An active fraction from Spatholobus suberectus dunn inhibits the inflammatory response by regulating microglia activation, switching microglia polarization from M1 to M2 and suppressing the TLR4/MyD88/NF-κB pathway in LPS-stimulated BV2 cells

Abstract

Neurodegenerative disorders are known to be associated with neuroinflammation caused by microglia. Therefore, regulation of microglia activation and polarization to inhibit neuroinflammatory reactions seems to hold promise as a therapeutic approach in neurodegenerative disorders. Spatholobus suberectus Dunn (SSD) has been utilized as a traditional Chinese medicine remedy for brain diseases for thousands of years. SSD possesses various pharmacological activities, such as circulation invigoration, neuroprotection, and anti-inflammatory. The objective of this research was to examine the anti-neuroinflammatory effects and molecular mechanisms of an active fraction from SSD (ASSD) in vitro culture BV2 cells, a type of mouse microglia cell line. The inflammatory responses in BV2 cells were induced by stimulating them with 1 μg/mL lipopolysaccharide (LPS) and the effects of ASSD on LPS-stimulated inflammation were monitored. Besides, by using the methods of Western blot, immunofluorescence, and RT-PCR, the mechanisms of ASSD on microglia activation, M1/M2 polarization, and the TLR4/MyD88/NF-κB pathway were investigated. Our findings demonstrate that the treatment doses of ASSD neither induce cytotoxicity nor promote the production of inflammatory cytokines. In addition, immunofluorescence analysis show that ASSD inhibited the expression of ionized calcium-binding adapter molecule 1(Iba1) and inducible nitricoxide synthase (iNOS), and induced arginase 1 (Arg1) expression. Moreover, Western blot analysis indicated that ASSD significantly down-regulated TLR4, MyD88, p-IκB, NF-κB p65, and NF-κB p-p65 protein expression levels. Furthermore, RT-qPCR assay show that ASSD significantly down-regulated iNOS, TLR4, MyD88, and NF-κB mRNA expression levels, and up-regulated Arg1 mRNA expression level. According to the findings, ASSD can suppress microglia-mediated inflammatory responses by modulating microglia activation, inducing a shift from M1 to M2 polarization, and inhibiting the TLR4/MyD88/NF-κB signaling pathway.

Highlights

• •ASSD at the treatment doses causes no cytotoxicity, and significantly weakens inflammatory response in BV2 cells.
• •ASSD suppresses the activation of microglia, and induces a shift in microglial polarization from M1 to M2 in BV2 cells.
• •ASSD reversed the activation of TLR4/MyD88/NF-κB pathway in BV2 cells.

1. Introduction

In recent years, there has been a significant amount of research focused on investigating the impact of neuroinflammation on central nervous system (CNS) disorders [1,2]. Various neurodegenerative disorders are linked to the development and advancement of neuroinflammation. The etiology and progression of various neurodegenerative disorders are linked to the development and advancement of neuroinflammation [3], such as depression [4,5] and Alzheimer's disease [6]. Microglia, as the resident macrophage-like cells, is likely the most crucial innate immune cells in CNS, where they participated in the regulation of cellular inflammatory response [6,7]. Just like macrophages, microglia can also be classified into M1 and M2 phenotypes based on their polarization [8]. The primary effects of M1 polarization involve the escalation of inflammatory cytokines and cytotoxic mediators, which lead to cellular harm and demise in CNS [9,10]. Conversely, the polarization of M2 may enhance the process of nerve regeneration in case of brain damage [11] and plays a crucial function in regulating inflammation and immunity [12].

Microglia are known to express toll-like receptor 4 (TLR4) predominantly, which triggers the inflammatory response in the brain and has been extensively documented [13]. Stresses, such as LPS, are capable of activating TLR4, which in turn triggers the recruitment of Myeloid differential protein-88 (MyD88) and subsequently promotes the activation of nuclear factor-κB (NF-κB). This is then followed by an elevation in the production of pro-inflammatory cytokines [14]. These inflammatory cytokines in turn activate the TLR4/MyD88/NF-κB signaling pathway, which is critical for the persistence of inflammatory responses.

