.10b 7.87c 12.90a 0.36 <0.001
 ADFI, g/d 20.16 19.93 20.35 0.18 0.731
 F/G 1.78b 2.51a 1.57c 0.10 <0.001
ab

Means within a row with different superscripts are significantly different (P < 0.05).

1

BW, body weight; ADG, average daily gain; ADFI, average daily feed intake; F/G, feed to gain ratio; CON, control.

2

SEM = standard error of mean, n = 6.

Salmonella Counts in Liver and Spleen

As showed in Figure 1, there were no Salmonella detected in liver and spleen of broiler chicks in CON, while ST challenge increased (P < 0.05) the number of Salmonella (Log10 CFU/g tissue) both in liver and spleen. Compared with broilers in ST, supplementation with PCA decreased (P < 0.05) the Salmonella counts in liver and spleen of chicks.

Figure 1.

Figure 1

Effects of protocatechuic acid (PCA) on Salmonella counts in liver (A) and spleen (B) of broiler chicks challenged with Salmonella typhimurium (ST). Results are presented as mean ± SEM (n = 6). * indicate significance at P < 0.05. CON, control.

Plasmal DAO Activity

As shown in Table 4, ST infection increased (P < 0.05) the activity of DAO in plasma. Compared with broilers in ST, supplementation with PCA decreased (P < 0.05) the DAO activity.

Table 4.

Effect of protocatechuic acid (PCA) on the activity of diamine oxidase (DAO) in plasma of Salmonella typhimurium- challenged (ST) broiler chicks.

Items CON1 ST PCA + ST SEM2 P value
DAO, U/L 5.01b 6.81a 5.67b 0.39 0.001
ab

Means within a row with different superscripts are significantly different (P < 0.05).

1

CON, control.

2

SEM = standard error of mean, n = 6.

Ileal Morphology

As shown in Table 5, compared with broilers in CON, ST infection significantly increased (P < 0.05) crypt depth and decreased (P < 0.05) the villus height and villus height/crypt depth. Compared with broilers in ST, supplementation with PCA increased (P < 0.05) the villus height and the ratio of villus height to crypt depth. The ileal morphology of broiler chicks is presented in Figure 2.

Table 5.

Effect of protocatechuic acid (PCA) on the ileal morphology of Salmonella typhimurium-challenged (ST) broiler chicks.

Items CON ST PCA + ST SEM P value
Villus height, mm 0.67a 0.52b 0.72a 0.05 0.009
Crypt depth, mm 0.14b 0.18a 0.16ab 0.01 0.050
Villus height/Crypt depth 4.29a 3.41b 4.43a 0.21 0.103
ab

Means within a row with different superscripts are significantly different (P < 0.05).

1CON, control.

2SEM = standard error of mean, n = 6.

Figure 2.

Figure 2

Effect of protocatechuic acid (PCA) on ileal morphology in Salmonella typhimurium-challenged (ST) broiler chicks. Representative images of the ileum stained with hematoxylin and eosin (H&E). Photomicrographs are shown at 300 × magnification. CON, control.

Ileal Apoptosis

As shown in Figure 3, compared with broilers in CON, ST infection caused ileal apoptosis (brown staining), which were alleviated by PCA + ST treatment.

Figure 3.

Figure 3

Effect of protocatechuic acid (PCA) on ileal apoptosis in Salmonella typhimurium-challenged (ST) broiler chicks. TdT-mediated dUTP Nick-End Labeling (TUNEL) assay: apoptotic cells are brown, and intact cells are blue. Photomicrographs are shown at 800 × magnification. CON, control.

Ileal Mucosal Immune Factors

As shown in Figure 4, compared with broilers in CON, ST-challenge increased (P < 0.05) the contents of IL-1β, IL-6, IL-8, TNF-α, IFN-β, and IFN-γ in ileal mucosa. Compared with broilers in ST, supplementation with PCA decreased (P < 0.05) the ileal contents of IL-1β, IL-6, TNF-α, and IFN-β.

Figure 4.

Figure 4

Effect of protocatechuic acid (PCA) on the contents of immune factors (A and B) in ileum of Salmonella typhimurium- challenged (ST) broiler chicks. Results are presented as mean ± SEM (n = 6). *indicate significance at P < 0.05. CON, control; IL-1β, Interleukin-1β; IL-6, Interleukin-6; IL-8, Interleukin-8; IFN-β, Interferon-β; IFN-γ, Interferon-γ; TNF-α, Tumor necrosis factor-α.

