Abstract
Objectives:
This study aimed to determine the antibiotic-resistant profile and to identify molecular characterization of some virulence genes of Klebsiella spp. isolated from mastitis samples in Vietnam.
Materials and Method:
A total of 468 samples from clinical mastitis cases were collected and submitted to the Laboratory. All samples were cultured, and Klebsiella spp. was identified through biochemical reactions and confirmed by Polymerase chain reaction (PCR). Antimicrobial resistance was tested by disk diffusion method, and virulence and resistance genes were tested by PCR.
Results:
An antibiogram study showed that a high proportion of isolates are multidrug-resistant (94%). All isolates were resistant to lincomycin and sulfamethoxazole, followed by ampicillin (94%), sulphonamide (66%), amoxicillin (56%), streptomycin (52%), polymyxin B (28%), colistin sulfate (12%), tetracycline (6%), ciprofloxacin (4%), florfenicol (4%), enrofloxacin (4%), piperacillin (2%), trimethoprim (2%), nalidixic acid (2%), imipenem (2%), and sulfamethoxazole/trimethoprim (2%). In contrast, all isolates showed sensitivity to gentamicin and ceftiofur. The appearance of an efflux pump system, extended-spectrum beta-lactamase (ESBL), tetracycline, and sulphonamides-resistant genes was reconfirmed using different specific primers. Capsular serotype K1 and virulence genes magA, fimH, and entB, responsible for hypermucoviscosity production, adherence, and enterobactin production, were confirmed in isolates. Multidrug resistance and virulence potential in Klebsiella spp. are changing this mastitis pathogen into a superbug and making its management harder.
Conclusions:
Klebsiella spp. associated with bovine mastitis in Nghe An province were mostly multidrug-resistant and carried virulence genes including fimH, entB, and antimicrobials resistant genes (blaSHV, acrAKp, tetA, etc.), but these isolates were not ESBL producers.
Keywords: Antimicrobial resistance, Klebsiella spp., mastitis, multidrug-resistant, virulence factors
Introduction
Mastitis is a considerable and recurring economic loss in the dairy industry worldwide. It differs from other animal diseases because several kinds of bacteria can cause the disease; these pathogens colonize the udder, multiply, and produce harmful substances that result in inflammation, decreased milk production, and affected milk quality [1]. Mastitis is an important and economically significant disease in the dairy industry, and not less so in countries like Vietnam, where the dairy sector is still in a relatively early phase of development. Economic effects of this disease include decreased milk production from affected animals, changes in milk quality, discarded milk, veterinary costs, and replacement costs associated with the culling of chronically affected cows and mortality [2]. The average failure costs of mastitis per cow per year were $US131 in the US [3] and 662 Canadian dollar in Canada [1]; milk production dropped accounts for approximately 70% of the total cost of mastitis [4]. In a previous study, we reported that the prevalence of bovine mastitis in Vietnam was 2.9%, and the isolation result of Klebsiella was 21.0% (unpublished data).
Klebsiella is a genus of Gram-negative, oxidase-negative, rod-shaped bacteria with a prominent polysaccharide-based capsule [5]. Klebsiella species are found everywhere in nature. This pathogen can be found in water, soil, plants, insects, and other animals, including humans [6]. Clinical mastitis due to Klebsiella is often severe and does not respond well to antimicrobial treatment, resulting in a prolonged duration of intramammary infection and substantial loss of milk yield [7]. Many virulence factors may cause udder infection, and its severity includes capsular serotypes, iron-scavenging systems, and fimbriae have been reported to be involved in the virulence of Klebsiella pneumoniae of human origin [8]. Recently, a study about hypermucoviscous phenotype related to the adhesive and invasive ability of the bovine mammary epithelial cells [9], and potential virulence genes isolated from clinical mastitis on large dairy farms have been reported in China [10].
In Vietnam, there are few studies only on the prevalence of mastitis but not on any specific pathogens and their virulence factors. Therefore, studying the virulence factors of Klebsiella spp. isolated in Vietnam’s large dairy farms is important. The objectives of this study were (1) to determine the antibiotic-resistant profile and (2) to identify molecular characterization of some virulence genes of Klebsiella spp. isolated. The results of this study would be useful for farmers or veterinarians to consider and/or make decisions to minimize the loss during and after episodes of mastitis caused by Klebsiella spp.
Materials and Methods
Herds profile and samples
This study was conducted from several large dairy farms in Nghe An province, Vietnam, in 2022. The animal population consisted of Holstein-Friesian dairy cows from intensively managed, fully housed, and total mixed ration-fed, ranging in average size from 1.800 to 4.500 animals. A total of 468 samples were collected [under aseptic conditions (sterilized sample vials, clean udder(s), sampling, labeling, refrigeration post-collection, and transport to the lab in the icebox)], submitted, and cultured on the day of arrival.
Bacteria isolation and identification
A loopful of mastitis sample (10 μl) was the first culture onto blood agar (incubated at 37°C for 24–48 h); the sample was considered culture-positive if 1 or more colonies were observed (≥100 CFU/ml) [11], Gram-negative and rod shape checked by Gram stain and microscope then inoculated on MacConkey agar and Chromatic agar (Liofilchem) (incubate at 37°C for 24 h). A mucoid, light pink colony on MacConkey agar and a green-blue colony on Chromatic agar were selected for confirmation by biochemical tests. Biochemical tests for Klebsiella include indole production, citrate utilization, motility [12], other carbohydrate fermentation (glucose, sucrose, lactose), gas production, methyl red—Voges Proskauer, oxidase, and catalase also tested.
Antimicrobial susceptibility test
Antimicrobial susceptibilities were conducted by using the disc diffusion test (DDT) with the Mueller-Hinton agar (MHA) technique which is described in Clinical and Laboratory Standards Institute (CLSI) M100-30th [13]. The bacteria were spread over the surface of sterile MHA plates using sterile cotton swabs then antibiotics discs were placed over the surface of inoculated plates. Let’s plate dry on a vertical surface for 15 min and then incubate at 37°C for 16–24 h. The zone of inhibitions of each antibiotic was recorded in millimeters (mm), corresponding to the CLSI standard values of respective antibiotics. Multi-drug resistance (MDR) was defined as acquired non-susceptibility to at least one agent in three or more antimicrobial categories [14]. Antimicrobial agents used in this study were listed and described in Table 1.
