Effects of maternal methionine supplementation on the response of Japanese quail (Coturnix coturnix japonica) chicks to heat stress

Abstract

This study investigated the hypothesis that methionine supplementation of Japanese quail (Coturnix coturnix japonica) hens can reduce the effects of oxidative stress and improve the performance of the offspring exposed to heat stress during growth. For that, the quail hens were fed with three diets related to the methionine supplementation: methionine-deficient diet (Md); diet supplemented with the recommended methionine level (Met1); and diet supplemented with methionine above the recommended level (Met2). Their chicks were identified, weighed, and housed according to the maternal diet group from 1 to 14 d of age. On 15 d of age, chicks were weighed and divided into two groups: thermoneutral ambient (constant temperature of 23 °C) and intermittent heat stress ambient (daily exposure to 34 °C for 6 h). Methionine-supplemented (Met1 and Met2) hens had higher egg production, better feed conversion ratio, higher hatchability of total and fertile eggs, and offspring with higher body weight. Supplemented (Met1 and Met2) hens showed greater expression of glutathione synthase (GSS) and methionine sulfoxide reductase A (MSRA) genes, greater total antioxidant capacity, and lower lipid peroxidation in the liver. The offspring of hens fed the Met2 diet had lower death rate (1 to 14 d), higher weight on 15 d of age, weight gain, and better feed conversion ratio from 1 to 14 d of age. Among chicks reared under heat stress, the progeny of methionine-supplemented hens had higher weight on 35 d, weight gain, expression of GSS, MSRA, and thermal shock protein 70 (HSP70) genes, and total antioxidant capacity in the liver, as well as lower heterophil/lymphocyte ratio. Positive correlations between expression of glutathione peroxidase 7 (GPX7) and MSRA genes in hens and offspring were observed. Our results show that maternal methionine supplementation contributes to offspring development and performance in early stages and that, under conditions of heat stress during growth, chicks from methionine-supplemented hens respond better to hot environmental conditions than chicks from nonsupplemented hens. Supplementation of quail hens diets with methionine promoted activation of different metabolic pathways in offspring subjected to stress conditions.

•Maternal diet can modulate short- and long-term performance and adaptive responses of her offspring to adverse environments.

•The modulation of the phenotypic characteristics of the progeny through the maternal diet is a beneficial strategy with a high probability of being accepted and implemented in large poultry productions.

Introduction

Breeding performance is particularly important in bird production. It is estimated that each breeder produces about 100 broilers per year (Berghof et al., 2013). Different factors such as genetic, age and ambient influence quail hens and egg performance (Santos et al., 2015; Aguiar et al., 2017; Kalvandi et al., 2019; Kim et al., 2021). Diet also has a major impact on the production efficiency of quail hens (Kalvandi et al., 2019). Stress caused by nutrient deficiency, such as methionine deficiency, can compromise body homeostasis, affecting the development and performance of layer breeders. Previous studies showed that methionine supplementation increases egg production and weight (Shafer et al., 1998; Narváez-Solarte et al., 2005; Gomez et al., 2009; Kalvandi et al., 2019). Methionine is associated with the production of growth-related hormones and plays a key role in protein synthesis (Del Vesco et al., 2013). Considered an antioxidant, methionine can increase total anti-oxidant capacity and minimize the action of reactive oxygen species. In addition, the compound acts in the intestinal environment, increasing digestion efficiency, and nutrient absorption (Elwan et al., 2019).

The conditions occurring from egg fertilization to hatching, a period known as “early life”, determine how the progeny will respond to its future environment. It is believed that the environment influences gene expression through epigenetic mechanisms of gene regulation (Turner, 2009; Nayak et al., 2016). The conditions experienced by the parental generation during embryo development may produce effects on the progeny, a phenomenon known as intergenerational or transgenerational epigenetic inheritance (Zimmer et al., 2017). Thus, by altering the maternal environment, it is possible to maximize benefits and minimize adverse effects on the progeny (Dixon et al., 2016).

Heat stress is still a major issue in birds production. Animals in situation of thermal stress use to present reduced feed intake in order to minimize the production of internal heat; this causes a cascade of negative effects on their productive performance as heat stress causes reduced feed efficiency by negatively affecting gut health and nutrient metabolism, which in turn affects muscle growth (Rostagno, 2020; Nawaz et al., 2021). In addition, heat stress induces oxidative stress and suppresses the animals cellular and humoral immune responses, which gradually depresses the animals health and increases the mortality rate (Kalvandi et al., 2019; Ahmad et al., 2022). Since refrigerated environments for production birds demand high production costs, one of the most targeted strategies in order to minimize the environmental impact on birds has been mainly the manipulation of the animal diet (Mohamed et al., 2019).

As maternal environment (including maternal diet) can also affect offspring development (Aigueperse et al., 2013; Widowski et al., 2022; Xia et al., 2022), a strategy to promote a better ability to respond to challenges in the offspring would be to manipulate or supplement breeder diets with nutrients with specific functions (van der Waaij et al., 2011; Aigueperse et al., 2013; Moraes et al., 2014; Koppenol et al., 2015). Despite the growing interest in the topic, studies evaluating how maternal environment can prepare its offspring to respond to their own challenges during the growth phase are still scarce (Guerrero-Bosagna et al., 2018).