Expression of Ileal Barrier-Related Genes

As shown in Figure 5, compared with broilers in CON, ST-challenge reduced (P < 0.05) the transcriptional expression of claudin 1 (CLDN1), and mucin 2 (MUC2) in ileum. Compared with broilers in ST, supplementation with PCA increased (P < 0.05) the transcriptional expression of CLDN1, zonula occludens-1 (ZO-1), and MUC2 in ileum.

Figure 5.

Figure 5

Effect of protocatechuic acid (PCA) on relative expression of genes related to ileal mucosal barrier function of Salmonella typhimurium- challenged (ST) broiler chicks. Results are presented as mean ± SEM (n = 6). * indicate significance at P < 0.05. CON, control; CLDN1, claudin 1; OCLN, occludin; ZO-1, zonula occludens-1; MUC2, mucin 2; MLCK, myosin light-chain kinase.

Microbiota Composition of the Cecal Digesta

The differences in the cecal microorganism in CON broilers and ST-challenged broilers with PCA treatment were analyzed. As shown in Figure 6A, compared with broilers in CON, ST-challenge decreased (P < 0.05) the Pd, Shannon, and Sobs indices. Compared with broilers in ST, supplementation with PCA increased (P < 0.05) the Chao, Pd, Shannon, and Sobs indices. The PCoA of microbial communities based on Bray distance showed difference in CON, ST and PCA + ST treatments (Figure 6B).

Figure 6.

Figure 6

Effect of protocatechuic acid (PCA) on α-diversity and Principal coordinates analysis (PCoA) of cecal bacterial communities of Salmonella typhimurium- challenged (ST) broiler chicks. CON, control. (A) α-diversity of the gut microbiota among the 3 treatments, as indicated by the Chao, Pd, Shannon, and Sobs indices. *indicate significance at P < 0.05. (B) PCoA of microbial communities among the 3 treatments, based on Bray-Curtis distance (n = 6).

The Phylum distributions of the gut microbiota composition among treatments were analyzed (Figure 7A). Compared with broilers in CON, ST-challenge decreased (P < 0.05) the relative abundance of Firmicutes, whereas that of Proteobacteria increased (P < 0.05) significantly. Compared with broilers in ST, supplementation with PCA increased (P < 0.01) the relative abundance of Firmicutes, whereas that of Bacteroidota and Proteobacteria decreased (P < 0.05) significantly. Concerning genus distributions (Figure 7B), compared with broilers in CON, ST-challenge decreased (P < 0.05) the relative abundance of Lactobacillus, whereas that of Escherichia-Shigella and Enterococcus increased (P < 0.05) significantly. Supplementation with PCA decreased (P < 0.01) the relative abundance of Bacteroides and Escherichia-Shigella, while Lactobacillus were markedly increased (P < 0.05) compared with broilers in ST.

Figure 7.

Figure 7

Differences in the cecal microbiota were determined using 16S rDNA sequencing. (A and B) The relative abundances (%) of phyla and genera with significant differences among treatments. Confidence interval was set at 95%. * indicate significance at P < 0.05, ⁎⁎ indicate significance at P < 0.01. (C) Linear discriminant analysis effect size (LEfSe) identified the most differentially abundant taxa among the treatments. Taxonomic cladogram generated from LEfSe. Red indicates enriched taxa in the controls (CON). Blue indicates enriched taxa in the Salmonella typhimurium- challenged (ST) chickens, and green indicates enriched taxa in the protocatechuic acid (PCA) treatment. Each circle's size reflects the taxon's abundance. The cutoff value of >3.5 was used for the linear discriminant analysis (LDA).

In addition, the predominant bacterial taxa of the cecal microbiota were identified in CON, ST, and PCA + ST treatments using linear discriminant analysis (LDA) effect size (LEfSe). The cladogram in Figure 7C shows those taxa that are significantly enriched in PCA + ST (green). LEfSe results (LDA score >3.5) showed that the relative abundances of Bacteroides and Escherichia-Shigella were dramatically higher (P < 0.05) in the ST treatment whereas the Lactobacillus, Clostridia, Firmicutes, Bifidobacterium, and Bacillaceae were noticeably higher (P < 0.05) in the PCA + ST treatment.

