Skip to main content
Journal of Advanced Research logoLink to Journal of Advanced Research
. 2022 May 2;46:87–100. doi: 10.1016/j.jare.2022.04.016

Persistent activation of Nrf2 in a p62-dependent non-canonical manner aggravates lead-induced kidney injury by promoting apoptosis and inhibiting autophagy

Cai-Yu Lian a,b,c,1, Bing-Xin Chu a,b,c,d,1, Wei-Hao Xia a,b,c, Zhen-Yong Wang a,b,c, Rui-Feng Fan a,b,c,⁎, Lin Wang a,b,c,⁎
PMCID: PMC10105071  PMID: 37003700

Graphical abstract

Graphical diagram illustrating the function and mechanism of Nrf2 in Pb-induced kidney injury.

graphic file with name ga1.jpg

Keywords: Lead, Nrf2, Kidney injury, Autophagy, Apoptosis

Highlights

  • •

    Lead (Pb)-induced persistent Nrf2 activation contributes to kidney injury.

  • •

    Persistent Nrf2 activation promotes apoptosis and autophagic blockage.

  • •

    Nrf2 is persistently activated in a p62-dependent non-canonical manner.

Abstract

Introduction

Lead (Pb) is an environmental toxicant that poses severe health risks to humans and animals, especially renal disorders. Pb-induced nephrotoxicity has been attributed to oxidative stress, in which apoptosis and autophagy are core events.

Objectives

Nuclear factor erythroid 2-related factor 2 (Nrf2) acts as a major contributor to counteract oxidative damage, while hyperactivation or depletion of Nrf2 pathway can cause the redox imbalance to induce tissue injury. This study was performed to clarify the function and mechanism of Nrf2 in Pb-triggered kidney injury.

Methods and results

First, data showed that Pb exposure activates Nrf2 pathway in primary rat proximal tubular cells. Next, Pb-induced Nrf2 activation was effectively regulated by pharmacological modulation or siRNA-mediated knockdown in vitro and in vivo assays. Notably, Pb-triggered cytotoxicity, renal injury and concomitant apoptosis were improved by Nrf2 downregulation, confirming that Pb-induced persistent Nrf2 activation contributes to nephrotoxicity. Additionally, Pb-triggered autophagy blockage was relieved by Nrf2 downregulation. Mechanistically, we found that Pb-induced persistent Nrf2 activation is attributed to reduced Nrf2 ubiquitination and nuclear-cytoplasmic loss of Keap1 in a p62-dependent manner.

Conclusions

In conclusion, these findings highlight the dark side of persistent Nrf2 activation and potential crosstalk among Pb-induced persistent Nrf2 activation, apoptosis and autophagy blockage in Pb-triggered nephrotoxicity.

Introduction

Lead (Pb) is one of the most pervasive heavy metal pollutants, exposure to which poses a potent risk to human health and environment [1], [2], [3]. Release of Pb into the eco-environment, workplace, and food supply has increased in recent years, primarily due to widespread use in commercial products and anthropogenic activities [4]. It is known that Pb cannot be degraded and can accumulate into many tissues once absorption, leading to multi-organ toxicity such as neurotoxicity, hepatotoxicity, nephrotoxicity, etc [2], [4], [5], [6], [7]. Kidney is the major target of Pb toxicity for being main route of excretion, while renal tubular epithelium is an important site of renal disorders [8], [9], [10], [11]. Moreover, primary cultured cells are desired models for cell toxicity study because they are more representative of living tissue than immortalized cell line. Thus, primary rat proximal tubular (rPT) cells and rat animal model were applied to clarify the mechanism of Pb-triggered nephrotoxicity in this study.

Oxidative stress, an imbalance in the complex pro-/anti-oxidant, is widely considered as one prime responder of the pathogenesis of kidney injury [12], [13]. Pb exposure-induced oxidative stress has been found to be associated with increased reactive oxygen species (ROS) [14], [15], [16], [17]. Notably, ROS overproduction-triggered oxidative stress is implicated in cell death including apoptosis and autophagy [7], [9], [18]. However, in the organism, cells have been equipped with various endogenous antioxidant defense systems that protect the cells from adverse insults, of which Nrf2 is a prime modulator of endogenous antioxidant defense to counteract oxidative damage [19], [20], [21]. Nrf2 is normally anchored in the cytoplasm by Kelch-like Ech-associated Protein-1 (Keap1) and degraded by the ubiquitin–proteasome pathway [22], [23]. Once cells suffer from oxidative damage, Keap1 undergoes conformational modification and releases Nrf2 to nucleus to activate its downstream target genes, which plays a critical role in preventing redox imbalance [24], [25], [26]. Recently a novel pathway of Nrf2 activation has been reported, known as the non-canonical pathway, including sequestospor-1 (SQSTM1/P62), which reduces Nrf2 ubiquitination and leads to Nrf2 activation by binding to Keap1 [27], [28], [29]. Currently, several studies have revealed that some antioxidants can protect Pb-induced kidney oxidative damage via regulating Nrf2 signaling pathway [30], [31], but there is a lack of systematic investigation on the function of Nrf2 in Pb-mediated nephrotoxicity.

Nrf2 pathway acts as a defense against harmful chemicals-induced oxidative damage via induction of cytoprotective genes. However, our latest findings have shown that cadmium (Cd), another oxidative stress inducer, activates Nrf2 signaling pathway in rPT cells while antioxidant puerarin prevents Cd-induced cytotoxicity via inhibiting Nrf2 signaling pathway [32], which prompted us to hypothesize that activated Nrf2 pathway may play a deleterious role in heavy metal-induced kidney injury. Indeed, the “dark” side of Nrf2 has also been revealed in various pathological models, that persistent Nrf2 activation potentially contributes to, rather than protects against oxidative damage [33], [34]. Importantly, emerging evidence has shown that pathological changes of Nrf2 activation are related to autophagy and apoptosis, which have been shown to be implicated in the pathogenesis and development of kidney damage [35], [36], [37]. Hereby, in the present study, Pb-induced persistent Nrf2 activation was regulated by Nrf2 activator Oltipraz, Nrf2 inhibitor Brusatol or siRNA-mediated knockdown in vitro and in vivo to evaluate the mechanism of Nrf2 in Pb-mediated nephrotoxicity. This study will provide novel insights into the potential crosstalk between the functional consequence of Nrf2 signaling and apoptosis as well as autophagy in Pb-triggered kidney damage.

Materials and methods

Reagents and antibodies

Lead (II) nitrate (228621) and Brusatol (Bru, SML1868) were a product of Sigma-Aldrich (St. Louis, MO, USA). Oltipraz (Olt, S7864) was from Selleck (Houston, TX, USA). Transfection reagent, siRNA specific for Nrf2 (siNrf2; Sequence 5′ to 3′ UACUCACUGGGAGAGUAAGGUUUCC), and DAB Advanced Chromogenic Kit were provided by Invitrogen (Carlsbad, CA, USA). Nuclear Protein Extraction Kit, Cell Counting Kit-8 and apoptosis detection kit were products of Beyotime Institute of Biotechnology (Haimen, Jiangsu, China). Immunoprecipitation kit was a product of Absin® (Shanghai, China). Primary antibodies for western blot analysis were from Abcam (Cambridge Science Park, Cambridge, UK): anti-SQSTM1/p62 (phospho S349, ab211324), anti-Keap1 (ab66620), anti-Nrf2 (ab31163), anti-HO-1 (ab68477), anti-NQO1 (ab80588), anti-CAT (ab76110), anti-GPx (ab108427), anti-SOD1 (ab51254), anti-SOD2 (ab68155), anti-GCLM (ab124827) and anti-GCLC (ab190685). anti-p62/SQSTM1 (P0067), anti-LC3B (L7543) and β-actin (A5441) were provided by Sigma (St. Louis, MO, USA). Anti-Histone H3 (4499), anti-cleaved caspase-3 (9661), anti-cleaved PARP (9545) and anti-GAPDH (5174) were provided by Cell Signaling Technology (Danvers, MA, USA). Anti-Ubiquitin (10201-2-AP) was from proteintech (Chicago, United States). Secondary antibodies for Western blotting were provided by Abcam (Cambridge, UK). Alexa Fluor®488-conjugated goat anti-mouse (A32723), Alexa Fluor ® 555-conjugated donkey anti-rabbit (A-31572) were products of Invitrogen (Carlsbad, CA, USA).