Therefore, this study investigates the hypothesis that methionine supplementation of Japanese quail (Coturnix coturnix japonica) hens can reduce the effects of oxidative stress (induced by heat stress) and improve the performance of progeny subjected to thermal stress during growth. We aimed to answer the following research questions: “What is the effect of methionine in the diet of quail hens on early progeny development?” and “How do maternal diet (supplemented with methionine) affect the response of quail chicks to their environment?”.

Materials and Methods

All animal experiments were approved (protocol number 2402310719) by the Animal Ethics Committee of the State University of Maringá, Paraná, Brazil.

Quail hens

Two hundred 1 d old female Japanese quail were reared in group cages up till 98 d of age. During this period, bird development and egg laying rate were monitored daily. On 98 d of age, 30 quail with a mean body weight of 154.60 ± 2.76 g and an egg laying rate of 85% ± 0.7% were assigned to three treatments (Table 1): a methionine-deficient diet (Md, nonsupplemented with methionine), a diet supplemented with methionine (dl-methionine feed grade 99%, MetAMINO, Evonik Industries, Brazil) at the level recommended by Rostagno et al. (2017) (Met1), and a diet oversupplemented with methionine (Met2). Each treatment consisted of 10 quail hens, and each bird was considered as an experimental unit and repetition. During the experimental period, birds were kept in individual cages with ad libitum access to feed and water. Quail hens were fed the experimental diets for 38 days (from age 98 d to 136 d). From 21 d of treatment onward, 30 male breeders matched by body weight (161.20 g) were placed in female cages for 1 h daily. Paternal effects were minimized by rotating the males. Males were reared in individual metal cages in an environment with thermal comfort temperature (approximately 23 °C) throughout the experimental period. These birds were fed a basal diet (19.597% crude protein; 2795.309 kcal/kg apparent metabolizable energy; 3.151% calcium; 0.330% phosphorus available; 1.051% lysine; and 0.600% methionine) and had ad libitum access to feed and water throughout the experiment. Male quail were used only for mating.

Table 1.

Composition and nutrient content of experimental diets for Japanese quail (Coturnix coturnix japonica) hens

Ingredients (%)	Experimental diet1
	Md	Met1	Met2
Ground corn	56.639	56.303	56.088
Soybean meal	32.200	32.300	32.300
Common salt	0.375	0.375	0.375
Soybean oil	1.700	1.600	1.500
Calcitic limestone	7.520	7.520	7.520
Dicalcium phosphate	0.990	0.990	0.990
l -Lysine HCL	0.130	0.130	0.130
dl -Methionine (99%)	-	0.335	0.650
l -Threonine	0.046	0.047	0.047
Vitamin–mineral premix for layers2	0.400	0.400	0.400
Total	100.000	100.000	100.000
Energy and nutrient contents (calculated)
Metabolizable energy (kcal/kg)	2796.357	2795.309	2795.061
Crude protein (%)	19.377	19.597	19.767
Calcium (%)	3.151	3.151	3.151
Available phosphorus (%)	0.330	0.330	0.330
Sodium (%)	0.171	0.171	0.170
Digestible amino acids (%) (calculated)
Methionine	0.268	0.600	0.910
Methionine + cystine	0.531	0.863	1.174
Lysine	1.049	1.051	1.051
Threonine	0.713	0.715	0.714
Trypthopan	0.215	0.215	0.215

¹ Md, methionine-deficient diet; met1, diet supplemented with the recommended level of methionine (dl-methionine Feed grade 99%, MetAMINO^®, Evonik Industries, Brazil) (Rostagno et al., 2017); met2, diet oversupplemented with methionine (dl-methionine Feed grade 99%, MetAMINO^®, Evonik Industries, Brazil).

²Provided per kg of product, 2,250,000 IU vitamin A; 500,000 IU vitamin D3; 7,000 IU vitamin E; 450 mg vitamin B1; 1,000 mg vitamin B2; 450 mg vitamin B6; 3,500 mg vitamin B12; 420 mg vitamin K3; 2,500 mg calcium pantothenate; 7,000 mg niacin; 180 mg folic acid; 15 mg biotin; 55 g choline; 12 g zinc; 12 g iron; 15 g manganese; 3,000 mg copper; 250 mg iodine; 50 mg cobalt; 72 mg selenium; 40 mg ethoxyquin; 40 mg butylated hydroxyanisole.

Eggs were collected daily in the last 10 d of experimentation (after 8 d of mating) to allow sufficient time for fertilization to occur. Collected eggs were identified by quail hens, weighed, and stored at 23 °C. On the last day of collection, all eggs were acclimated to ambient temperature, placed in fruit nets to separate individually, and transferred to an incubator (Luna 240, Chocmaster, Piraquara, Paraná, Brazil) at 37 °C and 60% relative humidity. After 19 d of incubation, unhatched eggs were opened and classified as infertile eggs or dead embryos.

Progeny

After hatching, 156 chicks were identified, weighed, and housed in a heated brooder according to the maternal diet group (Figure 1). From 1 to 14 d of age, chicks were fed a starter diet (Table 2) and water ad libitum.

Figure 1.

Schematic diagram of the experimental design. Eggs produced by quail hens fed methionine-deficient diet (Md), methionine-supplemented (met1), and methionine-oversupplemented (met2) diets were collected for 10 d and incubated under the same conditions. Upon hatching, all chicks were raised under standard conditions and fed a basal diet for 14 d. From 15 to 35 d of age, half of the chicks from each group were raised under thermoneutral conditions (23 °C) and the other half under intermittent heat stress conditions (daily exposure to 34 °C for 6 h).