Spatholobus suberectus Dunn (SSD) has been utilized as a Chinese traditional herbal medicine for thousands of years [15,16]. SSD and its compound prescriptions have been widespread in the treatment of brain diseases based on the traditional Chinese medical theory [17]. Many studies on SSD have indicated that it possesses various pharmacological effects, including circulation invigoration, neuroprotection anti-inflammatory, anti-platelet, anti-bacteria and antitumor activities [16,18,19]. Our previous studies revealed that SSD treatment significantly inhabited depression symptoms of mice and rats, and the mechanisms may relate to neuroinflammation [20]. However, it remains unclear if SSD could influence the neuroinflammation in microglia, and its related molecular mechanisms need to explore. In this study, the effects of an active fraction from SSD (ASSD) on microglia activation, M1/M2 polarization, and TLR4/MyD88/NF-κB pathway were investigated.

2. Materials and methods

2.1. Drugs and reagents

Spatholobus Suberectus Dunn was purchased from Nanning Jingchang Chinese Pharmaceutical Co. Ltd (Nanning, China). A voucher specimen (20,210,501) was identified by Professor Xianbiao Zeng, department of pharmacology, Guangxi institute of Chinese medicine and pharmaceutical science and was deposited in the Herbarium of Guangxi Institute of Chinese Medicine and Pharmaceutical Science. Formononetin was purchased from Shanghai Macklin Biochemical Co., Ltd (Shanghai, China). IL-1α, IL-6, and TNF-α ELISA kits were purchased from Wuhan Fine Biotech Co.,Ltd. (Wuhan, China). Resatorvid (10 mM *1 mL in DMSO) was purchased from MedChemExpress LLC (New Jersey, USA). The detail of related antibodies, material and reagents was shown in Supplementary Table 1.

2.2. Preparation of ASSD

Dry Spatholobus suberectus Dunn powder (0.25 kg) was extracted with 2 L 95% (v/v) ethanol for 6 h at under 55 ± 5 °C 3 times. The total extracts were filtered and concentrated into a dense paste using a rotary evaporator. The dense paste was dissolved with 0.25 L distilled water (55 ± 5 °C), and filtered to removed precipitation. The filtrates were condensed and dried under reduced pressure to form the active fraction of Spatholobus suberectus Dunn (ASSD). The yield (w/w) of ASSD was (22.5 ± 0.05) %.

ASSD were subjected to high performance liquid chromatography (HPLC) method for quality control, and formononetin (one of the active constituents of ASSD) was used as a reference. The analytical profiles were obtained with an UltiMate 3000 system equipped with RS variable wavelength detector (Thermo Fisher Scientific, USA). A Hypersil GOLD™ column (4.6 × 250 mm, 5 μm) was used. A binary isocratic elution of methanol (55%) and deionized water (45%) was selected. The detection conditions (flow rate: 1.0 mL/min, detection wavelength: 248 nm, column oven: 30 °C) were used. The data were obtained with Chromeleon Chromatography Data System (CDS) Software.

2.3. Cell culture and drug adminstration

The mouse microglia cell line, BV2 cells (Procell CL-0493) were kindly provided by Procell Life Science and Technology Co., Ltd. Cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin in a humidified atmosphere of 5% CO2 and maintained at 37 °C.

ASSD (5, 10, 20 μg/mL) or resatorvid (1 μM), mixed in the cultured media, were incubated with the cells for 24 h. Then the cultured media was removed. After 3 times of PBS washed, fresh cultured media containing 1 μg/mL LPS was added to the cells and incubated for 4 h. For sample preparation, ASSD was initially dissolved in 100% dimethyl sulfoxide (DMSO) to obtain various concentrations, and further diluted 1000 times with PBS. In the present study, 0.1% DMSO was used as a vehicle control.

2.4. Cell viability and proliferation

BV2 cells were seeded to a 96-well plate and pre-incubated for 4 h, and ASSD (5, 10, 20 μg/mL) or 0.1% DMSO were added to the cells and incubated for 24 h. The supernatant was removed and replaced with fresh cultured media containing 1 μg/mL LPS or equal volume of PBS and incubated for 4 h. Then the culture media was replaced with CCK solution and incubated for an additional 2 h. Cell viability and proliferation were calculated from the optical density at 450 nm using a microplate reader.