Cell culture

Briefly, the rPT cells were conducted from the kidneys of Sprague-Dawley (SD) rats with body weighing 180–200 g. The rats underwent cervical dislocation after complete anesthesia by intraperitoneal injection of pentobarbital sodium (2%, 0.31 ml/100 g). The rats were soaked in 75% alcohol for 2 min and take kidneys out from super-clean workbench. Isolation, purification and identification of SD rPT cells were carried out by an established method [9]. Bru, Olt and Pb (NO3)2 -were dissolved in DMSO, DMSO and sterile ultrapure water, respectively, which deliquated in culture medium to obtain a suitable working solution. Based on our preliminary trials, rPT cells were incubated with 0.5 µM Pb for 12 h, and Bru (0.2 µM) was incubated for the last 2 h of Pb exposure while Olt (12 µM) was incubated for the last 3 h of Pb exposure.

In vivo experimental design

Eighteen 6-week-old male SD rats weighing 100–110 g were provided by Jinan Pengyue Experimental Animal Breeding Co., ltd. (Jinan, China). After adaptation, the rats were randomly divided into 6 groups with 3 rats in each group. Rats were housed at 24 ± 0.5 °C with 12 h alternating light and dark cycles and were fed freely. Rats were injected intraperitoneally (i.p.) with Pb (NO3)2 (15 mg/kg. body weight) dissolved in aseptic ultrapure water once a day for 12 consecutive days to generate a model of Pb-induced kidney injury. Rats in the Bru + Pb or Olt + Pb groups were administered with Bru (0.4 mg/kg. body weight, i.p. administration) or Olt (80 mg/kg. body weight, i.p. administration) daily from Day 8 to Day 12 (last 5 days), while administered with Pb (NO3)2 for 12 days as stated above. Rats in Bru or Olt alone groups were injected intraperitoneally daily with an equal volume of aseptic ultrapure water for 7 days and Bru or Olt for last 5 days as mentioned above. Control rats received only the same volume of aseptic ultrapure water. At Day 13, rats were euthanized by injection of pentobarbital sodium and kidneys were collected for subsequent assays.

Ethics statement

All experimental protocols were approved by the Ethic Animal Care Committee of Shandong Agricultural University (No. SDAUA-2018-010).

Immunoblotting and immunoprecipitation

For immunoblotting analysis, cell lysates and rat kidney lysates were prepared as previously reported after the indicated treatments [38]. Then, specimens were submitted to SDS-PAGE gels followed by immobilizing onto PVDF membrane. The blots were blocked, incubated with primary antibodies and then with secondary antibodies. Specific proteins were detected by chemiluminescence and evaluated by computer-assisted densitometric analysis. For immunoprecipitation, freshly prepared cell supernatants containing 500 µg of total protein were immunoprecipitated with the specific antibody overnight at 4 °C, and exposed to protein A/G agarose beads for 4 h at 4 °C. Then beads were centrifuged at 5000g for 10 min, and then washed with PBS solution. Finally, the protein was eluted from the beads and subjected to immunoblotting.

Plasmid transient transfection

RFP-GFP-LC3 and GFP-LC3 plasmids were provided by Dr. Xiao-Ming Yin (Department of Pathology and Laboratory Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA). rPT cells treated/untreated with 12 h Nrf2-siRNA transfection -were transfected with GFP-LC3 plasmid or RFP-GFP-LC3 plasmid for another 24 h using Lipofectamine 3000. Following transfected for 24 h, cells were exposed to 0.5 µM Pb and/or Bru or Olt for 12 h. Then, 4% paraformaldehyde (PFA) was added at room temperature (RT) for 7 min. After incubation, cells were observed under a confocal microscope (TCS SPE, Leica, Germany), then representative areas were captured. The Analyze particles of Image J is used to quantify the specific points of each cell under the same threshold conditions.

Small interfering RNA (siRNA)-targeted gene silencing

Briefly, rPT cells were cultured on 6-well plate and sterile cover glass was placed on 24-well plate and grown to 70% confluence when transfected. After 2 h of pretreatment in Opti-MEM TM medium at 37 °C, cells were transfected with Nrf2-siRNA or scrambled control (Scr) siRNA as per the manufacturer’s protocol. After 6 h treatment, the medium containing the transfection complex was replaced with a complete medium. Nrf2-knockdown (Nrf2-KD) cells were established for the indicated experiments after 30 h.

Immunofluorescence (IF) staining

To assess the subcellular localization of Nrf2 or Keap1, rPT cells added on slides were incubated in the presence of 0.5 µM Pb for 12 h, and then incubated with 4% PFA for 8 min. 0.1% Triton X-100 was used to permeate cells for 15 min, followed by 2% bovine serum albumin (BSA) at RT for 1 h. Next, slides were incubated with Nrf2 antibody or Keap1 antibody at 4 °C overnight and incubated with secondary antibody for 1 h at RT. Finally, nuclei were labeled with DAPI. To analyze the colocalization status of Keap1 with p62 or p-p62 in Pb-treated rPT cells, 12-h Pb-exposed cells were fixed, permeabilized and blocked as mentioned above. Then coverslips were incubated with Keap1 antibody at 4 °C overnight, and then stained with secondary antibody at RT for 1 h. Next, coverslips were incubated with p62 antibody or p-p62 antibody dilution at 4 °C overnight, and incubated with secondary antibody for 1 h at RT. Finally, nuclei were stained with DAPI. Representative areas were performed under a confocal microscope with a × 63 oil-immersion objective.

Pathological analysis

Parafin-embedded Kidney specimens were cut into 5 μm thick section. Hematoxylin and eosin staining was used for routine morphological assessment. Kidney tissue slides were observed under an optical microscope (Nikon Eclipse E600W, Suzhou, China) by the blinded pathologist. The renal lesions were graded on a scale of 0–4 according to histologic severity of kidney damage using previous scoring system [39], [40]. The damage area was evaluated by two pathologists through observing five horizons in each section. And the assessment of histologically was verified by another two pathologists.

Kidney function

Serum creatinine and serum urea were evaluated as markers of kidney damage by standard methods on an i-STAT 300F autoanalyzer (Fuso Pharmaceutical Industries, Osaka, Japan).

Cytotoxicity assay

Cells were cultured on 96-well plate for cell survival assay. When cells grow to about 70% confluence, cells were treated with 0.5 µM Pb for 12 h and/or 0.2 µM Bru addition in the last two hours (the action of Bru is 2 h), with or without 12 µM Olt addition in the last three hours (the action of Olt is 3 h). Also, cells were subjected to Nrf2 knockdown and subsequent Pb exposure. Next, cell viability was analyzed by CCK-8 assay as per the manufacturer's protocol.

Apoptosis assay

Briefly, following deparaffinization and rehydration, antigen was extracted from 5 μm thick sections by boiling in a microwave oven with 0.01 mol/L sodium citrate buffer (pH = 6). Sections were blocked with BSA for 30 min, and then reacted with TUNEL reaction mixture for 1 h at 37 °C in a wet chamber. Biotinylated nucleotides were labeled with streptavidin-horseradish peroxidase (HRP) conjugate. Diaminobenzidine (DAB) incubated with the labeled tissue. Finally, slides were viewed under the light microscope. Ten randomly chosen high magnification fields from distinct slides were chosen for counting TUNEL positive cells, and the average was calculated.

Morphological changes and flow cytometry were performed to evaluate the apoptosis of rPT cells. After designated treatments, cells were stained with DAPI to evaluate apoptosis morphological changes. Two hundred cells were stochastically chosen to quantify apoptotic cells in each batch, each one performed in triplicate. Meanwhile, cells were labeled with annexin V/PI to evaluate the distribution of apoptotic cells by flow cytometer. These methods were described detailedly in the previous study [41].

Statistical analysis

Data are expressed as the mean ± SD of the repeated experiments. Statistical comparisons were conducted using Student t’s analysis or one-way analysis of variance (ANOVA) (Scheffe’s post-hoc test) after determining the homogeneity of variance between groups, and p < 0.05 was regarded as significant.