DISCUSSION

Salmonella typhimurium is a food borne pathogen that seriously threatens the health of humans and poultry. With the prohibition of antibiotics in feed, there has been intensive effort in exploring and developing natural extract products to control infection with foodborne pathogens in poultry. Protocatechuic acid, the simple phenolic acid, displays extensive pharmacological properties, including antibacterial effects (Pacheco-Ordaz et al., 2018). The present study demonstrated that dietary PCA protected against deleterious changes in BW, ADG and feed to gain ratio in ST-challenged Yellow broilers. In fact, final BW was even increased above that of the control chickens. A previous experiment found that PCA, provided over a longer period, significantly increased final BW and carcass weight, while reducing feed to gain ratio of broiler chickens (Wang et al., 2019). It has also been reported that feeding broilers with phenolic acid results in faster growth and lower feed to gain ratio (Mountzouris et al., 2011). The present results indicate that PCA could improve growth performance in ST-challenged Yellow broilers.

Protocatechuic acid reduced the activity of plasma DAO and increased ileal mucosal transcriptional expression of CLDN1, ZO-1, and MUC2 in ST challenged Yellow broilers in the present study, and this is consistent with the anti-inflammatory effect of 300 mg/kg PCA in broilers described by Wang et al. (2019). Hu et al. (2020) also reported that PCA increased ileal mucosal gene expression of ZO-1 and CLDN1 in piglets induced by LPS challenge. In the present study, the ileal villus height of broilers supplemented with PCA was higher than that of broilers infected with ST. Previous study had shown that the increase of intestinal villus height is closely related to the growth performance of broilers (Xu et al., 2003). Ileal apoptosis was decreased by PCA in ST-challenged Yellow broilers in the present study. The above results suggest that PCA reduces the barrier damage caused by ST infection in broilers.

With the increasing application of PCA in human nutrition and medicine (Song et al., 2020), animal farming is also paying attention to its use. The present study has shown that PCA increased BW of broilers infected with ST, and also found decreased levels of IL-1β, IL-6, TNF-α, and IFN-β in ileum. Others (Lende et al., 2011; Wang et al., 2019; Xi et al., 2019; Hu et al., 2020) have found PCA to have anti-inflammatory and immune-boosting properties. The above results suggest that PCA reduces the extent of ST-induced inflammation in broilers.

Intestinal microorganisms play an important role in maintaining homeostasis in animals. The cecal microorganisms of broilers include mainly the Firmicutes, Bacteroides, and Proteobacteria phyla. After the broilers were challenged with ST, broilers showed lower abundance of Firmicutes and higher abundance of Proteobacteria compared to controls. The relative abundance of bacteria, with predominance of Firmicutes and Proteobacteria, were similar to others’ studies (Rubinelli et al., 2017; Hu et al., 2020; Ma et al., 2020). It was found in mice that increased abundance of Proteobacteria was related to the occurrence of gastrointestinal inflammation (Carvalho et al., 2012). Proteobacteria are expanding in mice infected with Salmonella (Sekiro et al., 2010). Essential oils (including polyphenols) provided as dietary supplements decreased the abundance of Salmonella enterica in the ceca of broilers (Koscova et al., 2006). Previous experiment found that feeding broilers with PCA results in higher Lactobacillus in cecum (Wang et al., 2019). Similar results were obtained here using PCA in the augmentation of cecal Lactobacillus. The present results indicate that PCA could improve intestinal microbiota composition in chickens challenged with ST.

In conclusion, the present study demonstrates that PCA has anti-inflammatory and intestinal-protective effects in alleviating reduced growth performance, ileal mucosal barrier injury, ileal morphological injury, and ileal inflammation in broilers, caused by ST. Moreover, PCA also attenuated dysbiosis of the intestinal flora caused by ST. These findings provide a rational experimental basis for using PCA as a feed additive in alleviating Salmonella infection.

Acknowledgments

The authors sincerely thank W. Bruce Currie (Emeritus Professor, Cornell University, Ithaca, NY) for his help in presentation of this manuscript.

This work was funded by National Natural Science Foundation of China (31802104), National Key R&D Project (2021YFD1300004), Key Realm R&D Program of GuangDong Province (2020B0202090004), China Agriculture Research System of MOF and MARA (CARS-41), the Natural Science Foundation from Guangdong Province (2021A1515012412, 2021A1515010830), the Science and Technology Program of Guangdong Academy of Agricultural Sciences (202106TD, R2019PY-QF008), and Jiangmen Science and Technology Planning Project (2020030103300009062).

DISCLOSURES

All authors have read and approved this version of the paper and no conflict of interest exists in the submission of this manuscript. Finally, this paper is our original unpublished work and has not been submitted to any other journal for reviews.