2.5. Measurement of IL-1α, IL-6 and TNF-α

BV2 cells were seeded to a 96-well plate and pre-incubated for 4 h, then treated with ASSD (5, 10, 20 μg/mL) or resatorvid (1 μM) for 24 h. After stimulation with LPS for 4 h, cultured media from each group of cells were collected and stored at −80 °C until tested. The IL-1α, IL-6 and TNF-α levels in the cultured media of cells from each group were measured with ELISA kits, following the manufacturer's instructions.

2.6. Immunofluorescence staining

The cells were cultured in 24-well plates and treated as described in 2.5. After stimulation with LPS for 4 h, the cultured media were removed. Then 4% paraformaldehyde was used to fix the cells for 15 min at 20 °C, and 0.3% Triton X-100 was used to permeate the cells for 10 min. The cells were blocked with PBS containing 5% BSA to inhabit nonspecific reactions for 1 h at room temperature. The cells were incubated with anti-mouse Iba-1 (1:200), anti-rabbit arg1 (1:200), and anti-rabbit iNOS (1:100) at 4 °C overnight. On the second day, the cells were washed three times with PBS and incubated with donkey anti-mouse AlexFluor 647® (1:500), goat anti-rabbit AlexFluor 488® (1:500) secondary antibodies for 2 h under the protection of light. DAPI was used to stain the nucleus. The digital images were captured using a fluorescence microscope (Leica DMi8, Germany).

2.7. Western blot analysis

BV2 cells were cultured in 6-well plates and treated as mentioned in 2.5. After LPS stimulation for 4 h, cells were collected and extracted with 200 μL RIPA lysis buffer (RIPA: PMSF: phosphatase inhibito = 100:1:1) for 20 min. Then entrifugation was performed at 12,000 RPM at 4 °C for 15 min to obtain protein samples. After measuring the protein content with BCA method, sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) was perform to separate proteins. The separated proteins were transferred to PVDF membranes. After blocking with 5% non-fat milk for 2 h in TBS-T, the membranes were incubated with primary antibodies (TLR4, 1:2000; MyD88, 1:1000; p-IκB, 1:1000; NF-κB p65, 1:1000; NF-κB p-p65, 1:1000; GAPDH, 1:5000) at 4 °C overnight. On the following day, each membrane was washed with TBS-T buffer three times (10 min/time), and incubated for 1 h with secondary antibodies diluted in secondary antibody dilution buffer (1:3000) under the protection of light. Protein bands were visualized using the Odyssey FC Imager with Odyssey 1.1 software (Li-Cor). Digital images were analyzed using densitometry measurements by Image J software. GAPDH was used as the internal control. All values were normalized to GAPDH and expressed as arbitrary units relative to the control.

2.8. RT-qPCR analysis

The cells of 6 groups were collected after LPS stimulation for 4 h. Total RNA was isolated with RNAsimple Isolation Reagent Kits (Tiangen, China), following the manufacturer's protocol. The quality and yield of mRNA were quantified using a NanoDrop ND-1000 spectrophotometer (ThermoFisher Scientific, USA). Then, cDNAs were synthesized with First Strand cDNA Synthesis Kits (Tiangen, China). The qPCR assay was conducted with the 7500 Real-Time PCR System (Applied Biosystems, USA). The PCR reaction was conducted in a final volume of 20 μL containing 10 μL of SuperReal premix Reagent (Tiangen, China), 0.6 μL of forward primer, 0.6 μL of reverse primer, 6.8 μL of RNase-free water and 2 μL of cDNA. Reaction conditions were as follows: 2 min at 95 °C (first segment, one cycle), followed by 10 s at 95 °C and 30 s at 60 °C (second segment, 40 cycles). A housekeeping gene for GAPDH was used as an endogenous control. The specific primers for TLR4, MyD88, NF-κB, iNOS, Arg1 and GAPDH are shown in detail in Table 1. All of the primers were synthesized by Shenggong Biotech (Shanghai) Co., Ltd., China.

Table 1.

Primers used for RT-qPCR.