Table 1. Antimicrobials used for this study.
| Antimicrobial | Abbreviation | Code | Concentration |
|---|---|---|---|
| Ceftiofur | EFT | EFT | 30 μg |
| Gentamicin | GEN | CN120 | 120 μg |
| Sulfamethoxazole/Trimethoprim | STX | SXT25 | 1.25/23.75 μg |
| Imipenem | IMI | IPM10 | 10 μg |
| Nalidixic acid | NAL | NA30 | 30 μg |
| Trimethoprim | TRI | W5 | 5 μg |
| Piperacillin | PIP | PRL100 | 100 μg |
| Enrofloxacin | ENR | ENR5 | 5 μg |
| Florfenicol | FLO | FFC30 | 30 μg |
| Ciprofloxacin | CIP | CIP5 | 5 μg |
| Tetracycline | TET | TE30 | 30 μg |
| Colistin sulfate | COL | CT10 | 10 μg |
| Polymyxin B | POL | PB300 | 300 ui |
| Streptomycin | STR | S10 | 10 μg |
| Amoxycillin | AMO | AML10 | 10 μg |
| Sulphonamide | SUL | S3 300 | 300 μg |
| Ampicillin | AMP | AMP10 | 10 μg |
| Sulfamethoxazole | SUX | RL25 | 25 μg |
| Lincomycin | LIN | MY15 | 15 μg |
Extended-spectrum beta-lactamase (ESBL) production
ESBL production tests followed CLSI M100-30th [13] using the disk-diffusion method with MHA. Two sets of antibiotics were ceftazidime 30 μg together with ceftazidime-clavulanate 30/10 μg and cefotaxime 30 μg together with cefotaxime-clavulanate 30/10 μg. The inoculum was prepared according to the standard disk diffusion procedure. The agar plate was then incubated at 35°C ± 2°C for 16–20 h. The result was interpreted as ESBL positive when the inhibition zone of either antimicrobial agent tested in combination with clavulanate was bigger than the zone diameter of the agent when tested alone over 5 mm, as shown in Table 2.
Table 2. Criteria to confirm ESBL production.
| Single antibiotic diameter zone | Combination diameter zone |
|---|---|
| Ceftazidime < 22 mm | Ceftazidime-clavulanate ≥ 27 mm |
| Cefotaxime < 27 mm | Cefotaxime-clavulanate ≥ 32 mm |
Deoxyribonucleic acid (DNA) extraction
DNA of each isolate was extracted using Chelex 100 Resin protocol [15]: colonies on the agar were collected and enriched in peptone water overnight, and the medium (1.5 ml) was then centrifuged in 800 × g, for 5 min at 4°C. Supernatant collected (500 μl) and then centrifuged at 13,000 × g, 5 min at 4°C, remove supernatant, then add 200 μl Chelex 100 (in TE buffer) and mix well. Incubate with shaking at 56°C, 30 min at 800 rpm, then vortex the vial for 10 sec and incubate again at 96°C, 8 min at 800 rpm. The vial was then mixed and centrifuged at 13,000 × g, 3 min at 4°C, taking 100 μl supernatant for PCR running. DNA extracted was stored in the Eppendorf tube and kept under −20°C until the PCR reaction was carried out.
Molecular confirmation of isolates
The Klebsiella isolates were first identified by biochemical reactions and then confirmed by using Klebsiella-specific gene gyrA (441 bp) [16]; the test followed the standard protocol [15]: Polymerase chain reaction (PCR) (20 μl) was prepared by mixing 10 μl master mix (MyTaq HS Red Mix), with 1 μl of each forward (F-CGC GTA CTA TAC GCC ATG AAC GTA) and reverse (R-ACC GTT GAT CAC TTC GGT CAG G) primers, 3 μl nuclease-free PCR water, and 5 μl DNA sample, 100–1,500 bp DNA ladder (PCRBIO Ladders IV) was used. The mixture was first run at 95°C for denaturing for 3 min and 35 cycles of 95°C for 15 sec, 62°C for 15 sec, and 72°C for 10 sec on a thermal cycler (Biometra Professional, Germany). DNA extracted from Klebsiella oxytoca American Type Culture Collection (ATCC) 49131 and Staphylococcus aureus ATCC 25923 were used as the positive and negative control, respectively. PCR products were then purified and identified by agar electrophoresis (Mupid-Exu) and transillumination (Major Science - MBE 200A).
Confirmation of drug-resistance genes in isolates
Klebsiella isolates were confirmed again some specific genes corresponding resistance to ESBL production by blaSHV, blaTEM, blaKPC, blaNDM, blaCTX-M-3 and blaIMP, to Sulphonamides by sul1, sul2, to Tetracycline by tetA, tetB, to Trimethoprim by DHFR-I and to Quinolone by qnrA. The reaction mixture was prepared, and the tests followed the protocol described earlier with primers, sequences, predicted sizes, and annealing temperatures described in Table 3.
Table 3. The primer sequence, target gene, and amplicon size of antibiotics resistance genes used in this study.
