Emerging Invasive Group A Streptococcus M1_UK Lineage Detected by Allele-Specific PCR, England, 2020

Abstract

Increasing reports of invasive Streptococcus pyogenes infections mandate surveillance for toxigenic lineage M1_UK. An allele-specific PCR was developed to distinguish M1_UK from other emm1 strains. The M1_UK lineage represented 91% of invasive emm1 isolates in England in 2020. Allele-specific PCR will permit surveillance for M1_UK without need for genome sequencing.

Upsurges in invasive group A Streptococcus (GAS) infections have been widely reported in England and elsewhere (1), emphasizing the need to examine the relationship between circulating S. pyogenes that cause pharyngitis and scarlet fever and cases of invasive disease. Although many factors, such as exposure history, underlying conditions, viral co-infection, and genetic susceptibility, might increase susceptibility to S. pyogenes infection, strain-specific virulence might also be crucial.

In England, where both scarlet fever and invasive S. pyogenes infections are notifiable, pronounced upsurges in scarlet fever were recorded over an 8-year period (2,3), but subsided during the COVID-19 pandemic. During the 2015–16 season, a notable increase in invasive infections was observed that had not been evident previously (4). Both scarlet fever and invasive infections were associated with the emergence of M1_UK, a new sublineage of emm1 S. pyogenes (4) that appeared to outcompete the highly successful, contemporary epidemic emm1 M1_global strain, which emerged and spread globally during the 1980s (5,6). Despite an unchanged phage repertoire, M1_UK strains produce more superantigenic scarlet fever toxin SpeA (streptococcal pyrogenic exotoxin A) than contemporary M1_global S. pyogenes strains (4).

emm1 S. pyogenes strains are highly virulent (5) and disproportionately associated with invasive infections; any increase in the prevalence of emm1 strains in persons with pharyngitis or scarlet fever is, therefore, a public health concern. Known distribution of M1_UK is largely limited to those countries undertaking and reporting genome sequencing (Figure 1). M1_UK has been identified in other countries in Europe, from a single isolate in Denmark (4) to dominant status in the Netherlands (7). The lineage has also been reported in North America; the Public Health Agency of Canada reported that 17/178 (10%) of emm1 isolates from 2016 were M1_UK (8). This finding contrasts with a reported M1_UK frequency of just 0%–2.8% of emm1 isolates in the United States, according to the Active Bacterial Core surveillance system of the US Centers for Disease Control and Prevention; however, the low US frequency was associated with severe infections (9). Of note, most reports used genomic data that were >5 years old, so a reappraisal of prevalence is needed. A recent study in Australia using data through 2020 indicated expansion of M1_UK in Queensland and Victoria (10). The authors identified acquisition of an additional phage encoding superantigen genes ssa and spec and a single-nucleotide polymorphism (SNP) implicated in SpeA upregulation in the M1_UK lineage. Multicountry increases in GAS infections (1) since pandemic restrictions were lifted underscore the importance of increasing global surveillance of lineages that have potentially enhanced fitness, such as M1_UK.

Figure 1.

Countries and US states with reported M1_UK Streptococcus pyogenes cases. Map created by using MapChart (https://www.mapchart.net) as part of a study of emerging invasive group A Streptococcus M1_UK lineage detected by allele-specific PCR, England, 2020.

The Study

Genetic distinction between M1_UK and M1_global strains is possible by using whole-genome sequencing to detect the 27 SNPs that characterize the M1_UK lineage (4), but sequencing technology is not available in all countries. We designed an allele-specific PCR (AS-PCR) method to detect M1_UK-specific SNPs in the rofA, gldA, and pstB genes. We chose amplification targets to separate M1_UK and M1_global strains but also to identify strains from less common intermediate sublineages that had only 13 or 23 of the 27 M1_UK-specific SNPs (4). We optimized PCR conditions for each pair of amplicons by using DNA from control strains for each lineage (Table; Appendix Figure). Collecting bacterial samples from patients was part of routine clinical care; collecting surplus samples after anonymizing patient information was approved by the West London National Research Ethics Committee (approval no. 06/Q0406/20).

Table. PCR primers and conditions used to differentiate M1_global and M1_UK Streptococcus pyogenes lineages in study of emerging invasive group A Streptococcus M1_UK lineage detected by allele-specific PCR, England, 2020*.

Target gene	Primer type†	Sequences‡	PCR cycle conditions	Product, bp
rofA	WT sequence	TGTTAATTGCTTGGTTAAATCA	30 cycles of 95°C for 3 min, 45 s; 59.2°C for 30 s; 72°C for 1 min (final cycle: 5 min)	278
	Forward-SNP	5′-TGTTAATTGCTTGGTTAAAGtA-'3
	Forward-WT	5′-TGTTAATTGCTTGGTTAAAGCA-'3
	Reverse	5′-GCTCATCTCCTAACGGATTCTT-'3
gldA	WT sequence	AGATGGGTTAGCAACATGG	30 cycles of 95°C for 3 min, 45 s; 61.8°C for 30 s;72°C for 1 min (final cycle: 5 min)	292
	Forward-SNP	5′-AGATGGGTTAGCAACAAaG-'3
	Forward-WT	5′-AGATGGGTTAGCAACAAGG-'3
	Reverse	5′-GAATAGCACCTGTCAGCG-'3
pstB	WT sequence	GATAAATCAATCTTAGACCA	30 cycles of 95°C for 3 min, 45 s; 50°C for 30 s; 72°C for 1 min (final cycle: 5 min)	287
	Forward-SNP	5′-GATAAATCAATCTTAGATaA-'3
	Forward-WT	5′-GATAAATCAATCTTAGATCA-'3
	Reverse	5′-CGTGAGGCTTGCTGCATTGAG-'3

*SNP, single-nucleotide polymorphism; WT, wild-type. †Forward primers were designed to detect either the targeted SNP (M1_UK) or WT (M1_global) sequences. ‡Lowercase bold letters in primer sequences denote the base complementary to the targeted SNP in the M1_UK sequence. Underlined uppercase letters indicate an additional mismatched base introduced into primer sequences to increase primer specificity.