Gene	Sense primer (5′-3′)	Anti-sense primer (5′-3′)	Product size
GAPDH	ACTTGAAGGGTGGAGCCAAA	GCCCTTCCACAATGCCAAAG	189 bp
TLR4	GAGCCGGAAGGTTATTGTGGTAGTG	AGGACAATGAAGATGATGCCAGAGC	126 bp
MyD88	AGCAGAACCAGGAGTCCGAGAAG	GGGCAGTAGCAGATAAAGGCATCG	148 bp
NF-κB	AAATGGGAAACCGTATGAGCCTGTG	GTTGTAGCCTCGTGTCTTCTGTCAG	92 bp
iNOS	ATCTTGGAGCGAGTTGTGGATTGTC	TAGGTGAGGGCTTGGCTGAGTG	131 bp
Arg1	AGACAGCAGAGGAGGTGAAGAGTAC	AAGGTAGTCAGTCCCTGGCTTATGG	107 bp

2.9. Statistical analysis

Statistical analysis was performed using SPSS 16.0 for windows. (SPSS Inc., USA). The data were expressed as the mean ± SE. The data was analyzed using one-way ANOVA. LSD t-test was conducted multiple post hoc comparisons. A p-value <0.05 was considered to be statistically significant. The detail statistical parameters were shown in Supplementary Table 2. Raw data used in WB, IF, and qPCR quantifications and statistical analysis, and raw images of Western blot and immunofluorescence staining were available in the figshare platform. The DOI is https://doi.org/10.6084/m9.figshare.21746777.v2 and https://doi.org/10.6084/m9.figshare.22010282.

3. Results

3.1. Quantification of formononetin in ASSD

The retention time of formononetin was 13.2 min, and formononetin was clearly separated from other constituents in ASSD (Fig. 1a and b). The standard curve for formonetin was y = 0.934x+0.214 (R² = 0.999), which was derived from the peak areas under the curve and series concentrations. The linear range was 1.43–44.6 μg/mL. The content of formononetin was determined to be 102.42 ± 2.09 mg/g in ASSD, which calculated by the standard curve (Fig. 1c).

Fig. 1.

HPLC chromatograms for (a) ASSD and (b) formononetin. The content of formononetin in ASSD, according to (c) a standard curve was determined.

3.2. Influence of ASSD on the viability of BV2 microglial cells

As presented in Fig. 2a, treatment with ASSD (5, 10, 20 μg/mL) with or without exposure to LPS caused no cytotoxicity. Also, the vehicle control, 0.1% DMSO, had no cytotoxicity on BV2 cells.

Fig. 2.

Effects of ASSD on (a) viability of microglia, and secretion of (b) IL-1α, (c) IL-6 and (d) TNF-α. The data values are expressed as the mean ± SE (n = 4–6). ^##P < 0.01 compared to the control group. **P < 0.01 compared to the LPS group.

3.3. ASSD restrains the secretion of cytokines in BV2 microglial cells stimulated with LPS

To study the influences of ASSD on the LPS-induced inflammatory cytokine secretion, ELISA method was used to analysis the levels of IL-1α, IL-6 and TNF-α. The results showed that IL-1α, IL-6 and TNF-α levels were significantly increased in the culture media of the BV2 microglia stimulated with LPS (P < 0.01, vs control group). However, ASSD or resatorvid pre-treatment markedly decreased the release of these pro-inflammatory cytokines (P < 0.01, vs LPS group). (Fig. 2b, c, Fig. 2d).

3.4. ASSD regulated the activation and polarization of microglia stimulated with LPS

To determine the effect of ASSD on microglia activation and polarization, immunofluorescent staining for Iba1 (activated microglia marker), iNOS (M1 microglia marker), and Arg1 (M2 microglia marker) were performed. These results indicated that LPS stimulated significantly increased the Iba1⁺, iNOS⁺ and Iba1⁺ iNOS⁺ microglia cells, ASSD (10 μg/mL and 20 μg/mL) or resatorvid pre-treatment significantly suppressed the increase in Iba1⁺, iNOS⁺ and Iba1⁺ iNOS⁺ microglia cells (P < 0.01, vs LPS group). ASSD (5 μg/mL) significantly down-regulated the iNOS⁺ microglia cells (P < 0.05, vs LPS group), but had no effects on Iba1⁺ and Iba1⁺ iNOS⁺ microglia cells [Fig. 3(a-d)]. In the experiment of ASSD on M2 polarization, after LPS stimulated, the Iba1⁺, and Iba1⁺ Arg1⁺ microglia cells were markedly increase, and the Arg1⁺ microglia cells were decrease (P < 0.01, vs control group). However, ASSD (10 μg/mL and 20 μg/mL) or resatorvid pre-treatment significantly decreased the number of Iba1⁺ microglia cells, and increased the numbers of Arg1⁺, and Iba1⁺ Arg1⁺ microglia cells (P < 0.01, vs LPS group). ASSD (5 μg/mL) significantly down-regulated the Iba1⁺ microglia cells (P < 0.05, vs LPS group), but had no effects on Arg1⁺, and Iba1⁺ Arg1⁺ microglia cells [Fig. 4(a-d)].