Results

Persistent activation of Nrf2 pathway in Pb-treated rPT cells

To explore the impact of Pb treatment on Nrf2 activation status, 0.5 µM Pb was added to the rPT cells and incubated at different intervals to perform subsequent subcellular fractionation analysis. As shown in Fig. 1A and 1C, the level of Nrf2 protein in whole-cell lysates and cytoplasmic extractions reached the peak at 6 h after Pb exposure and decreased sharply at 12 h. Also, Pb caused a marked increase of Nrf2 nuclear protein expression in a time-dependent manner, indicating that Pb treatment caused persistent Nrf2 nuclear retention (Fig. 1B). In addition, Pb-induced Nrf2 nuclear accumulation was further confirmed by immunofluorescence staining in rPT cells incubated with 0.5 µM Pb for 12 h (Fig. 1D). Finally, expression levels of a battery of Nrf2 target genes were performed to determine the Nrf2 activation status after Pb exposure. Data suggested that Pb markedly enhanced the levels of HO-1, NQO1, SOD-1, SOD-2, CAT, GPx, GCLM and GCLC (Fig. 1E and 1F; Figs. S1A-F), suggesting that Pb induced Nrf2 activation. Thus, these data clearly demonstrate that Nrf2 pathway is persistently activated in Pb-exposed rPT cells.

Fig. 1.

Fig. 1

Pb activates Nrf2 pathway in rPT cells. rPT cells were treated with 0.5 µM Pb at different time intervals. Whole-cell lysates, nuclear and cytosolic fractions were immunoblotted against Nrf2 and quantified (A, B, C). (D) Nrf2 localization was detected by IF staining in rPT cell incubated with 0.5 µM Pb for 12 h. (E, F) rPT cells were incubated in the presence of 0.5 µM Pb for 12 h to analyze the protein expression of HO-1 and NQO1. Representative western blotting images and corresponding quantitative analysis were shown (mean ± SD, n = 3). * p < 0.05, ** p < 0.01.

Persistent Nrf2 activation contributes to Pb-triggered nephrotoxicity

Recent evidence has highlighted that hyperactivation of Nrf2 negatively affects renal homeostasis [42]. The present experiments were designed to assess whether persistent Nrf2 activation is implicated in Pb-triggered nephrotoxicity. First, up-regulated and down- regulated models of Pb-induced Nrf2 activation in vitro and in vivo were established using pharmacological modulation with Bru or Olt. Pb-triggered Nrf2 nuclear accumulation in vitro or in vivo was markedly alleviated by Bru treatment (Figs. S2A and S2C). Also, protein levels of two Nrf2-downstream target genes, i.e., HO-1 and NQO1, were also down-regulated by Bru treatment. However, protein expression of nuclear Nrf2, HO-1 and NQO1 in Pb + Bru group are still greater than those in corresponding control group. Meanwhile, Pb-enhanced nuclear Nrf2, HO-1 and NQO1 protein levels were markedly enhanced by Olt addition in vitro and in vivo (Figs. S2B and S2D). Moreover, Pb-activated Nrf2 pathway was successfully inhibited by Nrf2 siRNA-mediated knockdown, as evidenced by IF staining of Nrf2 nuclear localization and immunoblot analysis of nuclear Nrf2, HO-1 and NQO1 protein levels (Figs. S3A and S3B). Likewise, Pb-activated Nrf2 pathway was weakened by Nrf2 siRNA- mediated knockdown, which is still greater than that in the control cells. To sum up, the data support a successful establishment of Pb-induced Nrf2 activation inhibition and overactivation models in vitro and in vivo.

Next, histopathological examination and cytotoxicity assay were analyzed to evaluate the effect of Pb-triggered Nrf2 activation on renal damage. Renal histopathology showed that Pb caused severe tubular injury, mainly resulting in granular or vacuolar degeneration of renal tubules cells (red arrow) and renal tubular dilataltion (blue arrow), compared to the control (Fig. 2A). Histological scores showed that inhibition of Nrf2 activation by Bru alleviated Pb-induced renal injury, while activation of Nrf2 by Olt aggravated Pb-induced renal tubular injury. Bru or Olt treatment alone has no impact on morphology of renal tubular. Meanwhile, data from cell viability assays showed that Pb-decreased cell survival was markedly reversed by Bru addition (Fig. 2D) or Nrf2 siRNA-mediated knockdown (Fig. 5D), but further heightened by Olt administration (Fig. 2E). Notably, Olt and Bru alone has no effect on cell viability, but Nrf2 siRNA-mediated knockdown resulted in a decrease in cell viability, compared with the control, suggesting the cytoprotective role of basal Nrf2 activity. In addition, the serum markers of kidney damage, serum urea, and creatinine levels were also elevated. Results demonstrated that inhibition of Nrf2 activation by Bru decreased Pb-elevated serum urea and creatinine levels, while activation of Nrf2 by Olt aggravated Pb- elevated serum urea and creatinine levels (Fig. 2B-C). Bru or Olt treatment alone has no impact on the serum markers of kidney damage. Given these findings, it can be concluded that Pb-induced persistent Nrf2 activation exerts the dark side of contributing to kidney injury.

Fig. 2.

Fig. 2

Persistent Nrf2 activation contributes to Pb-triggered nephrotoxicity in vivo and in vitro. Rats were exposed with Pb (NO3)2 with or without Bru or Olt treatment as mentioned in materials and methods. Kidney sections were stained with hematoxylin and eosin (A) and serum was collected to measure urea and creatinine levels (B, C). rPT cells were incubated with 0.5 µM Pb for 12 h and/or Bru (D) or Olt (E) treatment as mentioned above to perform cell viability assays. Data were expressed as mean ± SD (n = 3). ns not significant, * p < 0.05, ** p < 0.01.

Fig. 5.

Fig. 5

Nrf2 knockdown mitigates Pb-triggered apoptosis. rPT cells transfected with Nrf2- siRNA or scrambled (Scr) siRNA were treated with 0.5 µM Pb for 12 h. Flow cytometry analysis using Annexin V-FITC/PI double staining (A) and apoptotic morphological changes assessed by fluorescent microscopy in rPT cells were performed to evaluate apoptotic rate (B). (C)Protein levels of c-casp3 and cleaved PARP were immunoblotted and quantified (mean ± SD, n = 3). (D) Cell viability was assessed by CCK8 assay. ** p < 0.01.

Persistent Nrf2 activation plays a part in Pb-induced apoptosis

We previously demonstrated that oxidative stress-mediated apoptotic cellular death is the main mechanism underlying Pb-induced cytotoxicity in rPT cells [41]. Here, flow cytometry analysis using Annexin V-FITC/PI double staining and apoptotic morphological changes assessed by fluorescent microscopy in rPT cells as well as TUNEL staining assay in rat kidney section were conducted to clarify the role of Nrf2 activation in Pb-triggered apoptosis. Data showed that Pb-increased percent of rPT cells stained positive with Annexin-V-FITC, chromatin condensation with quantified apoptotic cells and TUNEL-positive cells in kidney section were significantly mitigated by Bru addition (Fig. 3A, B, E), but further worsened by Olt administration (Fig. 4A, B, E). Also, Pb-induced apoptosis was markedly inhibited by siRNA-mediated knockdown of Nrf2 (Fig. 5A-B).

Fig. 3.

Fig. 3

Pharmacological inhibition of Nrf2 alleviates Pb-triggered apoptosis in vitro and in vivo. rPT cells were incubated with 0.5 µM Pb for 12 h and/or Bru treatment as mentioned above. Rats were treated with Pb (NO3)2 with or without Bru treatment as mentioned in materials and methods section. Flow cytometry analysis using Annexin V-FITC/PI double staining (A) and apoptotic morphological changes assessed by fluorescent microscopy (B) in vitro were performed to evaluate cell apoptotic rate. Protein expression of c-casp3 and cleaved PARP were immunoblotted and quantified (mean ± SD, n = 3) in vitro (C) and in vivo (D). Apoptosis in kidney sections subjected to the indicated treatments was assessed with TUNEL assay and quantified the apoptotic rate (E). ns not significant, ** p < 0.01.

Fig. 4.

Fig. 4

Pharmacological activation of Nrf2 deteriorates Pb-triggered apoptosis in vitro and in vivo. rPT cells were incubated with 0.5 µM Pb for 12 h and/or Olt treatment as mentioned above. Rats were treated with Pb (NO3)2 with or without Olt treatment as mentioned in materials and methods section. Flow cytometry analysis using Annexin V-FITC/PI double staining (A) and apoptotic morphological changes assessed by fluorescent microscopy (B) in vitro were performed to evaluate cell apoptotic rate. Protein expression of c-casp3 and cleaved PARP were immunoblotted and quantified (mean ± SD, n = 3) in vitro (C) and in vivo (D). Apoptosis in kidney sections subjected to the indicated treatments was assessed with TUNEL assay and quantified the apoptotic rate (E). ns not significant, ** p < 0.01.