Table 2.

Composition and nutrient content of starter (1 to 14 days of age) and grower (15 to 35 days of age) diets for Japanese quail (Coturnix coturnix japonica)

Ingredients (%)	Phases
	Starter	Grower
Ground corn	61.876	65.272
Soybean meal	34.000	30.600
Common salt	0.445	0.605
Soybean oil	0.300	-
Calcitic limestone	1.125	1.405
Dicalcium phosphate	1.530	1.400
l -Lysine HCL	0.123	0.138
dl -Methionine (dl-methionine Feed grade 99%, MetAMINO®)	0.185	0.165
l -Threonine	0.016	0.015
Vitamin–mineral premix1	0.400	0.400
Total	100.000	100.000
Energy and nutrient contents (calculated)
Metabolizable energy (kcal/kg)	2898.958	2910.317
Crude protein (%)	20.694	19.395
Calcium (%)	0.855	0.924
Available phosphorus (%)	0.450	0.420
Sodium (%)	0.199	0.260
Digestible amino acids (%) (calculated)
Methionine	0.470	0.436
Methionine + cystine	0.750	0.701
Lysine	1.101	1.030
Threonine	0.727	0.681
Tryptophan	0.228	0.210

¹Provided per kg of product, 2,270,000 IU vitamin A; 6,330 IU vitamin E; 561 mg vitamin B1; 1,490 mg vitamin B2; 858 mg vitamin B6; 3,500 mg vitamin B12; 450 mg vitamin K3; 2,976 mg calcium pantothenate; 8,820 mg niacin; 200 mg folic acid; 20 mg biotin; 86 mg choline; 19 mg zinc; 14 mg iron; 20 mg manganese; 3,040 mg copper; 290 mg iodine; 50 mg cobalt; 88 mg selenium; 25 mg ethoxyquin; 20 mg butylated hydroxyanisole.

At 15 d of age, chicks were weighed and divided into two groups: thermoneutral ambient (constant temperature of 23 °C) and intermittent heat stress ambient (daily exposure to 34 °C for 6 h, from 10:00 to 16:00 hours). Birds were housed two per cage according to the experimental group: offspring from hens fed Md diet and housed in thermoneutral temperature (n = 13); offspring from hens fed Met1 diet and housed in thermoneutral temperature (n = 13); offspring from hens fed Met2 diet and housed in thermoneutral temperature (n = 13); offspring from hens fed Md diet and housed under intermittent heat stress (n = 13); offspring from hens fed Met1 diet and housed under intermittent heat stress (n = 13); and offspring from hens fed Met2 diet and housed under intermittent heat stress (n = 13). Chicks had ad libitum access to water and feed. From 15 to 35 d of age, all chicks were fed a grower diet formulated according to Rostagno et al. (2017) (Table 2).

Performance assessment

During the experimental period, quail hens (n = 10 per treatment) were analyzed for feed intake (g) = amount of feed offered at the beginning of the experimental period (day 98) − the feed residue at the end of the experimental period (day 136). Egg mass (g/bird/d) = egg laying rate (%) × average egg weight (g); feed conversion/egg mass (g/g) = feed intake/egg mass; feed conversion per dozen eggs (g/dozen) = feed intake/weight of dozen eggs. Egg production (number of eggs produced in 38 d); egg laying rate = (number of eggs × 100)/total number of quail hens)). Egg weight (g) = egg weight of each cage by the number of eggs in 38 d. Hatchability of total and fertile eggs (%), and embryonic mortality (%) were calculated according to Koppenol et al. (2015). Progeny performance was analyzed for starter (1 to 14 d of age) and grower (15 to 35 d of age) phases. For performance analyses, the cage with two birds (n = 13) was considered as an experimental unit.

Sample collection

At the end of egg collection period, quail hens (n = 6 per treatment) were euthanized by cervical dislocation, and chicks (n = 6 per treatment) were euthanized by the same procedures at 35 d of age.

Hierarchy pre-ovulatory follicles (F1–F5) were extracted from the ovary of hens, weighed, and counted.

The relative weight of the ovary, liver, heart, intestine, and spleen was calculated by dividing the organ weight by the bird weight and multiplying by 100.

A 2-cm section of the left lobe of the liver of quail hens (n = 6 per treatment) and chicks (n = 6 per treatment) was collected for analysis of glutathione peroxidase 7 (GPX7), glutathione synthetase (GSS), heat-shock protein 70 kDA (HSP70), and methionine sulfoxide reductase A (MSRA) gene expression. Samples were preserved with RNAlater (Life Technologies, São Paulo, Brazil) and stored at −20 °C until total RNA extraction.

A 5-cm section of the right lobe of the liver of quail hens (n = 6 per treatment) and chicks (n = 6 per treatment) was collected in liquid nitrogen and stored at −80 °C for biochemical analyses (total antioxidant capacity, carbonylated proteins, and lipid peroxidation).

Blood samples of chicks (n = 6 per treatment) were collected into heparinized tubes for determination of the heterophil/lymphocyte ratio.

Gene expression analysis

Total RNA was extracted from 80 mg of liver tissue using 1 mL of TRIzol (Invitrogen, Carlsbad CA, USA), according to the manufacturer’s protocol. RNA integrity was assessed by electrophoresis on 1% agarose gels, followed by ethidium bromide (10 mg/mL) staining and visualization under ultraviolet light.