Fig. 3.

Effects of ASSD on (a) microglia activation marker Iba1 (red) and M1 marker iNOS (green), and the levels of (b) Iba1⁺, (c) iNOS⁺, and (d) Iba1⁺ iNOS⁺ cells were analyzed. The data values are expressed as the mean ± SE (n = 4). ^##P < 0.01 compared to the control group. *P < 0.05, **P < 0.01, compared to the LPS group. The scale bar is 100 μm.

Fig. 4.

Effects of ASSD on (a) microglia activation marker Iba1 (red) and M2 marker Arg1 (green), and the levels of (b) Iba1⁺, (c) Arg1⁺, and (d) Iba1⁺ Arg1⁺ cells were analyzed. The data values are expressed as the mean ± SE (n = 4). ^##P < 0.01 compared to the control group. *P < 0.05, **P < 0.01, compared to the LPS group. The scale bar is 100 μm.

3.5. ASSD inhibits the activation of TLR4/MyD88/NF-κB pathway in LPS-stimulated BV2 microglial cells

Because the TLR4/MyD88/NF-κB pathway plays a vital role in the inflammatory process, the effects of ASSD on protein expressions of TLR4, MyD88, p-IκB, and NF-κB, and NF-κB p65 were examined. The results of Western blot analysis indicated that the levels of TLR4, MyD88, p-IκB, NF-κB p65 and NF-κB p-p65 markedly increased after stimulated with LPS (P < 0.01, vs control group). In contrast, both ASSD and resatorvid pre-treatment suppressed the increase in TLR4, MyD88, p-IκB, NF-κB p65 and NF-κB p-p65 (P < 0.05 or P < 0.01, vs LPS group) [Fig. 5(a-f)].

Fig. 5.

Effects of ASSD on the expression of TLR4/MyD88/NF-κB pathway related proteins, including (a) TLR4, (b) MyD88, (c) p-IκB, and (d) NF-κB p65, and (e) NF-κB p-p65, in LPS-stimulated BV2 microglia cells. (f) The bands are from a representative blot. The data values are expressed as the mean ± SE (n = 4). ^##P < 0.01 compared to the control group. *P < 0.05, **P < 0.01, compared to the LPS group.

3.6. ASSD modulate the mRNA expression related to microglial polarization and TLR4/MyD88/NF-κB pathway

To further investigate the effect of ASSD on microglial polarization and TLR4/MyD88/NF-κB pathway. The iNOS, Arg1, TLR4, MyD88, and NF-κB mRNA expression were examined by RT-qPCR. As shown in Fig. 6a-e, the mRNA expression of iNOS, TLR4, MyD88, and NF-κB in microglia cells was up-regulated, and the mRNA expression of Arg1 was down-regulated in the LPS group, compared to the control group (P < 0.01)., the mRNA expression of iNOS, TLR4, MyD88, and NF-κB were down-regulated, and the mRNA expression of Arg1 was up-regulated in the ASSD or resatorvid pre-treatment group, compared to the LPS group (P < 0.05 or P < 0.01).

Fig. 6.

Effects of ASSD on the mRNA expressions of (a) iNOS, (b) Arg1, (c) TLR4, (d) MyD88, and (e) NF-κB in LPS-stimulated BV2 microglia cells. The data values are expressed as the mean ± SE (n = 4). ^##P < 0.01 compared to the control group. *P < 0.05, **P < 0.01, compared to the LPS group.