| Gene | Primer sequences (5’–3’) | Annealing temp | Size (bp) | Reference | |
|---|---|---|---|---|---|
| β-lactamases | |||||
| bla SHV | F | CTTTATCGGCCCTCACTCAA | 53 | 237 | [17] |
| R | AGGTGCTCATCATGGGAAAG | ||||
| bla TEM | F | CGCCGCATACACTATTCTCAGAATGA | 59 | 444 | [17] |
| R | ACGCTCACCGGCTCCAGATTTAT | ||||
| bla KPC | F | CGTCTAGTTCTGCTGTCTTG | 56 | 798 | [18] |
| R | CTTGTCATCCTTGTTAGGCG | ||||
| bla NDM | F | GGTTTGGCGATCTGGTTTTC | 56 | 621 | [18] |
| R | CGGAATGGCTCATCACGATC | ||||
| bla CTX-M-3 | F | AATCACTGCGTCAGTTCAC | 53 | 701 | [19] |
| R | TTTATCCCCCACAACCCAG | ||||
| bla IMP | F | GGAATAGAGTGGCTTAAYTCTC | 56 | 232 | [20] |
| R | GGTTTAAYAAAACAACCACC | ||||
| Sulfonamides | |||||
| sul1 | F | TTCGGCATTCTGAATCTCAC | 50 | 822 | [21] |
| R | ATGATCTAACCCTCGGTCTC | ||||
| sul2 | F | CGGCATCGTCAACATAACC | 54 | 722 | [19] |
| R | GTGTGCGGATGAAGTCAG | ||||
| Tetracycline | |||||
| tetA | F | GGTTCACTCGAACGACGTCA | 57 | 577 | [22] |
| R | CTGTCCGACAAGTTGCATGA | ||||
| tetB | F | CCTCAGCTTCTCAACGCGTG | 56 | 634 | [21] |
| R | GCACCTTGCTGATGACTCTT | ||||
| Trimethoprim | |||||
| DHFR-I | F | AAGAATGGAGTTATCGGGAATG | 56 | 391 | [19] |
| R | GGGTAAAAACTGGCCTAAAATTG | ||||
| Quinolone | |||||
| qnrA | F | ATTTCTCACGCCAGGATTTG | 54 | 516 | [23] |
| R | GATCGGCAAAGGTTAGGTCA | ||||
| Multidrug efflux pump | |||||
| acrAKp | F | ATTTCTCACGCCAGGATTTG | 55 | 940 | [24] |
| R | GATCGGCAAAGGTTAGGTCA | ||||
Detection of virulence factors
The virulence factors associated with Klebsiella spp. were determined by targeting specific gene fimH encoding for type 1 fimbriae, rmpA gene for the regulator of the mucoid phenotype A, magA for hypermucoviscosity production (mucoviscosity-associated gene A), K1 & K2 for encoding capsule serotype, iroN, entB, and iutA genes for encoding siderophore. The reaction mixture was prepared, and the tests followed the earlier protocol with primers, sequences, predicted sizes, and annealing temperatures described in Table 4.
Table 4. The primer sequence, target gene, and amplicon size of virulence genes used in this study.
| Gene | Primers sequences (5’–3’) | Annealing temp | Size (bp) | Reference | |
|---|---|---|---|---|---|
| fimH | F | ATGAACGCCTGGTCCTTTGC | 59 | 688 | [25] |
| R | GCTGAACGCCTATCCCCTGC | ||||
| rmpA | F | ACTGGGCTACCTCTGCTTCA | 55 | 516 | [26] |
| R | CTTGCATGAGCCATCTTTCA | ||||
| magA | F | GGTGCTCTTTACATCATTGC | 53 | 1283 | [26] |
| R | GCAATGGCCATTTGCGTTAG | ||||
| K1 | F | GTAGGTATTGCAAGCCATGC | 52 | 1046 | [26] |
| R | GCCCAGGTTAATGAATCCGT | ||||
| K2 | F | GACCCGATATTCATACTTGACAGAG | 52 | 641 | [26] |
| R | CCTGAAGTAAAATCGTAAATAGATGGC | ||||
| iroN | F | AAGTCAAAGCAGGGGTTGCCCG | 63 | 665 | [20] |
| R | GACGCCGACATTAAGACGCAG | ||||
| entB | F | ATTTCCTCAACTTCTGGGGC | 60 | 371 | [27] |
| R | AGCATCGGTGGCGGTGGTCA | ||||
| iutA | F | GGCTGGACATCATGGGAACTGG | 61 | 302 | [20] |
| R | CGTCGGGAACGGGTAGAATCG |
Statistics analysis
Spreadsheets were used as software tools for data entry, storage, analysis, and visualization in this study.
Results
The distribution of Klebsiella spp. in bovine mastitis in Nghe An province, Vietnam
From 468 samples submitted and tested during the study period, we followed the isolation protocols of the Laboratory and identified 103 Klebsiella strains by biochemical reactions. Because we did not investigate the prevalence and the sources of this pathogen in the farm (e.g., animals, water, bedding materials, milking equipment, etc.) but were interested in the virulence genes and antimicrobial resistance and its related genes. Thus, 50 isolates were randomly selected from 103 strains for further study and were confirmed as Klebsiella spp. by the support of PCR through the gyrA gene (Fig. 1). All isolates came from clinical mastitis cases from dairy farms in large-scale herds in Vietnam.
Figure 1. PCR reaction assay result for Klebsiella identification; ladder (L); positive control gyrA (441 bp) (P); positive samples (1–5, 6–8); negative control (N).
Antimicrobial resistance and ESBL producing of Klebsiella spp. isolated
All gyrA gene positives were then processed for antibiogram studies again, 19 common antibiotics (950 antibiograms) belong to 9 classes, and resistance levels varied between antibiotics (Fig. 2). All isolates were fully resistant to LIN and SUX, followed by AMP at 94% and SUL at 66%. Resistant to AMO, STR, and POL was 56%, 52%, and 28%, respectively. Resistance against Colistin (COL) was 12%, while TET was 6%; CIP, FLO, and ENR were at 4% each drug, followed by PIP, TRI, NAL, IMI, and SXT at 2% each. None of the isolates were resistant to GEN and EFT.
Figure 2. Drug resistance proportion of Klebsiella spp. isolates against antimicrobials used. Of 19 antibiotics used, we analyzed and demonstrated the results of MDR in Table 5.
One isolate was found to have no sensitivity to 10 different drugs, and none of these isolates were resistant to only 1 drug, most resistant to 5 (9/50) or 6 (14/50) drugs. The 50 isolates resistant to 2–10 different drugs were presented in 23 patterns (Table 5). All strains tested and three isolates give results of resistance to two antibiotic classes which take account of 6%, and MDR (resistance to ≥3 antimicrobial classes) was 94% (47/50) of the total isolates tested. ESBL producing was tested for all isolates; fortunately, all strains were confirmed, not ESBL producers.