RNA samples were treated with DNase I (Invitrogen, Carlsbad, CA, USA) to eliminate possible DNA contamination. The GoScript Reverse Transcription kit (Promega, Madison, WI, USA) was used for complementary DNA (cDNA) synthesis from 4 µL of DNase-treated RNA, following the manufacturer’s instructions.

Real-time PCR (qPCR) was performed using 5 µL of cDNA diluted to 40 ng/µL, 0.5 µL of each primer diluted to 10 µM, 12.5 µL of SYBR Green PCR Master Mix (Applied Biosystems, Waltham, MA, USA), and 6.5 µL of ultrapure water in a final volume of 25 µL. A pool of cDNA samples was serially diluted (10, 20, 40, and 80 ng/µL) and used to assess the efficiency of the primers. Thermocycling conditions were the same for all genes: 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s for denaturation and 60 °C for 1 min for annealing/extension. Melting curves were obtained to assess the specificity of amplification.

Primers (Table 3) were designed from sequences deposited in Genbank (www.ncbi.nlm.nih.gov) (accession numbers: GPX7, NM_001163245.1; GSS, XM_425692.3; HSP70, NM_001006685.1 and MSRA, XM_004935891). The β-actin gene (accession number L08165.1) was used as endogenous control. qPCR analyses were carried out in duplicate. Amplification efficiencies were similar for all target genes, ranging from 90% to 110%. The 2^−∆CT method was used for relative quantification of gene expression (Livak and Schmittgen, 2001).

Table 3.

Primers used in qPCR

Gene1	bp2	AT3 (°C)	Orientation	Sequence (5ʹ→3ʹ)
GPX7	140	60	Forward Reverse	GGTGCCTCCTTTCCTATGTT AGTTCCAGGTTGGTTCTTCTC
GSS	108	60	Forward Reverse	GTGCCAGTTCCAGTTTTCTTATGTCCCACAGTAAAGCCAAGAG
HSP70	65	60	Forward Reverse	ATGAGCACAAGCAGAAAGAG TCCCTGGTACAGTTTTGTGA
MSRA	76	60	Forward Reverse	ATGACCCGACACAAGGAATG TGGGAAAAGGTGTAGATGGC
β-actin	136	60	Forward Reverse	ACCCCAAAGCCAACAGA CCAGAGTCCATCACAATACC

¹ GPX7, glutathione peroxidase 7 gene; GSS, glutathione synthetase gene; HSP70, heat-shock protein 70 kDA gene; MSRA, methionine sulfoxide reductase A gene.

² bp, base pairs.

³AT, annealing temperature.

Biochemical analyses

Total antioxidant capacity was measured according to the method described by Brand-Williams et al. (1995), with modifications. For this analysis, 100 mg of liver tissue was added to a test tube containing 1 mL of methyl alcohol, homogenized, and centrifuged for 10 min at 10,000 × g and 4 °C. A 22.5 µL aliquot of the supernatant was added to a microplate containing 277.5 µL of 0.06 mM 2,2-diphenyl-1-picrylhydrazyl (DPPH, Sigma-Aldrich, St. Louis, MO, USA) in duplicate. Microplates were kept in the dark for 30 min, after that the absorbance at 515 nm was read on a microplate reader (VersaMax, Molecular Devices, San Jose, CA, USA). The antioxidant capacity of each sample was calculated as follows: total antioxidant activity (%) = (1 − (absorbance of the sample/absorbance of DPPH)) × 100.

Lipid peroxidation was determined by the thiobarbituric acid reactive substances (TBARS) method. Briefly, 100 mg of liver tissue was added to a test tube containing 1 mL of 0.1 M potassium phosphate buffer (pH 7.4), homogenized, and centrifuged for 10 min at 10,000 × g and 4 °C. After centrifugation, 500 µL of the supernatant was transferred to a new microtube containing 250 µL of 28% trichloroacetic acid diluted in 0.25 N hydrochloric acid, 250 mL of 1% thiobarbituric acid diluted in 1:1 acid acetic, and 125 mL of butylhydroxytoluene diluted in ethanol. The solution was homogenized, incubated at 95 °C for 15 min, and centrifuged for 10 min at 10,000 × g and 4 °C. TBARS concentration was determined in duplicate using aliquots of 300 µL. The absorbance was read (VersaMax, Molecular Devices) at 535 nm, and results are expressed as nmol TBARS/mg protein.

Protein oxidation was estimated by quantification of carbonylated derivatives using 2,4-dinitrophenylhydrazine (DNPH, Sigma–Aldrich), as described by Levine et al. (1994). Absorbance was read (VersaMax, Molecular Devices) at 370 nm. Carbonylated protein concentrations were determined using the Beer–Lambert equation: A = C × b × ε, where A is the absorbance of the sample minus that of the blank, C is the concentration of carbonylated proteins, b is the optical path length, and ε is the molar attenuation coefficient (22,000/M/cm⁻¹). Results are expressed as nmol carbonylated protein/mg protein.

Protein contents were determined by the Bradford method (Bradford, 1976).

Heterophil/lymphocyte ratio

A 10 µL aliquot of blood (chicks) was smeared on a microscope slide using a spreader slide until reaching the edges of the slide. Slides were left to air dry, stained using a blood staining kit (Instant Prov, Newprov, Pinhais, Paraná, Brazil), and examined under an optical microscope. A total of 100 cells (heterophils and lymphocytes) were counted to determine the heterophil/lymphocyte ratio.