Next, protein levels of cleaved caspase-3 (c-casp3) and cleaved PARP, two apoptotic markers, were determined by immunoblotting to further clarify the role of Nrf2 activation on Pb-triggered apoptosis. Data showed that Pb-elevated c-casp3 and cleaved PARP protein expression were evidently inhibited by Bru in vitro and in vivo (Fig. 3C–D), consistent with results from Nrf2 knockdown in rPT cells (Fig. 5C). However, Pb-elevated these two protein levels were further heightened by Olt administration in vitro and in vivo (Fig. 4C–D). Collectively, these results fully confirmed that Pb-induced persistent Nrf2 activation plays a part in apoptosis.

Persistent Nrf2 activation deteriorates Pb-induced autophagy inhibition

Emerging evidences have demonstrated that there is cross-talk between Nrf2 pathway and autophagy in maintaining cell survival under stress conditions [43], [44]. We previously demonstrated that autophagy inhibition contributes to Pb-triggered cytotoxicity in rPT cells [7], which enables us to consider whether Nrf2 activation is relevant to autophagy inhibition during Pb exposure. To verify our hypothesis, various autophagy assays were performed to compare the changes with or without pharmacological modification or siRNA-mediated knockdown of Nrf2. First, we selected the tandem sensor RFP-GFP-LC3, a sensitive and dynamic autophagy assay, to compare the number of autolysosomes and autophagosomes in Pb-treated rPT cells. As shown in Fig. 6A, 7A and 8A, Pb increased the autophagosome accumulation (yellow puncta) and decreased the autolysosome formation (red puncta), which were worsened by Olt addition but attenuated by Bru treatment and Nrf2 knockdown. Specifically, Nrf2 knockdown alone evidently caused the increase of yellow puncta with a concomitant reduction in red puncta (Fig. 8A). Similarly, results of GFP-LC3 plasmid transfection confirmed that Pb caused the autophagosome accumulation (green puncta) due to autophagy inhibition, which was also alleviated by Bru and Nrf2 knockdown (Fig. 6B and 8B). However, Pb-increased GFP-LC3 positive green puncta was further accumulated by Olt administration (Fig. 7B). Finally, protein expression of LC3-II and p62, two known autophagy markers, were performed by immunoblotting to further assess autophagic status. Data showed that Pb-elevated LC3-II and p62 protein expression were evidently decreased by Bru treatment and Nrf2 knockdown, but further aggravated by Olt both in vitro and in vivo (Fig. 6C-D, 7C-D, 8C-D). Taken together, these findings provide solid evidence that persistent Nrf2 activation deteriorates Pb-induced autophagy inhibition.

Fig. 6.

Fig. 6

Pharmacological inhibition of Nrf2 alleviates Pb-triggered autophagy inhibition in vitro and in vivo. rPT cells were transient transfected with RFP-GFP-LC3 plasmid (A) or GFP-LC3 plasmid (B), then incubated with 0.5 µM Pb for 12 h with or without Bru as mentioned above. rPT cells and rats were exposed to Pb with or without Bru treatment as mentioned above to analyze the autophagic marker protein levels. Protein expression of LC3-II and p62 were immunoblotted and quantified (mean ± SD, n = 3) in vitro (C) and in vivo (D). ns not significant, ** p < 0.01.

Fig. 8.

Fig. 8

Nrf2 knockdown alleviates Pb-triggered autophagy blockage. rPT cells were transfected with Nrf2-specific siRNA or scrambled (Scr) siRNA, then transfected with RFP-GFP-LC3 plasmid (A) or GFP-LC3 plasmid (B), followed by exposure with 0.5 μM Pb for 12 h. rPT cells were exposed to Pb with or without siRNA-mediated knockdown of Nrf2 to analyze the protein expression of LC3-II and p62 (C). Representative immunoblot images were present and quantification analysis were carried out. * p < 0.05, ** p < 0.01.

Fig. 7.

Fig. 7

Pharmacological up-regulation of Nrf2 aggravates Pb-induced autophagy inhibition in vitro and in vivo. rPT cells were transient transfected with RFP-GFP-LC3 plasmid (A) or GFP-LC3 plasmid (B), then incubated with 0.5 µM Pb for 12 h with or without Olt as mentioned above. rPT cells and rats were exposed to Pb with or without Olt treatment as mentioned above to analyze the autophagic marker protein levels. Protein expression of LC3-II and p62 were immunoblotted and quantified (mean ± SD, n = 3) in vitro (C) and in vivo (D). ns not significant, ** p < 0.01.

Reduced Keap1 caused by phosphorylation of p62 at Ser349 induces persistent Nrf2 activation

To determine the possible cause of Pb-induced persistent Nrf2 activation, mRNA expression levels of Nrf2 in different time intervals were detected. Results showed that Pb evidently promoted the Nrf2 transcription at the early stage with the peak at 4 h, whereas inhibited its transcription from 10 − 12 h (Fig. 9A). Under normal circumstances, Nrf2 is degraded by ubiquitination that is mediated by Keap1. p62 is a scaffold protein that involves in a variety of biological processes, including autophagy and oxidative stress. Abnormal accumulated p62 binds Keap1 and competes with Nrf2 for binding Keap1, ultimately decreasing Nrf2 ubiquitination and proteasomal degradation [45]. Then, protein expression profiles of Keap1 and p62 were analyzed. Results showed that Pb-increased p62 and p-p62 protein levels were mitigated by Bru or Nrf2 siRNA-mediated knockdown down, but further worsened by Olt administration (Fig. 6C-D, 7C-D, 8C, S4A-C). Likewise, data also showed that Pb-decreased Keap1 protein level was markedly reversed by Bru addition or Nrf2 siRNA-mediated knockdown, but further heightened by Olt administration. However, there was no significant difference in the effect of Bru, Olt or Nrf2 siRNA on Keap1 and p62, p-p62 expression levels in vitro and in vivo (Figs. S5A-C). Meanwhile, data in Fig. 9B demonstrated that Pb evidently reduced the distribution of Keap1 in the cytoplasm and nucleus in rPT cells, evidenced by IF staining. Consistently, data further confirmed that Pb reduced the Keap1 protein levels in nuclear-cytoplasmic extractions in vitro and in vivo (Fig. 9C–D). Importantly, confocal microscopy observation suggested that Pb treatment led to the p62 accumulation and enhanced the co-localization of p62 and Keap1 in rPT cells (Fig. 9E). It is notably that phosphorylation of p62 Ser349 can enhance the binding between p62 and Keap1, leading to persistent Nrf2 activation [46]. Hereby, we analyzed the protein level of p-p62 (Ser349) and found that Pb significantly increased p-p62 (Ser349) protein level in rPT cells (Fig. 9F). Moreover, Pb promoted the accumulation of p-p62 (Ser349) puncta and co-localization of p-p62 (Ser349) with Keap1 in cytoplasm of rPT cells (Fig. 9G). Additionally, Pb inhibited the Nrf2 ubiquitination level in rPT cells (Fig. 9H). According to these results, it can be seen that Pb-mediated accumulation of p62 and p-p62 (Ser349) is responsible for reduced Nrf2 ubiquitination and nuclear-cytoplasmic loss of Keap1, ultimately contributing to persistent Nrf2 nuclear retention.

Fig. 9.

Fig. 9

Reduced Keap1 caused by increased affinity with p62 and phosphorylation of p62 at Ser349 results in Pb-induced persistent Nrf2 activation. (A) mRNA levels of Nrf2 were determined by RT-qPCR analysis in different time intervals in vitro. rPT cells were incubated with 0.5 µM Pb for 12 h to evaluate the distribution of Keap1 in the nucleus and cytoplasm by IF staining (B) and immunoblot analysis (C). Rats were exposed to Pb as above mentioned and kidney tissues were collected to prepare cytoplasmic-nuclear extractions for analyzing the distribution of Keap1 protein by immunoblot analysis (D). rPT cells were treated with 0.5 µM Pb for 12 h to evaluate the colocalization of p62 with Keap1 (E), protein levels of p-p62 (F), colocalization of p-p62 with Keap1 (G) and the binding between Nrf2 and ubiquitination (H). Data in C, D and F are shown as mean ± SD (n = 3). * p < 0.05, ** p < 0.01, *** p < 0.001.

Discussion

While contributions of Nrf2 to redox imbalance have been recognized, molecular basis of the Nrf2 function in Pb-induced kidney damage remains to be clarified. In this study, the role of Nrf2 was evaluated in Pb-triggered nephrotoxicity in vitro and in vivo. The data demonstrated that Pb-induced cytotoxicity and renal injury were alleviated by Nrf2 down-regulation while deteriorated by Nrf2 up-regulation. Consistently, this phenomenon was also confirmed in vitro and in vivo that Pb-induced Nrf2 activation aggravated apoptosis and autophagy inhibition. Mechanically, Pb increased binding of Keap1 with p62 and p-p62 (Ser349), leading to deregulation of the Nrf2-Keap1 axis and resultant Nrf2 persistent activation, contributing to Pb-induced nephrotoxicity.

Oxidative stress is a known mechanism responsible for Pb-induced nephrotoxicity. It is a condition in which cells experience redox imbalance; that is, the balance between oxidants and antioxidants is disturbed. This imbalance is attributed to excessive ROS with or without lack of antioxidant levels [47]. Nrf2 is considered vital for the regulation of cellular homeostasis, as it functions to protect cells against endogenous and exogenous stresses like oxidative stress by controlling the expression of cytoprotective genes [48]. Here, Pb promotes the time-dependent nuclear Nrf2 protein accumulation and the consequent up-regulated expression of downstream antioxidant protein, thus displaying persistent Nrf2 activation. Prior studies have also shown that Pb increases Nrf2 expression in testes of rats and SH- SY5Y cells [49], but lack of systematical evidence to clarify the role of Nrf2 function in Pb-triggered toxicity. Moreover, considerable recent findings have demonstrated that moderate Nrf2 activation functions as a crucial protective mechanism in heavy metal (including Cd and Pb)-induced toxicity [50], [51], [52], [53]. Nrf2 deficiency has been known to aggravate Cd-triggered tissue injury [25], [52], elucidating the role of Nrf2 pathway in self-defense mechanism, which is consistent with the current data that Nrf2 knockdown results in cytotoxicity of rPT cells under basal conditions. Therefore, pharmacological modulations combined with siRNA-mediated knockdown of Nrf2, not Nrf2-knockout model, were applied in this study to clarify our hypothesis. Emerging data have also highlighted detrimental effect of Nrf2 in disease progression, that is, persistent Nrf2 activation aggravates tissue injury [37], [54], [55]. Likewise, the current data show that Pb-induced kidney injury was alleviated by Nrf2 down-regulation but aggravated by Nrf2 up-regulation, demonstrating that Pb-induced persistent Nrf2 activation contributes to nephrotoxicity. Combined with the Nrf2 function and our data, we speculated that Nrf2 is initially an adaptive response to Pb exposure and serves to render cells resistant to ROS attack. Gradually, ROS overproduction overwhelms antioxidant capacity to induce redox imbalance. Then Pb disrupts the regulation and fate of Nrf2 to induce the sustained nuclear Nrf2 accumulation, leading to kidney injury.

Apoptosis and autophagy are two different processes with regulatory connections that regulate cell fate in response to cytotoxic stress, which have been shown to be implicated in the pathogenesis and development of kidney injury [56]. Our recent studies have shown that oxidative stress-mediated apoptosis and autophagy inhibition play key roles in Pb-triggered cytotoxicity in rPT cells [7], [41], while Pb-triggered apoptosis and autophagy down-regulation were alleviated by Nrf2 inhibition but aggravated by Nrf2 up-regulation in this study. Based on data in this study, we speculated that Pb-induced excessive oxidative stress was alleviated when redundant nuclear Nrf2 accumulation was weakened by Bru addition or siRNA-mediated knockdown, further indicating the detrimental role of Nrf2 in Pb-triggered redox imbalance. Thus, the appropriate expression and concurrent balance of Nrf2 is indispensable for the regulation of oxidative stress. As regards to the role of Nrf2 in Pb-induced redox imbalance, it needs to be further investigated.

Moreover, there is crosstalk among Nrf2 pathway, apoptosis and autophagy. It is generally accepted that Nrf2 activation exerts an anti-apoptotic effect on harmful chemicals-induced kidney injury [57], [58], [59]. However, sustained high expression of Nrf2 induces apoptosis in arsenic (As)-triggered malignant transformation of cells, which is related to the cancer development and progression [54]. Given that both As and Pb are toxic carcinogenic heavy metals, we guess Pb-induced apoptosis due to persistent Nrf2 activation may be related to carcinogenesis, which merits further investigation. Meanwhile, Nrf2 pathway and autophagy are known to be complementary mechanisms in maintaining cell survival [60], [61]. However, researches on autophagy-defective experimental models provide solid information that persistent Nrf2 activation owing to dysregulated autophagy causes tissue damages [55], [62]. It is now widely known that p62 functions as an adaptor to link autophagy and Nrf2 signaling, that is, p62 accumulation induce persistent Nrf2 activation [35], [62]. Our previous research has revealed that Pb-triggered autophagy inhibition is attributed to lysosomal dysfunction, leading to p62 accumulation [7]. Thus, Pb-induced p62 accumulation may act as an important adaptor linking persistent Nrf2 activation and autophagy inhibition. Additionally, dysregulation of autophagy induces renal apoptosis in the progress of kidney injury [54]. In our previous study, results found that inhibited autophagic degradation aggravated Pb-induced apoptosis in rPT cells [63]. Moreover, some studies have also confirmed that the accumulation of p62/SQSTM1 caused by autophagic flux inhibition promotes apoptosis [64], [65]. However, the cross-talk between autophagy inhibition and apoptosis and the role of p62 in this process needs to be further investigated. Therefore, it is of great value to clarify the cross-talk mechanism among Nrf2 pathway, apoptosis and autophagy for clarifying Pb-induced nephrotoxicity.

Next, to determine the possible cause of Pb-induced persistent Nrf2 activation, mRNA expression levels of Nrf2 in different time intervals were detected. PCR results showed that the activated Nrf2 was not newly generated Nrf2. Mechanically, Keap1 enlists Nrf2 into the Cul3-containing E3 ubiquitin ligase complex for ubiquitin binding and resultant proteasome degradation under basal conditions [66]. In addition, Keap1 terminates Nrf2 signals by escorting Nrf2 nuclear export. Then, protein expression levels and the distribution of Keap1 in the cytoplasm and nucleus were analyzed. As evidenced by IF staining and Western blotting, Pb significantly reduced Keap1 expression levels and the distribution of Keap1 in the cytoplasm and nucleus, suggesting that Pb-induced persistent Nrf2 activation may be relevant to the reduction of Keap1. Notably, p62, an autophagy adaptor protein, is implicated in competitively prohibiting Keap1-Nrf2 binding. Moreover, p-p62 (Ser349) evidently enhances Keap1-p62 aggregate formation, which facilitates Nrf2 accumulation [45], [62]. It means that p-p62 (Ser349) binds to Keap1 and competes with the combination of Nrf2, which protects Nrf2 from Keap1-induced proteasomal degradation. Based on the current data, Pb led to the p62 accumulation and increased co-localization of p62 and Keap1 in rPT cells. Particularly, Pb significantly up-regulated p-p62 (Ser349) protein level and promoted co-localization of p-p62 (Ser349) with Keap1 in the cytoplasm. Consequently, Pb-induced abnormal accumulation of p-p62 (Ser349) competitively binds to Keap1, contributing to attenuated Nrf2 ubiquitination level. Thus, deregulation of the Nrf2-Keap1 axis caused by p62 competitively binding Keap1 is responsible for persistent nuclear retention of Nrf2 during Pb exposure.

Conclusion

In summary, the possible mechanism of persistent Nrf2 activation contributes to Pb-induced kidney injury is expounded. Reduced Nrf2 degradation and loss of Keap1 in a p62-dependent non-canonical manner result in persistent Nrf2 activation. Persistent Nrf2 activation causes redox imbalance to trigger apoptosis and autophagy blockage, contributing to Pb-triggered nephrotoxicity. These results shed light on the crosstalk among Nrf2 pathway, apoptosis and autophagy in Pb-induced kidney injury, thus providing valuable new insights into kidney injury.