Table 5. Antimicrobial resistance patterns of Klebsiella spp. isolates.
| Resistance pattern | Number of drugs | Number of antimicrobial classes | Number of isolates |
|---|---|---|---|
| AMP-SUX-ENR-FLO-SUL-CIP-AMO-LIN-NAL-STR | 10 | 6 | 1 |
| AMP-SUX-FLO-TET-SUL-STX-LIN-TRI | 8 | 5 | 1 |
| AMP-SUX-SUL-AMO-LIN-COL-POL-PSUX | 8 | 3 | 1 |
| AMP-SUX-SUL-AMO-LIN-COL-POL-STR | 8 | 4 | 2 |
| AMP-SUX-SUL-AMO-LIN-POL-STR | 7 | 4 | 4 |
| AMP-SUX-TET-SUL-AMO-LIN-STR | 7 | 5 | 2 |
| AMP-SUX-SUL-AMO-LIN-COL-POL | 7 | 3 | 1 |
| AMP-SUX-ENR-CIP-AMO-LIN | 6 | 4 | 1 |
| AMP-SUX-SUL-AMO-LIN-STR | 6 | 4 | 8 |
| AMP-SUX-SUL-IMI-LIN-STR | 6 | 5 | 1 |
| AMP-SUX-AMO-LIN-COL-STR | 6 | 4 | 1 |
| AMP-SUX-SUL-AMO-LIN-POL | 6 | 3 | 2 |
| AMP-SUX-SUL-LIN-COL-POL | 6 | 3 | 1 |
| AMP-SUX-SUL-AMO-LIN | 5 | 3 | 2 |
| AMP-SUX-AMO-LIN-POL | 5 | 3 | 1 |
| AMP-SUX-SUL-LIN-STR | 5 | 4 | 5 |
| AMP-SUX-SUL-LIN-POL | 5 | 3 | 1 |
| AMP-SUX-AMO-LIN | 4 | 3 | 2 |
| AMP-SUX-LIN-STR | 4 | 4 | 2 |
| AMP-SUX-SUL-LIN | 4 | 3 | 1 |
| AMP-SUX-LIN-POL | 4 | 3 | 1 |
| AMP-SUX-LIN | 3 | 3 | 6 |
| SUX-LIN | 2 | 2 | 3 |
| Total | 50 |
Detection of some antimicrobial resistance genes
The results of some antimicrobial resistance genes are summarized in Table 6 and Figure 3. All strains were tested for 13 different genes representatives for 5 types of antimicrobials. We found that 100% of isolates carried gene acrAKp, which might relate to the MDR found. Resistance towards Beta-lactam antibiotics was found with 94% of isolates carrying blaSHV, and 8% blaNDM, and no strains were found positive with blaTEM, blaKPC, blaCTX-M-3, and blaIMP. We found that the proportion of isolates that harbored sul1 and sul2 was 4% and 2%, respectively. Tetracycline-resistant encoded genes were found in 100% of isolates with tetA, but none carried tetB genes. qnrA gene encoding quinolone-resistant was not found in all Klebsiella spp. strains in this study. Analyzed gene patterns, we found 1 isolate with 5 genes (tetA- blaSHV - acrAKp -sul1-sul2), 1 isolate with the pattern (tetA- blaNDM - acrAKp -sul1), another isolate with (tetA- blaSHV - blaNDM - acrAKp), 45 isolates with 3 genes (tetA- blaSHV - acrAKp) and 2 isolates with (tetA- blaNDM - acrAKp) patterns.
Table 6. Percentage and number of resistance genes detected among Klebsiella spp. isolates.
| Virulence genes | Total isolates tested | Positive isolates | Positive proportion |
|---|---|---|---|
| acrA Kp | 50 | 50 | 100% |
| bla SHV | 50 | 47 | 94% |
| bla TEM | 50 | 0 | 0% |
| bla CTX-M-3 | 50 | 0 | 0% |
| bla KPC | 50 | 0 | 0% |
| bla NDM | 50 | 4 | 8% |
| bla IMP | 50 | 0 | 0% |
| sul1 | 50 | 2 | 4% |
| sul2 | 50 | 1 | 2% |
| tetA | 50 | 50 | 100% |
| tetB | 50 | 0 | 0% |
| DHFR-I | 50 | 0 | 0% |
| qnrA | 50 | 0 | 0% |
Figure 3. PCR result for tetA (1–4) 577 bp, acrAKp (5–8) 940 bp genes, H2O for negative control (H), ladder (L).
Detection of some virulence genes
Table 7 summarizes the results of virulence genes tested in this study. Fifty Klebsiella spp. isolates were investigated for some virulence genes; we found that 2 isolates harbored K1 (4%), all strains carried fimH (100%), and 49 Klebsiella spp. positive with entB (98%) genes. None of these isolates harbored K2, magA, rmpA, and iutA genes (Fig. 4).
Table 7. Percentage and number of virulence genes detected among Klebsiella spp. isolates.
| Virulence genes | Total isolates tested | Positive isolates | Positive proportion |
|---|---|---|---|
| K1 | 50 | 2 | 4% |
| K2 | 50 | 0 | 0% |
| magA | 50 | 0 | 0% |
| rmpA | 50 | 0 | 0% |
| fimH | 50 | 50 | 100% |
| entB | 50 | 49 | 98% |
| iutA | 50 | 0 | 0% |
Figure 4. PCR result for fimH (1–4) 688 bp (left), entB (1–4) 371 bp (right) genes, H2O for negative control (H), ladder (L).
Discussion
Our study revealed that Klebsiella spp. totally resistant to LIN and SUX, and AMP, resistant to LIN, was surprised as this antimicrobial has not been used by the farm, especially for treating mastitis cases; thus, a resistant gene related to this antimicrobial was not tested. Resistance to AMP was supported by similar studies in China [28] with 100% resistance, in Pakistan with 98% resistance to LIN, 86% AMP, and 99% SUX to mastitis pathogens [29]. Resistance toward AMP was used to predict the resistance to AMO [30]; thus, our AMO resistance was found to be high (56%) together with AMP, especially when compared with similar findings in China with 23.5% [31]. These drugs have been widely used in farms for a long time to deal with clinical mastitis, which may be why resistance to these antimicrobials is high. Fifty-two percent of isolates resistant to STR in the current study is higher in other countries like Canada with 38% [32], and China with 30.1% [28]. Like LIN, STR was never used by these farms before, but the resistance rate was still very high, even higher than in other countries close to Vietnam; it is potentially because this pathogen entered farms through bedding materials purchased and needs further studies to conclude. SUL was widely used in farms for treating mastitis, which might result from resistance to this drug up to 66%. This resistance was reported at 45.1% in China [33], which is quite lower than in our study. Resistance to TET was reported at 32% in China [34], 19% in Canada [32], and 41.5% in Brazil [6]. COL is a last resort antibiotic to treat infections caused by K. pneumoniae, and the resistance rate to this antibiotic has increased in recent years from 4.8% in 2013–2018 to 8.2% in 2019–2021 [35]; our resistance rate still higher, when compared to this finding and might come from the transmission between strains as this antimicrobial, was used for treatment calves with diarrhea. CIP, ENR, PIP, IMI, and STX were highly sensitive in our study, which could be a good choice for mastitis treatment, especially CIP, PIP, and IMI, as these drugs had never been used before at studied farms; this finding was supported by other studies in Brazil [6], in China [31]. We found that all isolates were sensitive to GEN and EFT; these drugs also be a good option for veterinarians to deal with mastitis cows. EFT was widely used in dairy farms as this drug generally results in a 0-h withdrawal time for the milk with a dose of 1 mg/kg body weight [36]. GEN was not commonly used for lactating animals and was banned in some countries, but not in Vietnam; thus, we recommended that farms consider this drug for treating diseases in calves only.
Our study revealed that 96% of isolates were MDR (Table 5). In same purpose studies in China [34,31,28] reported that 6.1% (4/66), 19.1%, and 43.9% Klebsiella spp. isolated from mastitis was MDR. Compared to these findings, our results are much higher, which indicates a quite high level and a possible association between antimicrobial resistance widespread among bacterial strains from animals and maybe from humans to animals and uncontrol antibiotic use.
The worldwide spread of K. pneumoniae producing extended-spectrum β-lactamase (ESBL-Kp) is a significant problem in human and veterinary medicine. Fortunately, all isolates in our study were not ESBL producers, similar to a report from Brazil 98.2% ESBL negative [6] and 98.8% in France [37]. This result indicated that Klebsiella spp. from dairy mastitis might not often be ESBL producers, and attention should be paid to β-lactams as it is an option for mastitis treatment.
It was revealed that there is a plasmid that carries a part of the acrAKp gene coding for a multidrug efflux pump (AcrAb) belonging to the resistance-nodulation-cell-division family [24]. Our results revealed that 100% of isolates carried gene acrAKp, which might relate to the MDR found. A study on the role of this gene revealed that AcrAB was involved in resistance to quinolones, other antimicrobial agents, and host antimicrobial peptides.
The development of resistance to β-lactam antibiotics is attributed to the production of β-lactamases coded by different genes, including blaSHV, blaTEM, blaNDM, blaCTX-M-3, [38]. The prevalence of blaSHV gene might explain the resistance to AMP and AMO in our study, as this gene often relates to the ability to hydrolyze penicillin and cephalosporins. A study in Iran reported that the proportion of blaCTX, blaSHV, and blaTEM genes were 62.5%, 42.5%, and 87.5%, respectively [39]. Another study in France revealed that none of the isolates carried a blaSHV gene, whereas the blaTEM-1 gene was detected in 2.2% (3/137) isolates [37]. On the other hand, a study in China claimed that 68.2% and 16.7% of K. pneumoniae strains harbored blaSHV and blaCTX-M, respectively [34]; these genes normally have broad hosts but are often found in E. coli and Klebsiella spp. [40]. Sulphonamides are widely used due to their low costs and resistance, primarily mediated by the sul1 and sul2 genes encoding dihydropteroate synthetase with a low affinity for sulphonamides [41]. Sulphonamide resistance in the current study varied depending on the antimicrobials (STX/SUX/SUL) used. A similar study in Pakistan reported that the proportion of sul1 was 39% and sul2 was 44% [42]; compared with this finding, our results were far lower, and resistance to sulphonamides may be less affected by these genes and need further investigation.
Resistance to tetracycline is governed by tet genes, which are involved in either the active efflux of the drug, ribosomal protection, or enzymatic drug modification. Among the various tet genes, tetA and tetB are reported in Gram-negative bacteria [43]. A similar study in China reported that 30.3% K. pneumoniae carried tetA gene [34], whereas a study in the Czech claimed that tetA prevalence of 5% and no tetB in the dairy farm [44]; compared to these results, our results were much higher in tetA and similar in tetB proportion. Although all isolates harbored tetA gene, the resistance to tetracycline in the current study was only 6%. It may be due to the other resistance mechanisms and need future studies. One of the three main mechanisms of quinolone resistance has been described as the acquisition of plasmid-mediated quinolone resistance genes leads to the protection of quinolone’s targets by qnr proteins [45]. A study in Egypt reported that out of fourteen Klebsiella spp. strains, two isolates carried qnrA gene, which accounted for 14.3% [46]. Connected to the resistant profile in the current study, the proportion of quinolone resistance was less than 4% and trimethoprim 2%, which may link to the lack of qnrA and DHFR-I genes.
The severity of infections caused by Klebsiella spp. will depend on many factors, including the virulence profile of each isolate. The polysaccharide capsule is one of the most important virulence factors [47], which is encoded by magA (mucoviscosity-associated gene A and specific to K1 capsule serotype), k2A (specific to K2 capsule serotype), and rmpA [20]. Additionally, siderophores which is the ability to procure iron for bacteria growth and survival, are encoded by the entB, iutA, iroN genes [48]. Type 1 fimbriae are thread-like protrusions on the bacterial cell surface, and the tip adhesive subunit is encoded by fimH [49].
Similar studies in China reported that the prevalence of fimH was 100% isolates, iroN 4.4%, rmpA 4.4% [31]; entB (78%), fimH1 (55%), kfu (31%), and mrkD (24%) were the prevalence of virulence genes among K. pneumoniae, whereas entB (50%), fimH1 (30%), and mrkD (22%) were prevalent in K. oxytoca [10], none of the isolates found K1, K2 but 100% isolate carried entB, 12% iutA, 94% fimH, and 3% rmpA [48]. Compared to these findings, our results look different in some virulence genes but similar in fimH and entB, which may be the main virulence factors of Klebsiella spp. from dairy animals in Vietnam and China. Significant differences in the frequency of antibiotic-resistant and virulence genes in different studies may be due to different sources of isolation in different regions, their methods of investigation and sensitivity, and the number and types of samples.
Conclusion
In conclusion, this is the first study to report the occurrence and molecular characterization of Klebsiella spp. from dairy animals, especially in Vietnam. Our study indicated that the infection of Klebsiella spp. associated with bovine mastitis are mostly multidrug-resistant, which increases the difficulties of treatment for mammary infections and is also a potential public health concern. Surprisingly, none of the isolates were ESBL producers, which was confirmed by the DDT test. This pathogen carried virulence genes, including adhesion (fimH), siderophore (entB), and antimicrobials resistant genes (blaSHV, acrAKp, tetA, etc.). Results from this study provided information about the distribution and characteristics of pathogenic Klebsiella spp.-infected bovine mastitis that could support dairy farmers/ owners and veterinarians to improve the usage and management of antimicrobial in mastitis treatment, especially with Klebsiella mastitis in large-scale herds.
Acknowledgments
The group of authors would like to express special thanks to the owners of dairy farms included in this study for their support and collaboration during the study period. Members of the laboratory department who supported samples tested in this study are also very much appreciated for their cooperation. The authors are thankful to the editors and anonymous reviewers for their constructive comments that help to improve the quality of this paper.
List of abbreviations
ATCC, American Type Culture Collection; CLSI, Clinical and Laboratory Standards Institute; DNA, Deoxyribonucleic acid; DDT, Disk diffusion test; ESBL, Extended-spectrum beta-lactamase; MDR, Multi-drug resistance; MHA, Mueller-Hinton agar; PCR, Polymerase chain reaction
Conflict of interest
The authors know no conflict of interest to declare.
Authors’ contributions
MTT, planning, conducting the research, data analyzing, and manuscript preparation. MDV, performing isolation, identification, and antimicrobial susceptibility tests. MPTB, performing PCR tests. TVL, detecting clinical mastitis cases, collecting samples, and supporting data analysis. DMV, revising the manuscript. BXD & LMTD planning the research and reviewing all the scientific content. All authors have approved the final manuscript.
References
- [1].Aghamohammadi M, Haine D, Kelton DF, Barkema HW, Hogeveen H, Keefe GP, et al. Herd-level mastitis-associated costs on Canadian dairy farms. Front Vet Sci. 2018;5:100. doi: 10.3389/fvets.2018.00100. https://doi.org/10.3389/fvets.2018.00100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [2].Seegers H, Fourichon C, Beaudeau F. Production effects related to mastitis and mastitis economics in dairy cattle herds. Vet Res. 2003;34(5):475–91. doi: 10.1051/vetres:2003027. https://doi.org/10.1051/vetres:2003027. [DOI] [PubMed] [Google Scholar]
- [3].Henk H, Wilma S, Christopher AW. Annual review of resource economics. 2019;11:289–312. https://doi.org/10.1146/annurev-resource-100518-093954. [Google Scholar]
- [4].Zhao X, Lacasse P. Mammary tissue damage during bovine mastitis: causes and control. J Anim Sci. 2008;86(13):57–65. doi: 10.2527/jas.2007-0302. https://doi.org/10.2527/jas.2007-0302. [DOI] [PubMed] [Google Scholar]
- [5].Ryan KJ, Ray CG., editors. 4th. McGraw Hill; New York, NY: 2004. Sherris medical microbiology; p. 370. [Google Scholar]
- [6].Nobrega DB, Calarga AP, Nascimento LC, Chande Vasconcelos CG, de Lima EM, Langoni H, et al. Molecular characterization of antimicrobial resistance in Klebsiella pneumoniae isolated from Brazilian dairy herds. J Dairy Sci. 2021;104(6):7210–24. doi: 10.3168/jds.2020-19569. https://doi.org/10.3168/jds.2020-19569. [DOI] [PubMed] [Google Scholar]
- [7].Schukken Y, Chuff M, Moroni P, Gurjar A, Santisteban C, Welcome F, et al. The “other” Gram-negative bacteria in mastitis: Klebsiella, Serratia, and more. Vet Clin North Am Food Anim Pract. 2012;28:239–56. doi: 10.1016/j.cvfa.2012.04.001. https://doi.org/10.1016/j.cvfa.2012.04.001. [DOI] [PubMed] [Google Scholar]
- [8].Holt KE, Wertheim H, Zadoks RN, Baker S, Whitehouse CA, Dance D, et al. Genomic analysis of diversity, population structure, virulence, and antimicrobial resistance in Klebsiella pneumoniae, an urgent threat to public health. Proc Natl Acad Sci USA. 2015;112:E3574–81. doi: 10.1073/pnas.1501049112. https://doi.org/10.1073/pnas.1501049112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [9].Cheng J, Zhang J, Han B, Herman WB, Eduardo RC, John PK, et al. Klebsiella pneumoniae isolated from bovine mastitis is cytopathogenic for bovine mammary epithelial cells. J Dairy Sci. 2020;103:3493–504. doi: 10.3168/jds.2019-17458. https://doi.org/10.3168/jds.2019-17458. [DOI] [PubMed] [Google Scholar]
- [10].Gao J, Li SM, Zhang J, Zhou YN, Xu SY, Barkema HW, et al. Prevalence of potential virulence genes in Klebsiella spp. isolated from cows with clinical mastitis on large Chinese dairy farms. Foodborne Pathog Dis. 2019;16:856–63. doi: 10.1089/fpd.2019.2657. https://doi.org/10.1089/fpd.2019.2657. [DOI] [PubMed] [Google Scholar]
- [11].Verbeke J, Piepers S, Supre K, Vliegher SD. Pathogen-specific incidence rate of clinical mastitis in Flemish dairy herds, severity, and association with herd hygiene. J Dairy Sci. 2014;97:6926–34. doi: 10.3168/jds.2014-8173. https://doi.org/10.3168/jds.2014-8173. [DOI] [PubMed] [Google Scholar]
- [12].Pamela A, Lawrence F, Sandra G, Bhushan MJ, Greg K, David K, et al. 3th. National Mastitis Council; Madison, WI: 2017. Laboratory handbook on Bovine mastitis; p. 147. [Google Scholar]
- [13].CLSI. CLSI; Wayne, PA: 2020. Performance standards for antimicrobials susceptibility testing M100—30th. [Google Scholar]
- [14].Magiorakos A-P, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012;18(3):268–81. doi: 10.1111/j.1469-0691.2011.03570.x. https://doi.org/10.1111/j.1469-0691.2011.03570.x. [DOI] [PubMed] [Google Scholar]
- [15].Singh UA, Kumari M, Iyengar S. Method for improving the quality of genomic DNA obtained from minute quantities of tissue and blood samples using Chelex 100 resin. Biolog Proced Online. 2018;20:12. doi: 10.1186/s12575-018-0077-6. https://doi.org/10.1186/s12575-018-0077-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [16].Brisse S, Verhoef J. Phylogenetic diversity of Klebsiella pneumoniae and Klebsiella oxytoca clinical isolates revealed by randomly amplified polymorphic DNA, gyrA and parC genes sequencing and automated ribotyping. Int J Syst Evolut Microbiol. 2001;51(3):915–24. doi: 10.1099/00207713-51-3-915. https://doi.org/10.1099/00207713-51-3-915. [DOI] [PubMed] [Google Scholar]
- [17].Fang H, Ataker F, Hedin G, Dornbusch K. Molecular epidemiology of extended-spectrum-lactamases among Escherichia coli isolates collected in a Swedish hospital and its associated health care facilities from 2001 to 2006. J Clin Microbiol. 2008;46:707–12. doi: 10.1128/JCM.01943-07. https://doi.org/10.1128/JCM.01943-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [18].Poirel L, Walsh TR, Cuvillier V, Nordmann P. Multiplex PCR for detection of acquired carbapenemase genes. Diag Microbiol Infect Dis. 2011;70:119–23. doi: 10.1016/j.diagmicrobio.2010.12.002. https://doi.org/10.1016/j.diagmicrobio.2010.12.002. [DOI] [PubMed] [Google Scholar]
- [19].Maynard C, Bekal S, Sanschagrin F, Levesque RC, Brousseau R, Masson L, et al. Heterogeneity among virulence and antimicrobial resistance gene profiles of extraintestinal Escherichia coli isolates of animal and human origin. J Clin Microbiol. 2004;42(12):5444–52. doi: 10.1128/JCM.42.12.5444-5452.2004. https://doi.org/10.1128/JCM.42.12.5444-5452.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [20].Candan ED, Aksöz N. Klebsiella pneumoniae: characteristics of carbapenem resistance and virulence factors. Acta Biochim Polonica. 2015;62(4):867–74. doi: 10.18388/abp.2015_1148. http://dx.doi.org/10.18388/abp.2015_1148. [DOI] [PubMed] [Google Scholar]
- [21].Momtaz H, Safarpoor Dehkordi F, Taktaz T, Rezvani A, Yarali S. Shiga toxin-producing Escherichia coli isolated from bovine mastitic milk: serogroups, virulence factors, and antibiotic resistance properties. Sci World J. 2012;2012:618709. doi: 10.1100/2012/618709. https://doi.org/10.1100/2012/618709. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [22].Abed AH, Menshawy AMS, Zeinhom MMA, Hossain D, Khalifa E, Wareth G, et al. Subclinical mastitis in selected bovine dairy herds in north upper Egypt: assessment of prevalence, causative bacterial pathogens, antimicrobial resistance and virulence-associated genes. Microorganisms. 2021;9:1175. doi: 10.3390/microorganisms9061175. https://doi.org/10.3390/microorganisms9061175. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [23].Robicsek A, Strahilevitz J, Sahm DF, Jacoby GA, Hooper DC. qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob Agents Chemother. 2006;50(8):2872–4. doi: 10.1128/AAC.01647-05. https://doi.org/10.1128/AAC.01647-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [24].Li DW, Onishi M, Kishino T, Matsuo T, Ogawa W, Kuroda T, et al. Properties and expression of a multidrug efflux pump AcrAB-KocC from Klebsiella pneumoniae. Biol Pharm Bull. 2008;31(4):577–82. doi: 10.1248/bpb.31.577. https://doi.org/10.1248/bpb.31.577. [DOI] [PubMed] [Google Scholar]
- [25].Fertas-Aissani RE, Messai Y, Alouache S, Bakour R. Virulence profiles and antibiotic susceptibility patterns of Klebsiella pneumoniae strains isolated from different clinical specimens. Pathologie Biologie. 2013;61(5):209–16. doi: 10.1016/j.patbio.2012.10.004. https://doi.org/10.1016/j.patbio.2012.10.004. [DOI] [PubMed] [Google Scholar]
- [26].Turton JF, Baklan H, Siu LK, Kaufmann ME, Pitt TL. Evaluation of a multiplex PCR for detection of serotypes K1, K2 and K5 in Klebsiella sp. and comparison of isolates within these serotypes. FEMS Microbiol Lett. 2008;284:247–52. doi: 10.1111/j.1574-6968.2008.01208.x. https://doi.org/10.1111/j.1574-6968.2008.01208.x. [DOI] [PubMed] [Google Scholar]
- [27].Fatima S, Liaqat F, Akbar A, Sahfee M, Samad A, Anwar M, et al. Virulent and multidrug-resistant Klebsiella pneumoniae from clinical samples in Balochistan. Int Wound J. 2020;18:510–8. doi: 10.1111/iwj.13550. https://doi.org/10.1111/iwj.13550. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [28].Wu X, Liu J, Feng J, Muhammad ABS, Feng Y, Guo R, et al. Epidemiology, environmental risks, virulence, and resistance determinants of Klebsiella pneumoniae from dairy cows in Hubei, China. Front Microbiol. 2022;13:858799. doi: 10.3389/fmicb.2022.858799. https://doi.org/10.3389/fmicb.2022.858799. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [29].Ali T, Kamran , Raziq A, Wazir I, Ullah R, Shah P, et al. Prevalence of mastitis pathogens and antimicrobial susceptibility of isolates from cattle and buffaloes in northwest of Pakistan. Front Vet Sci. 2021;8:746755. doi: 10.3389/fvets.2021.746755. https://doi.org/10.3389/fvets.2021.746755. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [30].Humphries RM, Ambler J, Mitchell SL, Castanheira M, Dingle T, Hindler JA, et al. CLSI methods development and standardization working group of the subcommittee on antimicrobial susceptibility testing. CLSI methods development and standardization working group best practices for evaluation of antimicrobial susceptibility tests. J Clin Microbiol. 2018;56(4):e01934–17. doi: 10.1128/JCM.01934-17. https://doi.org/10.1128/JCM.01934-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [31].Tianle X, Xinyue W, Hainan C, Tianxu P, Yu Z, Yi Y, Zhangping Y. The Characteristics of multilocus sequence typing, virulence genes and drug resistance of Klebsiella pneumoniae isolated from cattle in northern Jiangsu, China. Animals. 2022;12:2627. doi: 10.3390/ani12192627. https://doi.org/10.3390/ani12192627. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [32].Massé J, Dufour S, Archambault M. Characterization of Klebsiella isolates obtained from clinical mastitis cases in dairy cattle. J Dairy Sci. 2019;103:3392–400. doi: 10.3168/jds.2019-17324. https://doi.org/10.3168/jds.2019-17324. [DOI] [PubMed] [Google Scholar]
- [33].Liu K, Zhang L, Gu X, Qu W. The Prevalence of Klebsiella spp. associated with bovine mastitis in China and its antimicrobial resistance rate: a meta-analysis. Front Vet Sci. 2022;9:757504. doi: 10.3389/fvets.2022.757504. https://doi.org/10.3389/fvets.2022.757504. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [34].Yang Y, Peng Y, Jiang J, Gong Z, Zhu H, Wang K, et al. Isolation and characterization of multidrug-resistant Klebsiella pneumoniae from raw cow milk in Jiangsu and Shandong provinces, China. Transbound Emerg Dis. 2021;68(3):1033–9. doi: 10.1111/tbed.13787. https://doi.org/10.1111/tbed.13787. [DOI] [PubMed] [Google Scholar]
- [35].Narimisa N, Goodarzi F, Bavari S. Prevalence of colistin resistance of Klebsiella pneumoniae isolates in Iran: A systematic review and meta-analysis. Ann Clin Microbiol Antimicrob. 2022;21(1):29. doi: 10.1186/s12941-022-00520-8. https://doi.org/10.1186/s12941-022-00520-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [36].Durel L, Gallina G, Pellet T. Assessment of ceftiofur residues in cow milk using commercial screening test kits. Vet Rec Open. 2019;6(1):e000329. doi: 10.1136/vetreco-2018-000329. https://doi.org/10.1136/vetreco-2018-000329. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [37].Dahmen S, Métayer V, Gay E, Madec JY, Haenni M. Characterization of extended-spectrum beta-lactamase (ESBL)-carrying plasmids and clones of Enterobacteriaceae causing cattle mastitis in France. Vet Microbiol. 2013;162:793–9. doi: 10.1016/j.vetmic.2012.10.015. https://doi.org/10.1016/j.vetmic.2012.10.015. [DOI] [PubMed] [Google Scholar]
- [38].Pfeifer Y, Cullik A, Witte W. Resistance to cephalosporins and carbapenems in Gram-negative bacterial pathogens. Int J Med Microbiol. 2010;300(6):371–9. doi: 10.1016/j.ijmm.2010.04.005. https://doi.org/10.1016/j.ijmm.2010.04.005. [DOI] [PubMed] [Google Scholar]
- [39].Enferad , E. , Mahdavi S. Antibiotic resistance pattern and frequency of some beta lactamase genes in Klebsiella pneumoniae isolated from raw milk samples in Iran. J Hellenic Vet Med Soc. 2021;71:2455. https://doi.org/10.12681/jhvms.25925. [Google Scholar]
- [40].Bajpai T, Pandey M, Varma M, Bhatambare GS. Prevalence of TEM, SHV, and CTX-M beta-lactamase genes in the urinary isolates of a tertiary care hospital. Avicenna J Med. 2017;7(1):12. doi: 10.4103/2231-0770.197508. https://doi.org/10.4103/2231-0770.197508. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [41].Skold O. Sulfonamide resistance: mechanisms and trends. Drug Resist Updat. 2000;3:155–60. doi: 10.1054/drup.2000.0146. https://doi.org/10.1054/drup.2000.0146. [DOI] [PubMed] [Google Scholar]
- [42].Aslam B, Chaudhry TH, Arshad MI, Muzammil S, Siddique AB, Yasmeen N, et al. Distribution and genetic diversity of multi-drug-resistant Klebsiella pneumoniae at the human–animal–environment interface in Pakistan. Front Microbiol. 2022;13:898248. doi: 10.3389/fmicb.2022.898248. https://doi.org/10.3389/fmicb.2022.898248. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [43].Jones CH, Tuckman M, Murphy E, Bradford PA. Identification and sequence of a tet(M) tetracycline resistance determinant homologue in clinical isolates of Escherichia coli. J Bacteriol. 2006;188:7151–64. doi: 10.1128/JB.00705-06. https://doi.org/10.1128/JB.00705-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [44].Kyselková M, Jirout J, Vrchotová N, Schmitt H, Elhottová D. Spread of tetracycline resistance genes at a conventional dairy farm. Front Microbiol. 2015;6:536. doi: 10.3389/fmicb.2015.00536. https://doi.org/10.3389/fmicb.2015.00536. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [45].Salah FD, Soubeiga ST, Ouattara AK, Sadji AY, Metuor-Dabire A, Obiri-Yeboah D, et al. Distribution of quinolone resistance gene (qnr) in ESBL-producing Escherichia coli and Klebsiella spp. in Lomé, Togo. Antimicrob Resist Infect Control. 2019;8:104. doi: 10.1186/s13756-019-0552-0. https://doi.org/10.1186/s13756-019-0552-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [46].Ahmed AM, Shimamoto T. Molecular characterization of antimicrobial resistance in Gram-negative bacteria isolated from bovine mastitis in Egypt. Microbiol Immunol. 2011;55(5):318–27. doi: 10.1111/j.1348-0421.2011.00323.x. https://doi.org/10.1111/j.1348-0421.2011.00323.x. [DOI] [PubMed] [Google Scholar]
- [47].Ko KS. The contribution of capsule polysaccharide genes to virulence of Klebsiella pneumoniae. Virulence. 2017;8(5):485–6. doi: 10.1080/21505594.2016.1240862. https://doi.org/10.1080/21505594.2016.1240862. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [48].Cheng J, Man Z, Diego BN, Cao Z, Yang J, Zhu C, et al. Virulence profiles of Klebsiella pneumoniae isolated from 2 large dairy farms in China. J Dairy Sci. 2021;104(8):9027–36. doi: 10.3168/jds.2020-20042. https://doi.org/10.3168/jds.2020-20042. [DOI] [PubMed] [Google Scholar]
- [49].Struve C, Bojer M, Krogfelt KA. Characterization of Klebsiella pneumoniae type 1 fimbriae by detection of phase variation during colonization and infection and impact on virulence. Infect Immun. 2008;76(9):4055–65. doi: 10.1128/IAI.00494-08. https://doi.org/10.1128/IAI.00494-08. [DOI] [PMC free article] [PubMed] [Google Scholar]