To evaluate allele-specific PCR, we tested whether the rofA and pstB primers correctly identified lineages of 27 newly genome-sequenced noninvasive emm1 S. pyogenes strains isolated during 2017–18 and collected by the infection bioresource at Imperial College. We artificially enriched the isolates for M1_global strains to ensure adequate numbers of each lineage: 8/27 isolates were M1_global, and 19/27 were M1_UK. PCR amplification of rofA and pstB alleles from those isolates assigned 100% of strains to the correct lineage previously identified by sequencing (Appendix Table 1).

To evaluate the ability of AS-PCR to identify emm1 isolates from M1_global, M1_UK, and intermediate sublineages (4), we tested 16 strains from 2013–2016 that comprised 4 isolates each of M1_global, M1_13snps, M1_23snps, and M1_UK lineages (Appendix Table 2). SNPs were correctly detected in the rofA gene from all M1_13snps, M1_23snps, and M1_UK isolates (Appendix Table 3). SNPs were also correctly detected in gldA from all M1_23snps and M1_UK isolates but not M1_global or M1_13snps isolates_. Finally, SNPs in pstB were only identified in M1_UK isolates_. Thus, in all cases, SNP profiles determined by AS-PCR were consistent with strain-specific genome sequences.

In England, submission of all isolates from invasive infection is requested by the UK Health Security Agency reference laboratory for emm genotyping. emm1 isolates are routinely the dominant genotype among invasive sterile-site isolates, typically representing 20%–30% of invasive infections. During 2020, when incidence of common respiratory infections was reduced by COVID-19–related public health interventions, emm1 S. pyogenes frequency varied each month from 0%–24% of all invasive infections and decreased toward the end of the year. We subjected all 305 invasive emm1 S. pyogenes isolates from 2020 that were available for this study to AS-PCR (Appendix Table 4). AS-PCR identified M1_UK-specific SNPs in rofA, gldA, and pstB in 278/305 (91.1%) of isolates, which were, therefore, assigned to the M1_UK lineage. No SNPs were detected in the remaining 27 isolates, which were assigned to M1_global; no intermediate lineage emm1 strains were identified in isolates collected during 2020 by using AS-PCR.

We performed Western blot analysis of 10 M1_UK isolates identified by AS-PCR. We confirmed that SpeA production was similar to M1_UK strains tested previously; however, we did not quantify SpeA production.

Conclusions

The longevity of emergent S. pyogenes lineages in a population is difficult to predict. Although an emm89_emergent acapsular lineage has disseminated globally (11), an emergent emm3 SpeC-producing lineage, associated with upsurges in scarlet fever and invasive infections, ceased to be detectable within a few years (12). Taken together with previously reported genome-sequenced emm1 isolates (Figure 2), AS-PCR results indicated that the M1_UK lineage continued to expand among invasive S. pyogenes isolates from 2016 to the end of 2020 in England.

Figure 2.

Prevalence of M1_UK and M1_global Streptococcus pyogenes lineages over time in study of emerging invasive group A Streptococcus M1_UK lineage detected by allele-specific PCR, England, 2020. We determined percentages of emm1 isolates in England that belonged to M1_UK or M1_global lineages by using all available emm1 S. pyogenes genome sequences for 2007–2016 (4) and all available invasive isolates from 2020 that we tested by allele-specific PCR. Numbers on graph indicate number of isolates assigned as M1_UK/total number sequenced for each year. Graph was adapted and updated from data previously described (4).

Increased invasive GAS activity in several countries (1) indicates a need for ongoing surveillance of novel lineages, given the potential public health effects. AS-PCR provides a readily available method to detect M1_UK that is straightforward and, for screening purposes only, can be simplified by using only rofA primers to identify M1_UK or associated sublineages. A limitation of our study is that the assay requires validation in reference laboratory settings. AS-PCR does not replace genome sequencing as the preferred method for surveillance of highly pathogenic bacteria, but sequencing is not widely available and is expensive.

emm1 strains have accounted for >50% of invasive infections in children in England during the 2022–23 season (13). Our results indicate that the M1_UK lineage remained dominant in England and expanded to the end of 2020, and contact tracing in 2018 demonstrated a high frequency of secondary acquisition of M1_UK in school outbreak settings (14). Given the recognized association between emm1 S. pyogenes and fatal outcome of invasive infections (15), enhanced surveillance for the M1_UK sublineage is warranted. We conclude that AS-PCR is a readily available method to determine whether emm1 S. pyogenes isolates belong to the M1_UK clade without need for genome sequencing and will improve surveillance of invasive GAS strains.

Appendix

Additional information for emerging invasive group A Streptococcus M1_UK lineage detected by allele-specific PCR, England, 2020.

Biography

Dr. Zhi is a postdoctoral research associate at Imperial College London. Her research focuses on pathogenesis and vaccine prevention of Streptococcus pyogenes disease.