Compliance with ethics requirements

Eighteen 6-week-old male SD rats weighing 100–110 g were provided by Jinan Pengyue Experimental Animal Breeding Co., ltd. (Jinan, China). All experimental protocols were approved by the Ethic Animal Care Committee of Shandong Agricultural University (No. SDAUA-2018-010).

CRediT authorship contribution statement

Cai-Yu Lian: Conceptualization, Methodology, Software, Data curation, Writing – original draft. Bing-Xin Chu: . Wei-Hao Xia: Writing – review & editing. Zhen-Yong Wang: Writing – review & editing. Rui-Feng Fan: Writing – review & editing, Project administration, Funding acquisition. Lin Wang: Writing – review & editing, Project administration, Funding acquisition.

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgements

This work was supported by grants from the National Natural Science Foundation of China (32172920, 31873030, 32072927), Shandong Provincial Natural Science Foundation of China (No. ZR2019MC068), Youth Innovation and Technology Program in Colleges and Universities of Shandong Province (no. 2020KJF009) and project of Shandong province higher educational science and technology program (no. J18KA119).

Footnotes

Peer review under responsibility of Cairo University.

Appendix A

Supplementary data to this article can be found online at https://doi.org/10.1016/j.jare.2022.04.016.

Contributor Information

Rui-Feng Fan, Email: fanruifeng@sdau.edu.cn.

Lin Wang, Email: wanglin2013@sdau.edu.cn.

Appendix A. Supplementary material

The following are the Supplementary data to this article:

Supplementary data 1
mmc1.pdf (127.9KB, pdf)
Supplementary data 2
mmc2.pdf (192.7KB, pdf)
Supplementary data 3
mmc3.pdf (258.7KB, pdf)
Supplementary data 4
mmc4.pdf (135.3KB, pdf)
Supplementary data 5
mmc5.pdf (109.6KB, pdf)
Supplementary data 6
mmc6.docx (15.6KB, docx)

References

  • 1.Arif M.S., Yasmeen T., Shahzad S.M., Riaz M., Rizwan M., Iqbal S., et al. Lead toxicity induced phytotoxic effects on mung bean can be relegated by lead tolerant Bacillus subtilis. Chemosphere. 2019;234:70–80. doi: 10.1016/j.chemosphere.2019.06.024. [DOI] [PubMed] [Google Scholar]
  • 2.Ahmad F., Haque S., Ravinayagam V., Ahmad A., Kamli M.R., Barreto G.E., et al. Ghulam Md, Developmental lead (Pb)-induced deficits in redox and bioenergetic status of cerebellar synapses are ameliorated by ascorbate supplementation. Toxicology. 2020;440 doi: 10.1016/j.tox.2020.152492. [DOI] [PubMed] [Google Scholar]
  • 3.Shabaan M., Asghar H.N., Akhtar M.J., Ali Q., Ejaz M. Role of plant growth promoting rhizobacteria in the alleviation of lead toxicity to Pisum sativum L. Int J Phytorem. 2021;23(8):837–845. doi: 10.1080/15226514.2020.1859988. [DOI] [PubMed] [Google Scholar]
  • 4.Ashraf U., Mahmood M.H., Hussain S., Abbas F., Anjum S.A., Tang X. Lead (Pb) distribution and accumulation in different plant parts and its associations with grain Pb contents in fragrant rice. Chemosphere. 2020;248 doi: 10.1016/j.chemosphere.2020.126003. [DOI] [PubMed] [Google Scholar]
  • 5.Oyagbemi A.A., Omobowale T.O., Akinrinde A.S., Saba A.B., Ogunpolu B.S., Daramola O. Lack of reversal of oxidative damage in renal tissues of lead acetate-treated rats. Environ Toxicol. 2015;30(11):1235–1243. doi: 10.1002/tox.21994. [DOI] [PubMed] [Google Scholar]
  • 6.Renu K., Chakraborty R., Myakala H., Koti R., Famurewa A.C., Madhyastha H., et al. Molecular mechanism of heavy metals (Lead, Chromium, Arsenic, Mercury, Nickel and Cadmium) - induced hepatotoxicity - A review. Chemosphere. 2021;271 doi: 10.1016/j.chemosphere.2021.129735. [DOI] [PubMed] [Google Scholar]
  • 7.Song X.-B., Liu G., Liu F., Yan Z.-G., Wang Z.-Y., Liu Z.-P., et al. Autophagy blockade and lysosomal membrane permeabilization contribute to lead-induced nephrotoxicity in primary rat proximal tubular cells. Cell Death Dis. 2017;8(6):e2863. doi: 10.1038/cddis.2017.262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Song X., Li Z., Liu F., Wang Z., Wang L. Restoration of autophagy by puerarin in lead-exposed primary rat proximal tubular cells via regulating AMPK-mTOR signaling. J Biochem Mol Toxicol. 2017;31(3):e21869. doi: 10.1002/jbt.21869. [DOI] [PubMed] [Google Scholar]
  • 9.Liu G., Wang Z.-K., Wang Z.-Y., Yang D.-B., Liu Z.-P., Wang L. Mitochondrial permeability transition and its regulatory components are implicated in apoptosis of primary cultures of rat proximal tubular cells exposed to lead. Arch Toxicol. 2016;90(5):1193–1209. doi: 10.1007/s00204-015-1547-0. [DOI] [PubMed] [Google Scholar]
  • 10.Pérez B., Acosta B.E. Proceedings of the Western Pharmacology Society. 2002. Kidney function changes after acute exposure to lead; pp. 97–98. [PubMed] [Google Scholar]
  • 11.Wang Y., Quan F., Cao Q., Lin Y., Yue C., Bi R., et al. Quercetin alleviates acute kidney injury by inhibiting ferroptosis. J Adv Res. 2021;28:231–243. doi: 10.1016/j.jare.2020.07.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Paithankar J.G., Saini S., Dwivedi S., Sharma A., Chowdhuri D.K. Heavy metal associated health hazards: An interplay of oxidative stress and signal transduction. Chemosphere. 2021;262 doi: 10.1016/j.chemosphere.2020.128350. [DOI] [PubMed] [Google Scholar]
  • 13.Pellegrino D., La Russa D., Marrone A. Oxidative Imbalance and Kidney Damage: New Study Perspectives from Animal Models to Hospitalized Patients. Antioxidants (Basel) 2019;8(12):594. doi: 10.3390/antiox8120594. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Liu Z.H., Shang J., Yan L., Wei T., Xiang L., Wang H.L., et al. Oxidative stress caused by lead (Pb) induces iron deficiency in Drosophila melanogaster. Chemosphere. 2020;243 doi: 10.1016/j.chemosphere.2019.125428. [DOI] [PubMed] [Google Scholar]
  • 15.Huang H.e., Chen J., Sun Q.i., Liu Y., Tang Y., Teng X. NLRP3 inflammasome is involved in the mechanism of mitigative effect of selenium on lead-induced inflammatory damage in chicken kidneys. Environ Sci Pollut Res Int. 2021;28(9):10898–10908. doi: 10.1007/s11356-020-11322-w. [DOI] [PubMed] [Google Scholar]
  • 16.Zhang T., Chen S.i., Chen L., Zhang L., Meng F., Sha S., et al. Chlorogenic Acid Ameliorates Lead-Induced Renal Damage in Mice. Biol Trace Elem Res. 2019;189(1):109–117. doi: 10.1007/s12011-018-1508-6. [DOI] [PubMed] [Google Scholar]
  • 17.Iflazoglu Mutlu S., Seven I., Arkali G., Birben N., Sur Arslan A., Aksakal M., et al. Tatli Seven, Ellagic acid plays an important role in enhancing productive performance and alleviating oxidative stress, apoptosis in laying quail exposed to lead toxicity. Ecotoxicol Environ Saf. 2021;208 doi: 10.1016/j.ecoenv.2020.111608. [DOI] [PubMed] [Google Scholar]
  • 18.Su L.J., Zhang J.H., Gomez H., Murugan R., Hong X., Xu D., et al. Reactive oxygen species-induced lipid peroxidation in apoptosis, autophagy, and ferroptosis. Oxid Med Cell Longev. 2019;2019:5080843. doi: 10.1155/2019/5080843. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Xie J., He X., Fang H., Liao S., Liu Y., Tian L., et al. Identification of heme oxygenase-1 from golden pompano (Trachinotus ovatus) and response of Nrf2/HO-1 signaling pathway to copper-induced oxidative stress. Chemosphere. 2020;253 doi: 10.1016/j.chemosphere.2020.126654. [DOI] [PubMed] [Google Scholar]
  • 20.Zhao X., Liu Z., Gao J., Li H., Wang X., Li Y., et al. Inhibition of ferroptosis attenuates busulfan-induced oligospermia in mice. Toxicology. 2020;440 doi: 10.1016/j.tox.2020.152489. [DOI] [PubMed] [Google Scholar]
  • 21.Yang Q., Han B., Li S., Wang X., Wu P., Liu Y., et al. The link between deacetylation and hepatotoxicity induced by exposure to hexavalent chromium. J Adv Res. 2022;35:129–140. doi: 10.1016/j.jare.2021.04.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Liu X., Li T., Liu Y., Sun S., Liu D. Nuclear factor erythroid 2-related factor 2 potentiates the generation of inflammatory cytokines by intestinal epithelial cells during hyperoxia by inducing the expression of interleukin 17D. Toxicology. 2021;457 doi: 10.1016/j.tox.2021.152820. [DOI] [PubMed] [Google Scholar]
  • 23.Liang J., Zhang X.-Y., Zhen Y.-F., Chen C., Tan H., Hu J., et al. PGK1 depletion activates Nrf2 signaling to protect human osteoblasts from dexamethasone. Cell Death Dis. 2019;10(12) doi: 10.1038/s41419-019-2112-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Guo K., Ge J., Zhang C., Lv M.W., Zhang Q., Talukder M., et al. ‘Cadmium induced cardiac inflammation in chicken (Gallus gallus) via modulating cytochrome P450 systems and Nrf2 mediated antioxidant defense. Chemosphere. 2020;249 doi: 10.1016/j.chemosphere.2020.125858. [DOI] [PubMed] [Google Scholar]
  • 25.Chen C., Han X., Wang G., Liu D., Bao L., Jiao C., et al. Nrf2 deficiency aggravates the kidney injury induced by subacute cadmium exposure in mice. Arch Toxicol. 2021;95(3):883–893. doi: 10.1007/s00204-020-02964-3. [DOI] [PubMed] [Google Scholar]
  • 26.Zhang Q., Liu J., Duan H., Li R., Peng W., Wu C. Activation of Nrf2/HO-1 signaling: An important molecular mechanism of herbal medicine in the treatment of atherosclerosis via the protection of vascular endothelial cells from oxidative stress. J Adv Res. 2021;34:43–63. doi: 10.1016/j.jare.2021.06.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Yasuda D., Ohe T., Takahashi K., Imamura R., Kojima H., Okabe T., et al. Inhibitors of the protein-protein interaction between phosphorylated p62 and Keap1 attenuate chemoresistance in a human hepatocellular carcinoma cell line. Free Radic Res. 2020;54(11-12):859–871. doi: 10.1080/10715762.2020.1732955. [DOI] [PubMed] [Google Scholar]
  • 28.Silva-Islas C.A., Maldonado P.D. Canonical and non-canonical mechanisms of Nrf2 activation. Pharmacol Res. 2018;134:92–99. doi: 10.1016/j.phrs.2018.06.013. [DOI] [PubMed] [Google Scholar]
  • 29.Kageyama S., Saito T., Obata M., Koide R.-H., Ichimura Y., Komatsu M. Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant. Mol Cell Biol. 2018;38(7) doi: 10.1128/MCB.00642-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Albarakati A.J.A., Baty R.S., Aljoudi A.M., Habotta O.A., Elmahallawy E.K., Kassab R.B., et al. Luteolin protects against lead acetate-induced nephrotoxicity through antioxidant, anti-inflammatory, anti-apoptotic, and Nrf2/HO-1 signaling pathways. Mol Biol Rep. 2020;47(4):2591–2603. doi: 10.1007/s11033-020-05346-1. [DOI] [PubMed] [Google Scholar]
  • 31.Song Y., Sun H., Gao S., Tang K.e., Zhao Y., Xie G., et al. Saikosaponin a attenuates lead-induced kidney injury through activating Nrf2 signaling pathway. Comp Biochem Physiol C: Toxicol Pharmacol. 2021;242:108945. doi: 10.1016/j.cbpc.2020.108945. [DOI] [PubMed] [Google Scholar]
  • 32.Wang L.-Y., Fan R.-F., Yang D.-B., Zhang D., Wang L. Puerarin reverses cadmium-induced lysosomal dysfunction in primary rat proximal tubular cells via inhibiting Nrf2 pathway. Biochem Pharmacol. 2019;162:132–141. doi: 10.1016/j.bcp.2018.10.016. [DOI] [PubMed] [Google Scholar]
  • 33.Zang H., Mathew R.O., Cui T. The Dark Side of Nrf2 in the Heart. Front Physiol. 2020;11:722. doi: 10.3389/fphys.2020.00722. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Kannan S., Muthusamy V.R., Whitehead K.J., Wang L.i., Gomes A.V., Litwin S.E., et al. Nrf2 deficiency prevents reductive stress-induced hypertrophic cardiomyopathy. Cardiovasc Res. 2013;100(1):63–73. doi: 10.1093/cvr/cvt150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Liao W., Wang Z., Fu Z., Ma H., Jiang M., Xu A., et al. p62/SQSTM1 protects against cisplatin-induced oxidative stress in kidneys by mediating the cross talk between autophagy and the Keap1-Nrf2 signalling pathway. Free Radic Res. 2019;53(7):800–814. doi: 10.1080/10715762.2019.1635251. [DOI] [PubMed] [Google Scholar]
  • 36.Arab H.H., Ashour A.M., Eid A.H., Arafa E.A., Al Khabbaz H.J., Abd El-Aal S.A. Targeting oxidative stress, apoptosis, and autophagy by galangin mitigates cadmium-induced renal damage: Role of SIRT1/Nrf2 and AMPK/mTOR pathways. Life Sci. 2022;291 doi: 10.1016/j.lfs.2021.120300. [DOI] [PubMed] [Google Scholar]
  • 37.Fan R.-F., Tang K.-K., Wang Z.-Y., Wang L. Persistent activation of Nrf2 promotes a vicious cycle of oxidative stress and autophagy inhibition in cadmium-induced kidney injury. Toxicology. 2021;464:152999. doi: 10.1016/j.tox.2021.152999. [DOI] [PubMed] [Google Scholar]
  • 38.Gong Z.-G., Wang X.-Y., Wang J.-H., Fan R.-F., Wang L. Trehalose prevents cadmium-induced hepatotoxicity by blocking Nrf2 pathway, restoring autophagy and inhibiting apoptosis. J Inorg Biochem. 2019;192:62–71. doi: 10.1016/j.jinorgbio.2018.12.008. [DOI] [PubMed] [Google Scholar]
  • 39.Li Y., Shi D., Zhang H., Yao X., Wang S., Wang R., et al. The Application of Functional Magnetic Resonance Imaging in Type 2 Diabetes Rats With Contrast-Induced Acute Kidney Injury and the Associated Innate Immune Response. Front Physiol. 2021;12 doi: 10.3389/fphys.2021.669581. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Shingu C., Koga H., Hagiwara S., Matsumoto S., Goto K., Yokoi I., et al. Hydrogen-rich saline solution attenuates renal ischemia-reperfusion injury. J Anesth. 2010;24(4):569–574. doi: 10.1007/s00540-010-0942-1. [DOI] [PubMed] [Google Scholar]
  • 41.Wang L., Wang H., Hu M., Cao J., Chen D., Liu Z. Oxidative stress and apoptotic changes in primary cultures of rat proximal tubular cells exposed to lead. Arch Toxicol. 2009;83(5):417–427. doi: 10.1007/s00204-009-0425-z. [DOI] [PubMed] [Google Scholar]
  • 42.Suzuki T., Seki S., Hiramoto K., Naganuma E., Kobayashi E.H., Yamaoka A., et al. Hyperactivation of Nrf2 in early tubular development induces nephrogenic diabetes insipidus. Nat Commun. 2017;8:14577. doi: 10.1038/ncomms14577. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Dodson M., Redmann M., Rajasekaran N.S., Darley-Usmar V., Zhang J. KEAP1-NRF2 signalling and autophagy in protection against oxidative and reductive proteotoxicity. Biochem J. 2015;469(3):347–355. doi: 10.1042/BJ20150568. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Yu Y., Tian Z.Q., Liang L., Yang X., Sheng D.D., Zeng J.X., et al. Babao Dan attenuates acute ethanol-induced liver injury via Nrf2 activation and autophagy. Cell Biosci. 2019;9:80. doi: 10.1186/s13578-019-0343-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Liao K., Su X., Lei K., Liu Z., Lu L., Wu Q., et al. Sinomenine protects bone from destruction to ameliorate arthritis via activating p62(Thr269/Ser272)-Keap1-Nrf2 feedback loop. Biomed Pharmacother. 2021;135 doi: 10.1016/j.biopha.2020.111195. [DOI] [PubMed] [Google Scholar]
  • 46.Egbujor M.C., Saha S., Buttari B., Profumo E., Saso L. Activation of Nrf2 signaling pathway by natural and synthetic chalcones: a therapeutic road map for oxidative stress. Expert Rev Clin Pharmacol. 2021;14(4):465–480. doi: 10.1080/17512433.2021.1901578. [DOI] [PubMed] [Google Scholar]
  • 47.Reyes J.L., Molina-Jijon E., Rodriguez-Munoz R., Bautista-Garcia P., Debray-Garcia Y., Namorado Mdel C. Tight junction proteins and oxidative stress in heavy metals-induced nephrotoxicity. Biomed Res Int. 2013;2013 doi: 10.1155/2013/730789. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Robledinos-Anton N., Fernandez-Gines R., Manda G., Cuadrado A. Activators and Inhibitors of NRF2: A Review of Their Potential for Clinical Development. Oxid Med Cell Longev. 2019;2019:9372182. doi: 10.1155/2019/9372182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Ye F., Li X., Li L., Lyu L., Yuan J., Chen J. The role of Nrf2 in protection against Pb-induced oxidative stress and apoptosis in SH-SY5Y cells. Food Chem Toxicol. 2015;86:191–201. doi: 10.1016/j.fct.2015.10.009. [DOI] [PubMed] [Google Scholar]
  • 50.Hosseinirad H., Shahrestanaki J.K., Moosazadeh Moghaddam M., Mousazadeh A., Yadegari P., Afsharzadeh N. Protective Effect of Vitamin D3 Against Pb-Induced Neurotoxicity by Regulating the Nrf2 and NF-kappaB Pathways. Neurotox Res. 2021;39(3):687–696. doi: 10.1007/s12640-020-00322-w. [DOI] [PubMed] [Google Scholar]
  • 51.Yu Z.M., Wan X.M., Xiao M., Zheng C., Zhou X.L. Puerarin induces Nrf2 as a cytoprotective mechanism to prevent cadmium-induced autophagy inhibition and NLRP3 inflammasome activation in AML12 hepatic cells. J Inorg Biochem. 2021;217 doi: 10.1016/j.jinorgbio.2021.111389. [DOI] [PubMed] [Google Scholar]
  • 52.Ren X., Xu Y., Yu Z., Mu C., Liu P., Li J. The role of Nrf2 in mitigating cadmium-induced oxidative stress of Marsupenaeus japonicus. Environ Pollut. 2021;269 doi: 10.1016/j.envpol.2020.116112. [DOI] [PubMed] [Google Scholar]
  • 53.Song Q., Zhu Z. Using Cordyceps militaris extracellular polysaccharides to prevent Pb(2+)-induced liver and kidney toxicity by activating Nrf2 signals and modulating gut microbiota. Food Funct. 2020;11(10):9226–9239. doi: 10.1039/d0fo01608j. [DOI] [PubMed] [Google Scholar]
  • 54.Kong Q., Deng H., Li C., Wang X., Shimoda Y., Tao S., et al. Sustained high expression of NRF2 and its target genes induces dysregulation of cellular proliferation and apoptosis is associated with arsenite-induced malignant transformation of human bronchial epithelial cells. Sci Total Environ. 2021;756 doi: 10.1016/j.scitotenv.2020.143840. [DOI] [PubMed] [Google Scholar]
  • 55.Rojo de la Vega M., Dodson M., Gross C., Mansour H.M., Lantz R.C., Chapman E., et al. Role of Nrf2 and Autophagy in Acute Lung Injury. Curr Pharmacol Rep. 2016;2(2):91–101. doi: 10.1007/s40495-016-0053-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Kim D.H., Park J.S., Choi H.I., Kim C.S., Bae E.H., Ma S.K., et al. The critical role of FXR is associated with the regulation of autophagy and apoptosis in the progression of AKI to CKD. Cell Death Dis. 2021;12(4):320. doi: 10.1038/s41419-021-03620-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Kassab R.B., Lokman M.S., Daabo H.M.A., Gaber D.A., Habotta O.A., Hafez M.M., et al. Ferulic acid influences Nrf2 activation to restore testicular tissue from cadmium-induced oxidative challenge, inflammation, and apoptosis in rats. J Food Biochem. 2020;44(12) doi: 10.1111/jfbc.13505. [DOI] [PubMed] [Google Scholar]
  • 58.Wei W., Ma N., Fan X., Yu Q., Ci X. The role of Nrf2 in acute kidney injury: Novel molecular mechanisms and therapeutic approaches. Free Radic Biol Med. 2020;158:1–12. doi: 10.1016/j.freeradbiomed.2020.06.025. [DOI] [PubMed] [Google Scholar]
  • 59.Li Z., Zhu J., Wan Z., Li G., Chen L., Guo Y. Theaflavin ameliorates renal ischemia/reperfusion injury by activating the Nrf2 signalling pathway in vivo and in vitro. Biomed Pharmacother. 2021;134 doi: 10.1016/j.biopha.2020.111097. [DOI] [PubMed] [Google Scholar]
  • 60.Lv H., Yang H., Wang Z., Feng H., Deng X., Cheng G., et al. Nrf2 signaling and autophagy are complementary in protecting lipopolysaccharide/d-galactosamine-induced acute liver injury by licochalcone A. Cell Death Dis. 2019;10(4):313. doi: 10.1038/s41419-019-1543-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Walker A., Singh A., Tully E., Woo J., Le A., Nguyen T., et al. Nrf2 signaling and autophagy are complementary in protecting breast cancer cells during glucose deprivation. Free Radic Biol Med. 2018;120:407–413. doi: 10.1016/j.freeradbiomed.2018.04.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Jiang T., Harder B., Rojo de la Vega M., Wong P.K., Chapman E., Zhang D.D. p62 links autophagy and Nrf2 signaling. Free Radic Biol Med. 2015;88(Pt B):199–204. doi: 10.1016/j.freeradbiomed.2015.06.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Chu B.X., Fan R.F., Lin S.Q., Yang D.B., Wang Z.Y., Wang L. Interplay between autophagy and apoptosis in lead(II)-induced cytotoxicity of primary rat proximal tubular cells. J Inorg Biochem. 2018;182:184–193. doi: 10.1016/j.jinorgbio.2018.02.015. [DOI] [PubMed] [Google Scholar]
  • 64.Feng X., Chen L., Guo W., Zhang Y., Lai X., Shao L., et al. Graphene oxide induces p62/SQSTM-dependent apoptosis through the impairment of autophagic flux and lysosomal dysfunction in PC12 cells. Acta Biomater. 2018;81:278–292. doi: 10.1016/j.actbio.2018.09.057. [DOI] [PubMed] [Google Scholar]
  • 65.Zhu X.G.L.F.S., Tang X., Jiang J.J., Han Y., Li Y.N., Ma C.Y., et al. Neferine promotes the apoptosis of HNSCC through the accumulation of p62/SQSTM1 caused by autophagic flux inhibition. Int J Mol Med. 2021;48:1–12. doi: 10.3892/ijmm.2021.4957. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Shelton L.M., Park B.K., Copple I.M. Role of Nrf2 in protection against acute kidney injury. Kidney Int. 2013;84(6):1090–1095. doi: 10.1038/ki.2013.248. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary data 1
mmc1.pdf (127.9KB, pdf)
Supplementary data 2
mmc2.pdf (192.7KB, pdf)
Supplementary data 3
mmc3.pdf (258.7KB, pdf)
Supplementary data 4
mmc4.pdf (135.3KB, pdf)
Supplementary data 5
mmc5.pdf (109.6KB, pdf)
Supplementary data 6
mmc6.docx (15.6KB, docx)

Articles from Journal of Advanced Research are provided here courtesy of Elsevier

RESOURCES