REFERENCES

  1. Adedara I.A., Okpara E.S., Busari E.O., Omole O., Owumi S.E., Farombi E.O. Dietary protocatechuic acid abrogates male reproductive dysfunction in streptozotocin-induced diabetic rats via suppression of oxidative damage, inflammation and caspase-3 activity. Eur. J. Pharmacol. 2019;849:30–42. doi: 10.1016/j.ejphar.2019.01.033. [DOI] [PubMed] [Google Scholar]
  2. Als D., Radhakrishnan A., Arora P., Gaffey M.F., Campisi S. Global trends in typhoidal salmonellosis: a systematic review. Am. J. Trop. Med. Hyg. 2018;99:10–19. doi: 10.4269/ajtmh.18-0034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Carvalho F.A., Koren O., Goodrich J.K., Johansson M.E.V., Nalbantoglu I., Aitken J.D., Su Y., Chassaing B., Walters W.A., González A. Transient inability to manage proteobacteria promotes chronic gut inflammation in TLR5-deficient mice. Cell Host Microbe. 2012;12:139–152. doi: 10.1016/j.chom.2012.07.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chao C.Y., Yin M.C. Antibacterial effects of roselle calyx extracts and protocatechuic acid in ground beef and apple juice. Foodborne Pathog. Dis. 2009;6:201–206. doi: 10.1089/fpd.2008.0187. [DOI] [PubMed] [Google Scholar]
  5. Cossart P., Sansonetti P.J. Bacterial invasion: the paradigms of enteroinvasive pathogens. Science. 2004;304:242–248. doi: 10.1126/science.1090124. [DOI] [PubMed] [Google Scholar]
  6. Cox N.A., Cason J.A., Richardson L.J. Minimization of Salmonella contamination on raw poultry. Annu. Rev. Food Sci. Technol. 2011;2:75–95. doi: 10.1146/annurev-food-022510-133715. [DOI] [PubMed] [Google Scholar]
  7. Finstad S., O'Bryan C.A., Marcy J.A., Crandall P.G., Ricke S.C. Salmonella and broiler processing in the United States: relationship to foodborne salmonellosis. Food Res. Int. 2012;45:789–794. [Google Scholar]
  8. Hu R., He Z., Liu M., Tan J., Wu S. Dietary protocatechuic acid ameliorates inflammation and up-regulates intestinal tight junction proteins by modulating gut microbiota in LPS-challenged piglets. J. Anim. Sci. Biotechnol. 2020;11:92. doi: 10.1186/s40104-020-00492-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Koscova N., Jonecova G., Bomba S., Buleca Effect of two plant extracts and Lactobacillus fermentum on colonization of gastrointestinal tract by Salmonella enterica var. Dusseldorf in chicks. Biologia. 2006;61:775–778. [Google Scholar]
  10. Lende A.B., Kshirsagar A.D., Deshpande A.D., Muley M.M., Patil R.R., Bafna P.A., Naik S.R. Anti-inflammatory and analgesic activity of protocatechuic acid in rats and mice. Inflammopharmacology. 2011;19:255–263. doi: 10.1007/s10787-011-0086-4. [DOI] [PubMed] [Google Scholar]
  11. Ma B.H., Mei X., Lei C.W., Li C., Wang H.N. Enrofloxacin shifts intestinal microbiota and metabolic profiling and hinders recovery from Salmonella enterica subsp. enterica serovar Typhimurium infection in neonatal chickens. mSphere. 2020;5 doi: 10.1128/mSphere.00725-20. e00725-00720. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Mountzouris K.C., Paraskevas V., Tsirtsikos P., Palamidi I., Steiner T., Schatzmayr G., Fegeros K. Assessment of a phytogenic feed additive effect on broiler growth performance, nutrient digestibility and caecal microflora composition. Anim. Feed Sci. Technol. 2011;168:223–231. [Google Scholar]
  13. Pacheco-Ordaz R., Wall-Medrano A., Goni M.G., Ramos-Clamont-Montfort G., Ayala-Zavala J.F., González-Aguilar G.A. Effect of phenolic compounds on the growth of selected probiotic and pathogenic bacteria. Lett. Appl. Microbiol. 2018;66:25–31. doi: 10.1111/lam.12814. [DOI] [PubMed] [Google Scholar]
  14. Reis B., Martins M., Barreto B.R., Milhazes N., Garrido E.M., Silva P., Garrido J., Borges F. Structure-property-activity relationship of phenolic acids and derivatives. Protocatechuic acid alkyl esters. J. Agric. Food Chem. 2010;58:6986–6993. doi: 10.1021/jf100569j. [DOI] [PubMed] [Google Scholar]