4. Discussion

In the previous research, we found that ASSD treatment effectively alleviated depression symptoms in mice and rats. In addition, ASSD treatment inhibited the levels of inflammatory cytokines, and the protein expression of NF-κB p65 in hippocampus of depression rats [20]. This study shows that ASSD suppressed the secretion of inflammation cytokines in LPS-stimulated BV2 microglial cells. Neuroinflammation mediated by microglia has been identified as a significant risk factor for neurodegenerative diseases [21]. Increased microglia activation could induce neuroinflammation and degeneration diseases by releasing various inflammation mediators and inflammation cytokines [22]. It is reported that the activation of hippocampal microglia significantly increased in depression patients compared to healthy controls [23]. Our results indicated that the anti-depression effect of ASSD may be contributed to suppression of neuroinflammation mediated by microglia.

We delved deeper into the function of ASSD in BV2 microglia cells stimulated with LPS. In response to LPS, microglia activated and polarized to an M1 phenotype, which secrete specific pro-inflammatory cytokines, such as TNF-α and IL-6, to participate in inflammatory reactions. Conversely, M2 microglia mainly employ anti-inflammatory cytokines, including IL-4, IL-13, IL-10, and TGF-β, to inhibit inflammation and promote tissue repair [24,25]. Therefore, it may be functionally important to strictly regulate the activation and polarization of microglia in order to alleviate inflammatory reactions and treat neurodegenerative diseases. In this study, the expression of Iba1 (activated microglia marker), iNOS (M1 microglia marker), and Arg1 (M2 microglia marker) were evaluated using immunofluorescence staining. We found that ASSD at doses of 10 μg/mL and 20 μg/mL could significantly decrease the Iba1⁺ in BV2 cells stimulate with LPS. Interestingly, ASSD (10 μg/mL and 20 μg/mL) also induces a shift in microglial polarization from M1 to M2 in BV2 cells stimulated with LPS. In addition, ASSD could significantly downregulate the mRNA expressions of iNOS, and upregulate the mRNA expression level of Arg1. These results suggest that ASSD may play a neuroprotective role by modulating microglia activation, and inducing a shift from M1 to M2 polarization.

Among other TLRs, TLR4 is abundantly expressed in microglia [6]. TLR4 activation induces phosphorylation of NF-κB through the Myd88 adaptor, and enhances the secretion of inflammatory chemokines and cytokines by microglia [13,26].

It has been demonstrated that the polarization of microglia [27], as well as cell survival and proliferation, inflammation, and immune response processes [28], are affected by NF-κB factors. Numerous evidences show that TLR4/MyD88/NF-κB signaling pathway maybe a vital link between inflammation and depression [29,30]. We explored whether ASSD affects neuroinflammation through alterations in the TLR4/MyD88/NF-κB pathway. The results showed that treatment of ASSD efficiently inhibit the mRNA and protein levels of TLR4, MyD88, and NF-κB. Furthermore, ASSD suppressed the phosphorylation of IκB and NF-κB p65. These results indicate that ASSD inhibits LPS-induced inflammatory responses modulated by the TLR4/MyD88/NF-κB pathway in BV2 microglia.

In conclusion, the results of this study showed that ASSD inhibit neuroinflammatory in vitro by attenuating inhibiting inflammatory response in BV2 cells stimulated with LPS. These beneficial effects are associated with modulating microglia activation, inducing a shift from M1 to M2 polarization, and inhibiting the TLR4/MyD88/NF-κB signaling pathway. These findings demonstrated the potential of ASSD as a safe and effective candidate for the treatment of inflammation-related neurodegenerative disorders.

Author contribution statement

Molu Ban: Analyzed and interpreted the data; Wrote the paper.

Hua Su, Xianbiao Zeng, Chunxia Chen, Shuguang Zhou: Performed the experiments.

Xiaoyu Chen: Conceived and designed the experiments; Contributed reagents, materials, analysis tools or data.

Zhihuan Nong: Conceived and designed the experiments; Analyzed and interpreted the data; Wrote the paper.

Funding statement

Mr Zhihuan Nong was supported by Young Scientists Fund [No. 82003967].

Data availability statement

Data included in article/supp. Material/referenced in article.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix A. Supplementary data

The following are the Supplementary data to this article.