Statistical analysis

All statistical procedures were performed using SAS statistical software (SAS version 9.00, 2002; SAS Institute Inc., Cary, NC, USA). The effects of maternal supplementation with methionine on quail hens (98 to 136 d of age) and progeny (during starter period) performance parameters were assessed using analysis of variance one-way (ANOVA, PROC GLM). To investigate maternal effects on progeny development during the grower period, maternal diet effects were assessed using analysis of variance one-way (ANOVA, PROC GLM) within the progeny environment. Hatchling weight at birth was not included in the models, as this parameter could mask the effects of maternal diet on chick development (van der Waaij et al., 2011). Results were considered significant when the P-value was less than 5% and Tukey’s test was used for post hoc multiple comparisons of fixed effects. Results are presented as mean and pooled standard error (SEp). Pearson correlation analysis was performed to investigate associations between gene expression in quail hens and their progeny as well as between target genes.

Results

Effect of diet on quail hens performance

Quail hens fed Met1 and Met2 diets produced more eggs at a higher laying rate than quail hens fed the Md diet. Egg weight and egg mass were higher and feed conversion ratio was lower in supplemented quail (Met1 and Met2) (P < 0.05). Methionine supplementation increased the hatchability of total and fertile eggs and hatchling weight at birth. No differences in performance parameters were observed between Met1 and Met2 diets (Table 4).

Table 4.

Performance parameters of Japanese quail (Coturnix coturnix japonica) hens during the reproductive phase

Parameter	Diet1			SEp2	P-value
	Md	Met1	Met2
Initial body weight (g)	164.17	158.33	162.50	15.37	0.7977
Final body weight (g)	173.33	167.50	172.50	12.67	0.6956
Feed intake (g)	850.83	794.00	822.33	250.38	0.9260
Feed conversion ratio (g feed/g egg)	2.95	1.96	2.06	0.72	0.0595
Feed conversion ratio per dozen eggs (g feed/g dozen eggs)	2.94	2.24	2.67	0.62	0.1744
Total number of eggs produced	24.83b	29.00a	28.83a	3.01	0.0497
Egg laying rate (%)	82.77b	96.66a	96.11a	10.02	0.0497
Egg weight (g)	9.43b	11.00a	11.12a	0.61	0.0003
Egg mass (g/bird/d)	7.81b	10.65a	10.70a	1.21	0.0011
Hatchability (%)	50.93b	72.92a	77.78a	6.79	0.0308
Hatchability of fertile eggs (%)	54.93b	79.30a	77.78a	6.47	0.0305
Hatchling weight at birth (g)	6.51b	8.09a	8.15a	0.20	<0.0001

¹ Md, methionine-deficient diet; Met1, diet supplemented with the recommended level of methionine; Met2, diet oversupplemented with methionine.

² SEp, pooled standard error.

^a,bMeans within a row followed by different letters differ significantly by Tukey’s test (P < 0.05).

Diet had no effect on the number of mature follicles (Table 5). Quail hens fed the Met1 diet, however, had higher follicle weight (1.28 g; P = 0.0475) than nonsupplemented (md)hens (1.04 g), not differing from hens fed the Met2 diet (1.12 g). There was no effect of methionine supplementation on the relative weight of the ovary, liver, intestine, heart and spleen (Table 5).

Table 5.

Follicle number and relative organ weights of Japanese quail (Coturnix coturnix japonica) hens during the reproductive phase

Parameter	Diet1			SEp2	P-value
	Md	Met1	Met2
Number of hierarchy pre-ovulatory follicles (F1-F5)	4.33	4.50	4.83	0.49	0.2363
Weight of hierarchy pre-ovulatory follicles (F1-F5) (g)	1.04b	1.28a	1.12ab	0.16	0.0475
Relative weight of ovary (%)	3.26	4.02	3.76	0.53	0.0702
Relative weight of liver (%)	2.88	2.64	2.73	0.44	0.6427
Relative weight of intestine (%)	5.19	4.64	4.42	0.73	0.2034
Relative weight of heart (%)	0.82	0.93	0.94	0.15	0.5984
Relative weight of spleen (%)	0.04	0.04	0.04	0.01	0.7485

¹ Md, methionine-deficient diet; Met1, diet supplemented with the recommended level of methionine; Met2, diet oversupplemented with methionine.

² SEp, pooled standard error.

^a,bMeans within a row followed by different letters differ significantly by Tukey’s test (P < 0.05).

GSS and MSRA expressions were highest in hens fed the Met2 diet (Figure 2). There were no treatment effects on GPX7 and HSP70 gene expression (P > 0.05).

Figure 2.

Effect of methionine supplementation of quail (Coturnix coturnix japonica) hens on mRNA levels of glutathione peroxidase 7 (GPX7) (A), glutathione synthetase (GSS) (B), heat-shock protein 70 kDA (HSP70) (C), and methionine sulfoxide reductase A (MSRA) (D) genes in the liver. Md, methionine-deficient diet; Met1, diet supplemented with the recommended level of methionine; Met2, diet oversupplemented with methionine. Results are expressed as arbitrary units (AU) (n = 6 chicks per group). Error bars represent the standard error. ^a,bMeans of bars with different letters differ significantly by Tukey’s test (P < 0.05).

Methionine-supplemented quail hens (Met1 and Met2) had a lower TBARS content and greater total antioxidant capacity (P < 0.05) than nonsupplemented (md) quail hens (Figure 3). There was no effect of treatments on the content of carbonylated proteins in the liver of quail hens.

Figure 3.

Effect of methionine supplementation of quail (Coturnix coturnix japonica) hens on lipid peroxidation (TBARS) (A), carbonylated protein content (B), and total antioxidant capacity (C) in the liver. Md, methionine-deficient diet; Met1, diet supplemented with the recommended level of methionine; Met2, diet oversupplemented with methionine. Error bars represent the standard error (n = 6 chicks per group). ^a,bMeans of bars with different letters differ significantly by Tukey’s test (P < 0.05).

Effects of maternal methionine supplementation on development, gene expression, and stress indicators of the progeny

The effect of methionine supplementation from quail hens on progeny development was assessed in two periods: starter (1 to 14 d of age) and grower (15 to 35 d of age) phases, and the effects of methionine supplementation from quail hens on the expression of genes involved in the anti-oxidant defense and stress indicators were evaluated in chicks at 35 d of age.

In the starter phase, the mortality rate was lower among progeny of quail hens fed Met1 (23.33%) and Met2 (26.19%) diets (P < 0.05; Figure 4). Chicks from quail hens fed the Met2 diet had higher weight gain, higher weight at 15 d, and lower feed conversion ratio than progeny of hens fed the Md diet (Figure 4). On 15 d of age, chicks were divided and subjected to one of two environmental conditions (thermoneutral and heat stress), and the effect of methionine supplementation from quail hens was assessed in each experimental group (Figure 5). There was no significant effect of maternal diet on weight of the progeny at 15 d of age reared in a thermoneutral and/or heat stress environment (P > 0.05). For the chicks reared in a thermoneutral environment, the offspring of quail hens that received the Met2 diet had greater weight at 35 d of age and greater weight gain in the period from 15 to 35 d (P < 0.05). There was no difference between the offspring of quail hens fed the Md and Met1 diets. For chicks reared under heat stress, the offspring of quail hens fed Met1 and Met2 diets had higher weight gain and weight at 35 d than the offspring of quail hens fed the Md diet (P < 0.05).

Figure 4.

Effects of maternal methionine supplementation on chick mortality during the starter phase (1 to 14 d of age) (A), chick weight at 15 d of age (B), weight gain (C), and feed conversion ratio (D). Md, methionine-deficient diet; Met1, diet supplemented with the recommended level of methionine; Met2, diet oversupplemented with methionine. Results are presented as mean and standard error. Each cage with two chicks was considered an experimental unit, n = 13. ^a,bMeans of bars with different letters differ significantly by Tukey’s test (P < 0.05).

Figure 5.

Effect of maternal diet on the performance of chicks raised under thermoneutral and heat stress conditions. Chick weight at 15 d of age (A), chick weight at 35 d of age (B), and weight gain from 15 to 35 d of age (C). Md, methionine-deficient diet; Met1, diet supplemented with the recommended level of methionine; Met2, diet oversupplemented with methionine. Results are presented as mean and standard error. Each cage with two chicks was considered an experimental unit, n = 13. ^a,bWithin each thermal condition, means of bars with different letters differ significantly by Tukey’s test (P < 0.05).

With regard to gene expression, we observed that among chicks raised under thermoneutral conditions, those from quail hens fed the Met1 diet showed the highest HSP70 expression. Under heat stress conditions, chicks from quail hens fed the Md diet showed the lowest expression of GSS, HSP70, and MSRA. There were no treatment effects on GPX7 gene expression (P > 0.05) (Figure 6).

Figure 6.

Effects of maternal methionine supplementation on mRNA levels of glutathione peroxidase 7 (GPX7) (A), glutathione synthetase (GSS) (B), heat-shock protein 70 kDA (HSP70) (C), and methionine sulfoxide reductase A (MSRA) (D) genes in the liver of 35-d old chicks raised under thermoneutral and heat stress conditions. Md, methionine-deficient diet; Met1, diet supplemented with the recommended level of methionine; Met2, diet oversupplemented with methionine. Results are expressed as arbitrary units (AU) and are presented as mean and standard error (n = 6 chicks per group). ^a,bWithin each thermal condition, means followed by different letters differ significantly by Tukey’s test (P < 0.05).

Genetic inheritance can be observed through the correlation between maternal and offspring gene expression. A high positive correlation in GPX7 and MSRA expression was observed between quail hens and offspring (P < 0.05). There was a positive correlation (P < 0.05) between the expression of GPX7, GSS, HSP70, and MSRA in progeny, suggesting that genes act together in the response of quail chicks to environmental conditions. Positive correlations were also found between HSP70 maternal expression and GPX7 offspring expression (0.45; P = 0.0244), GSS maternal expression and MSRA offspring expression (0.46; P = 0.0218), and HSP70 maternal expression and MSRA offspring expression (0.51; P = 0.0108) (Table 6).

Table 6.

Pearson correlation matrix for the expression of glutathione peroxidase 7 (GPX7), glutathione synthetase (GSS), heat-shock protein 70 kDA (HSP70), and methionine sulfoxide reductase A (MSRA) genes between Japanese quail (Coturnix coturnix japonica) hens (H) and their progeny (P) (n = 6 quail hens/treatment and n = 6 quail chick/treatment)

	GPX7 (H)	GPX7 (P)	GSS (H)	GSS (P)	HSP70 (H)	HSP70 (P)	MSRA (H)	MSRA (P)
GPX7 (H)	1	0.50*	0.29	0.20	0.58*	−0.08	0.65*	0.32
p-value		0.0128	0.1564	0.3269	0.0026	0.3269	0.0005	0.1157
GPX7 (P)		1	0.07	0.51*	0.45*	0.46*	0.30	0.42*
p-value			0.7316	0.0098	0.0244	0.0231	0.1455	0.0361
GSS (H)			1	0.33	0.61*	−0.20	0.78*	0.46*
p-value				0.1152	0.0013	0.3466	<0.0001	0.0218
GSS (P)				1	0.25	0.38	0.34	0.52*
HSP70 (H)					1	0.002	0.80*	0.51*
p-value						0.9894	<0.0001	0.0108
HSP70 (P)						1	−0.05	0.34
p-value							0.7955	0.1006
MSRA (H)							1	0.48*
p-value								0.0162
MSRA (P)								1

An asterisk (*) indicates a significant correlation (P < 0.05).

Among chicks raised under heat stress, those whose mothers were fed the Met2 diet had the highest total anti-oxidant capacity, whereas those whose mothers were fed the Met1 diet had the lowest heterophil/lymphocyte ratio (Figure 7). Under thermoneutral conditions, chicks from quail hens fed the Met1 diet had the highest anti-oxidant capacity and those from quail hens fed the Met2 diet had the lowest concentration of carbonylated proteins. Chicks from methionine-supplemented quail hens had a lower heterophil/lymphocyte ratio than chicks from nonsupplemented (Md) quail hens.

Figure 7.

Effects of maternal methionine supplementation on lipid peroxidation (A), carbonylated proteins (B), total antioxidant capacity (C), and heterophil/lymphocyte (H/L) ratio (D) in 35 d old Japanese quail (Coturnix coturnix japonica) chicks raised under thermoneutral and heat stress conditions. Md, methionine-deficient diet; Met1, diet supplemented with the recommended level of methionine; Met2, diet oversupplemented with methionine. Results are presented as mean and standard error (n = 6 chicks per group). ^a,bWithin each thermal condition, means followed by different letters differ significantly by Tukey’s test (P < 0.05).

The maternal diet did not affect lipid peroxidation (TBARS) in the liver of chicks raised under thermoneutral and heat stress conditions (P > 0.05).

Discussion

In this study, we observed that methionine-supplemented quail hens had improved egg-laying performance. Previous study has shown that methionine supplementation enhances laying rate, egg weight, feed conversion, and egg quality (Xiao et al., 2017). These results are probably associated with the higher protein and energy efficiencies (Saki et al., 2011) and nutrient absorption capacity (Elwan et al., 2019) promoted by methionine supplementation. Such effects may also stem from the action of methionine on the somatotropic axis; methionine supplementation is known to stimulate protein deposition through the production of growth hormone and insulin-like growth factor I (Del Vesco et al., 2013, 2015). Somatotropic hormones are involved in reproductive system development during the prelaying phase (Pisaraei et al., 2008) and in egg performance and quality during the laying phase (Mohammadi et al., 2015). Growth hormone promotes oocyte maturation and pre-antral follicle growth and maturation (Silva et al., 2009). Our results show that supplementation of the quail hens diet with methionine improves follicle weight and laying rate, and this is related to the fact that dietary methionine is involved in the synthesis of insulin-like growth factor which acts on the production and regulation of steroid hormones, cell proliferation and differentiation, apoptosis inhibition, follicle selection, and prevention of follicular atresia. This protein also enhances the effect of luteinizing hormone and follicle-stimulating hormone on progesterone secretion, stimulating the development and growth of follicles (Onagbesan et al., 2009; Ruan et al., 2017). In laying hens, reproductive performance largely depends on the supply of adequate amounts of nutrients by the feed and intrinsic ovarian development (Ma et al., 2020). According to Ma et al. (2020), less than 5% of prehierarchical follicles can develop into mature pre-ovulatory follicles, suggesting that the laying performance of the bird is likely to be improved through nutritional manipulations capable of optimizing ovarian development. Thus, our results suggest that methionine may have beneficial effects on reproductive parameters of quail hens.

Methionine supplementation increased total anti-oxidant capacity and decreased TBARS content in the liver of quail hens. These results are likely associated with the upregulation of GSS and MSRA observed in supplemented quail hens. Previous studies showed that methionine supplementation enhances anti-oxidant capacity indirectly via the glutathione system (Shen et al., 2015) and directly through the thioredoxin and MSRA pathway (Stadtman et al., 2005). Ruan et al. (2017) observed that methionine supplementation increased glutathione levels (GSH), glutathione peroxidase activity, total antioxidant capacity, as well as the expression of the nuclear factor erythroid 2 like 2 and haem oxygenase 1 genes involved in anti-oxidant defense, and reduced the content of malondialdehyde (MDA) in the liver of laying duck breeders.

Ruan et al. (2017) demonstrated that the maternal methionine supplementation improved fertility rate, hatchability, natality rate, and increased total anti-oxidant capacity and reduced malonaldehyde levels in the brain of hatchlings. In the present study, we found that maternal methionine supplementation increased the hatchability of total and fertile eggs and hatchling weight on hatch. Methionine can be transferred to fertile eggs (Bunchasak and Silapasorn, 2005), increasing anti-oxidant capacity and growth-related hormone secretion. The results are increased egg weight, quality and benefit to the proper development of the embryo. Methionine supplementation also reduced mortality rate in the early breeding phase. Embryo development and chick quality depend on the nutrients deposited in the egg (Uni et al., 2012). This maternal effect may be genetic (Lofti et al., 2012) or environmental, as maternal nutrition is a determining factor in progeny health and development (Surai, 2012). Therefore, maternal ­supplementation with anti-oxidants can enhance the anti-oxidant defense system of the embryo (via enzymatic and nonenzymatic actions), reducing tissue susceptibility to reactive oxygen species and increasing viability during the first days of life (Yigit et al., 2014; Obianwuna et al., 2022).

The beneficial effects of maternal methionine supplementation extended throughout the starter phase. Despite the known effects of maternal diet on progeny performance in the posthatching phase (Aigueperse et al., 2013; Kalvandi et al., 2019), few studies have investigated the relationship between embryo developmental conditions and chick responses to the environment during growth (McCoski et al., 2021; Andrieux et al., 2022). For example, Boulton et al. (2021), when evaluating the effect of maternal diet on the growth and behavior of the offspring that were stressed with corticosterone in ovo (simulation of maternal stress), observed that the maternal diet had a positive effect on the growth and development of the first-generation offspring when subjected to stressors. To broaden the knowledge on the subject, we assessed the effect of maternal environment (diet) on the response of offspring to different environmental conditions (heat stress and thermoneutral). Chicks raised in thermoneutral condition presented better weight gain when the quail hens were fed with Met2 diet, suggesting that under a comfortable condition, it was necessary a higher level of methionine in quail hens diet to change the offspring performance. However, for chicks grown under heat stress conditions, maternal methionine supplementation in both the levels (Met1 and Met2) improved performance what shows the important role of methionine supplementation under heat stress condition. It was also observed that under heat stress conditions, maternal methionine supplementation enhanced total anti-oxidant capacity (Met2), and reduced the heterophil/lymphocyte ratio (Met1). These results may be attributed to the greater expression of GSS (Met2), MSRA (Met2), and HSP70 (Met1). Maternal methionine supplementation promoted activation of different metabolic pathways (for example: immune and anti-oxidant) in the progeny, helping to mitigate the adverse effects of heat stress. Suggesting that supplementation of quail hens with methionine may modulate the responsiveness of the progeny in their own environment.

Methionine reduces oxidative stress in heat-stressed birds via expression of methionine sulfoxide, participation in glutathione synthesis (Wang et al., 2019) and expression of HSP70 (Guo et al., 2018). It should be noted that, in our study, there was a positive correlation between the expression of GPX7, GSS, HSP70, and MSRA in offspring indicating that these genes act in combination.

These findings indicate that conditions occurring during embryo development can produce phenotypic differences between individuals in later life stages. In fact, according to Dixon et al. (2016), the experiences obtained during early stages of development are important determinants of progeny phenotype and future responses to the postnatal environment. Epigenetic changes occurring during embryo development have been the focus of recent research (Feeney et al., 2014; Verwoolde et al., 2022; Widowski et al., 2022). Environmental factors, such as maternal diet, can ­produce epigenetic marks that alter the responses of progeny to their environment (Tiffon, 2018). For example, Lan et al. (2013) evaluated the influence of maternal diet on epigenetic modifications and gene expression in sheep. The authors showed strong evidence of the association between maternal nutrition during mothers pregnancy and transcriptomic and epigenomic alterations of nine imprinted genes and three DNA methyltransferases in fetal tissues. In chickens, Hu et al. (2020) demonstrated that maternal supplementation with betaine reduced cholesterol deposition in the progeny liver through epigenetic regulation of genes involved in cholesterol metabolism.

The hypothesis of the present study that methionine supplementation of Japanese quail (Coturnix coturnix japonica) hens can reduce the effects of oxidative stress and improve the performance of progeny subjected to thermal stress during growth was supported by the better performance and anti-oxidant response capacity of offspring submitted to heat stress, and positive correlation between maternal and offspring gene expression patterns.

Our results show that maternal methionine supplementation contributes to offspring development and performance in early life stages and that, under conditions of heat stress during growth, chicks from methionine-supplemented quail hens respond better to the environment than chicks from nonsupplemented quail hens.

Glossary

Abbreviations

ANOVA

analysis of variance

AU

arbitrary unit

cDNA

complementary DNA

DPPH

2,2-diphenyl-1-picrylhydrazyl

GSG

glutathione

GPX7

glutathione peroxidase 7 gene

GSS

glutathione synthase gene

HSP70

thermal shock protein 70 gene

Md

methionine-deficient diet

Met1

diet supplemented with the recommended methionine level

Met2

diet supplemented with methionine above the recommended level

MSRA

methionine sulfoxide reductase A gene

MSRA

methionine sulfoxide reductase A enzyme

qPCR

real-time PCR

SEp

pooled standard error

TBARS

thiobarbituric acid reactive substances

Funding

This work was supported by the National Council of Technological and Scientific Development (CNPq), Brazil (grant number 407669/2016-7), the Brazilian Federal Agency for Support and Evaluation of Graduate Education (CAPES, Financial code 001), and the Program for Mobility of Scientific Personnel (PROMOB).

Conflict of Interest Statement

The authors declare no real or perceived conflicts of interest.