  15. Rubinelli P.M., Ae K.S., Hong P.S., Roto S.M., Jean N.N., Ryan E.P., Ricke S.C., Zhou H. Differential effects of rice bran cultivars to limit Salmonella Typhimurium in chicken cecal in vitro incubations and impact on the cecal microbiome and metabolome. Plos One. 2017;12 doi: 10.1371/journal.pone.0185002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Sekiro I., Gill N., Jogova M., Tam N.M., Robertson M.L., De Llanos R., Li Y., Finlay B.B. Salmonella SPI-1-mediated neutrophil recruitment during enteric colitis is associated with reduction and alteration in intestinal microbiota. Gut Microbes. 2010;1:30–41. doi: 10.4161/gmic.1.1.10950. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Song J., He Y., Luo C., Feng B., Zhang D. New progress in the pharmacology of protocatechuic acid: a compound ingested in daily foods and herbs frequently and heavily. Pharmacol. Res. 2020;161 doi: 10.1016/j.phrs.2020.105109. [DOI] [PubMed] [Google Scholar]
  18. Standardization Administration of China (SAC) China Agricultural Press; Beijing, China: 2018. Determination of Calcium in Feeds (GB/T 6436-2018) [Google Scholar]
  19. Standardization Administration of China (SAC) China Agricultural Press; Beijing, China: 2018. Determination of Phosphorus in Feeds (GB/T 6437-2018) [Google Scholar]
  20. Tanaka T., Kojima T., Kawamori T., Mori H. Chemoprevention of digestive organs carcinogenesis by natural product protocatechuic acid. Cancer. 1995;75:1433–1439. doi: 10.1002/1097-0142(19950315)75:6+<1433::aid-cncr2820751507>3.0.co;2-4. [DOI] [PubMed] [Google Scholar]
  21. Wang Y., Baikui Y., Xiaoqiang M., Shouqun J., Li. Weifen Protocatechuic acid improved growth performance, meat quality, and intestinal health of Chinese yellow-feathered broilers. Poult. Sci. 2019;98:3138–3149. doi: 10.3382/ps/pez124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Wang Y., Ma X., Ye J., Zhang S., Jiang S. Effects of dietary supplementation with bilberry extract on growth performance, immune function, antioxidant capacity, and meat quality of Yellow-Feathered chickens. Animals. 2021;11:1989. doi: 10.3390/ani11071989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Wang Y., Wang Y., Lin X., Gou Z., Fan Q., Jiang S. Effects of clostridium butyricum, sodium butyrate, and butyric acid glycerides on the reproductive performance, egg quality, intestinal health, and offspring performance of Yellow-Feathered breeder hens. Front. Microbiol. 2021;12 doi: 10.3389/fmicb.2021.657542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Wang B., Ye X., Zhou Y., Zhao P., Mao Y. Glycyrrhizin attenuates salmonella typhimurium-induced tissue injury, inflammatory response, and intestinal dysbiosis in C57BL/6 mice. Front. Vet. Sci. 2021;8 doi: 10.3389/fvets.2021.648698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Xi Z., Hu X., Chen X., Yang Y., Ren J., Wang B., Zhong Z., Sun Y., Yang G., Sun Q. Protocatechuic acid exerts protective effects via suppression of the P38/JNK- NF-κB signalling pathway in an experimental mouse model of intracerebral haemorrhage. Eur. J. Pharmacol. 2019;854:128–138. doi: 10.1016/j.ejphar.2019.03.008. [DOI] [PubMed] [Google Scholar]
  26. Xu Z.R., Hu C.H., Xia M.S., Zhan X.A., Wang M.Q. Effects of dietary fructooligosaccharide on digestive enzyme activities, intestinal microflora and morphology of male broilers. Poult. Sci. 2003;82:1030–1036. doi: 10.1093/ps/82.6.1030. [DOI] [PubMed] [Google Scholar]
  27. Yan J.J., Jung J.S., Hong Y.J., Moon Y.S., Suh H.W., Kim Y.H., Yun-Choi H.S., Song D.K. Protective effect of protocatechuic acid isopropyl ester against murine models of sepsis: inhibition of TNF-alpha and nitric oxide production and augmentation of IL-10. Biol. Pharm. Bull. 2004;27:2024–2027. doi: 10.1248/bpb.27.2024. [DOI] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES