FEBS Letters, 2022 Nov; 596 (18): 2441–2448.
The sequence of the reverse primer used for PCR mutagenesis in the experimental section is incorrect. The correct sequence is 5′‐CACATACAGTAGCGCGGCGGTCTTTTCGTTAATGGCGCTTTCCAGTTGCCAGCG‐3′.
. 2022 Oct 25;596(23):3103. doi: 10.1002/1873-3468.14517
Corrigendum: His‐163 is a stereospecific proton donor in the mechanism of d‐glucosaminate‐6‐phosphate ammonia‐lyase
Robert S Phillips
, Kaitlin L Anderson
, Declan Gresham
Robert S Phillips
Find articles by Robert S Phillips
Kaitlin L Anderson
Find articles by Kaitlin L Anderson
Declan Gresham
Find articles by Declan Gresham
Issue date 2022 Dec.
© 2022 Federation of European Biochemical Societies.
PMCID: PMC10117607 PMID: 36281965
This corrects the article "His‐163 is a stereospecific proton donor in the mechanism of d‐glucosaminate‐6‐phosphate ammonia‐lyase" on page 2441.