Borrelia miyamotoi Infection in Immunocompromised Man, California, USA, 2021

Abstract

Infection with Borrelia miyamotoi in California, USA, has been suggested by serologic studies. We diagnosed B. miyamotoi infection in an immunocompromised man in California. Diagnosis was aided by plasma microbial cell–free DNA sequencing. We conclude that the infection was acquired in California.

Borrelia miyamotoi is a relapsing fever spirochete; infection is recognized in Europe, Japan, and the northeastern United States as an emerging human infectious disease (1,2). First identified in Japan in 1995 in Ixodes persulcatus ticks, B. miyamotoi has since been detected in other species of Ixodes ticks, including I. ricinus in Europe, I. scapularis in eastern North America, and I. pacificus in western North America (1). In California, USA, I. pacificus ticks can harbor 2 spirochetes capable of causing human disease: B. miyamotoi and Borrelia burgdorferi, the agent that causes Lyme disease (3). Prevalence of B. miyamotoi in I. pacificus ticks in California is estimated to be 0.8% in adult ticks and 1.4% in nymphal ticks, similar to other parts of the world that have Ixodes spp. ticks and reported human cases of B. miyamotoi infection (1).

In California, tick-borne relapsing fever is usually ascribed to infection with B. hermsii, transmitted by soft ticks (Ornithodoros hermsi), found in high-elevation habitats (4). Although infection with B. miyamotoi in California has been suggested by serologic studies, clinical human cases of B. miyamotoi infection acquired in the western United States have not been reported in the literature (1,3,4). We describe B. miyamotoi infection, confirmed through plasma microbial cell–free DNA (mcfDNA) sequencing, in a California man with relapsing fevers. Our investigation was determined to be exempt from human subjects research by the Office of Human Research Protections of the California Health and Human Services Agency (Federalwide Assurance no. 00000681).

The Case

In December 2021, an adult man receiving ocrelizumab (anti-B lymphocyte CD20 monoclonal antibody) for multiple sclerosis diagnosed in 2018 sought care at a neurology clinic in San Francisco, California, USA. The patient reported having experienced new fevers up to 38.7°C beginning in October 2021. The febrile episodes typically lasted 1 day, occurred every 10–14 days, and were associated with night sweats, mild vision changes, and nausea. Results of a physical examination were unremarkable, and the patient was sent home with a recommendation to return for evaluation if fever recurred.

Given continued intermittent fevers, the neurologist referred the patient to a local hospital in Greenbrae, California, USA, 3 days later for an expedited evaluation. Although the patient was again afebrile and results of physical examination were unremarkable, laboratory results were notable for thrombocytopenia (96,000 cell/mL [reference range 150,000–400,000 cells/mL]), elevated C-reactive protein level (47.2 mg/L [reference <5.0 mg/L]), and elevated procalcitonin level (1.89 ng/mL [reference <0.10 ng/mL]). No abnormalities were noted on chest radiographs or computed tomography scans of the abdomen and pelvis. Peripheral blood cultures were without growth, and the patient was discharged to home with a referral to the infectious disease clinic in San Francisco. At that clinic, serologic evaluation for certain bacteria, fungi, and viruses was notable only for positive Epstein-Barr viral capsid and nuclear antigen IgG. Serologic test results for Borrelia burgdorferi, brucellosis, and leptospirosis were negative, and results of a peripheral blood smear were unremarkable (Table 1).

Table 1. Laboratory test results for patient with Borrelia miyamotoi Infection, California, USA, 2021* .

Blood test (reference values)	Dec 2021	May 2022
Leukocytes (4.0–11.0 k/uL)	5.1	4.8
Hemoglobin (13.5–18.0 g/dL)	13.3 (low)	15.2
Hematocrit (40.0%–52.0%)	38.5% (low)	43.4%
Thrombocytes (150–400 l/uL)	96,000 (low)	224,000
Sodium (136–145 mmol/L)	134 (low)	137
Creatinine (0.70–1.30 mg/dL)	0.82	0.98
Albumin (2.8–4.7 g/dL)	3.6	4.7
Aspartate transaminase (<40 U/L)	45 (high)	41 (high)
Alanine transaminase (<65 U/L)	46	46
Alkaline phosphatase (<38 U/L)	81	60
Total bilirubin (<1.0 mg/dL)	1.0	0.8
C-reactive protein (<5.0 mg/L)	47.2 (high)	0.2
Procalcitonin (<0.10 ng/mL)	1.89 (high)	<0.10
COVID-19/influenza/RSV PCR	Not detected	ND
Peripheral blood cultures (2 cultures in Dec 2022)	No growth at 5 days	ND
Hepatitis B surface Ab (>10 mIU/mL)	113	ND
Hepatitis B surface Ag	Nonreactive	ND
Hepatitis B core Ab	Nonreactive	ND
Hepatitis C Ab	Nonreactive	ND
EBV VCA IgM (<36 U/mL)	<36 U/mL	ND
EBV VCA IgG Ab (<18 U/mL)	248 (high)	ND
EBV EBNA IgG (<18 U/mL	255 (high)	ND
CMV IgM (<30 AU/mL)	<30	ND
CMV IgG (<0.6 U/mL)	<0.6	ND
Cryptococcus Ag	Not detected	ND
Coccidioides Ab, CF (<1:2)	<1:2	ND
Coccidioides Ab, ID	Negative	ND
Histoplasma Ab, CF (<1:8)	<1:8	ND
Histoplasma, ID	Negative	ND
Histoplasma Ag, urine (<0.2 ng/mL)	<0.2	ND
Blastomyces Ab, ID	Negative	ND
Bartonella Ab	Negative	ND
Coxiella burnetti Ab IgM and IgG	Negative	ND
Rickettsia Ab panel	Negative	ND
Syphilis (Treponema) screen by RPR (nonreactive)	Nonreactive	ND
Quantiferon-TB Gold Plus	Negative	ND

*Additional testing: February 2022, Borrelia burgdorferi, Brucella, and Leptospira Ab results all negative; March 2022, β-d-glucan (reference value <60 pg/mL), <31 pg/mL; galactomannan Ag (reference value <0.5), 0.018; Coccidioides Ag, serum, negative; sequencing of microbial cell–free DNA in plasma performed at Karius, Inc. (https://kariusdx.com) (reference value <10 DNA MPM), Borrelia miyamotoi 56 DNA MPM; relapsing fever PCR performed at CDC, Borrelia PCR positive group B. miyamotoi .Ab, antibody; Ag, antigen; CDC, Centers for Disease Control and Prevention; CF, complement fixation; CMV, cytomegalovirus; EBV, Epstein-Barr virus; EBNA, Epstein-Barr nuclear Ag; ID, immunodiffusion; MPM, molecules/mL; RPR, rapid plasma reagin; RSV, respiratory syncytial virus; VCA, viral capsid antigen.

Given the patient’s immunocompromised status and relapsing fever history, suspicion for infection remained high and plasma mcfDNA sequencing (Karius test, https://kariusdx.com) was ordered. Results were positive for B. miyamotoi (56 DNA molecules/μL [reference <10 molecules/μL]). The Centers for Disease Control and Prevention performed confirmatory Borrelia PCR testing, results of which were also positive for B. miyamotoi (5), and multilocus sequence typing (MLST), which indicated that the sequence was 100% identical in >6,040 nucleotides to a B. miyamotoi isolate from an I. pacificus tick collected in Marin County, California (Table 2) (6,7). The sequence was distinct from B. miyamotoi isolates from other geographic regions, displaying 99.3% identity (44 nt differences) to isolates from the eastern United States.

Table 2. Primers used to amplify genes for multilocus sequencing of Borrelia miyamotoi that infected immunocompromised man in California, 2021*.

Gene	Forward primer, 3′ → 5′	Reverse primer, 5′ → 3′
clpA	TTGATCTCTTAGATGATCTTGG	CAAACATAAACCTTTTCAGCCTTTAATA
clpX	TTATCTGTTGCTGTTTATAATC	TTCAAACATAACATCTTTAAGTAATTCTTC
nifS	GAAAAAGTAAACTCCCTCAGAARGG	CAATGATGCCTGCAATATTTGGTG
pepX	AGAGACTTAAATTTAGCAGGAGTTG	TGCATTCCCCACATTGGAGTTC
pyrG	TTTAGTAATTGAGATTGGTGGTAC	TATTCCACAAACATTACGAGC
recG	TAGCATTCCTTTAGTTGAGGC	CTCAGCATGCTCAACTACC
rplB	AACTTATAGGCCAAAAACTTC	GATACAGGATGACGACCACC
uvrA	TTAAATTTTTAATTGATGTTGGACT	TCTGTAAAAAACCCAACATAAGTTGC

*Genes derived from (6), with modifications to the nifS and rplB forward primers to make them more specific for B. miyamotoi.

After B. miyamotoi infection was diagnosed, a 4-week course of doxycycline was prescribed. The patient reported having 1 additional febrile episode (38.9°C) after the first dose, but fevers subsequently resolved, and all other signs/symptoms improved. After consultation with the patient’s neurologist, cerebrospinal fluid testing was not performed, given resolution of visual symptoms and absence of other focal neurologic deficits. The patient returned to the clinic 1 month after having completed the course of doxycycline without any fever recurrence; laboratory testing showed resolution of thrombocytopenia and normalization of inflammatory markers. Ocrelizumab infusions were resumed after B. miyamotoi treatment, and symptom recurrence has not been reported.

The patient was a resident of Marin County, California, and reported having traveled 2 months before fever onset to Ohio and within California to Mendocino and Monterey Counties but reported no travel outside the United States for the previous 2 years. He reported hiking and swimming in freshwater lakes while traveling and near home but did not recall any insect or tick bites. He reported often spending time outdoors near home. He owned 2 domestic indoor cats not receiving regular tick prevention and reported no other animal exposures.

The California Department of Public Health Vector-Borne Disease Section collaborated with Marin-Sonoma Vector Control Agency to collect and test ticks from areas around the patient’s residence. The habitat consisted of coastal redwood grove and understory grass and shrub vegetation. Questing ticks were collected by dragging a 1-m² white flannel cloth along the ground cover. A total of 19 I. pacificus ticks (12 adults, 7 nymphs) from the patient’s yard and nearby trails were collected and stored in 70% ethanol until DNA extraction. PCR testing did not identify any ticks positive for B. miyamotoi infection but identified 1 adult tick infected with B. burgdorferi sensu lato (8).

Conclusions

Although B. miyamotoi has been identified in ticks in California for >20 years, locally acquired human cases within the western United States have not been described (1). Our environmental investigation identified multiple I. pacificus ticks near this patient’s residence and recreation areas in California, all in locations where B. miyamotoi has been documented in I. pacificus ticks (1). The B. miyamotoi sequence recovered from the patient was most closely related to an isolate recovered from an I. pacificus tick in California (7). Of note, the patient’s travel to Ohio was during August, when seasonal activity of Ixodes spp. ticks in the region is low, and was to a location where B. miyamotoi has not been identified (9).

For patients with high or relapsing fever during seasons of Ixodes tick activity, particularly in areas where B. miyamotoi has been reported in local tick populations, clinicians should consider the possibility of B. miyamotoi infection along with other Borrelia spp. Laboratory confirmation of B. miyamotoi infection can be challenging because the spirochetes share many proteins with B. burgdorferi and B. hermsii, resulting in cross-reacting antibodies, and because few laboratories offer specific molecular diagnostic testing for B. miyamotoi (10). For this case, B. miyamotoi infection was diagnosed through molecular testing with unbiased plasma mcfDNA sequencing, an increasingly used tool for evaluating patients with fever of unknown etiology (11,12). The patient’s immunocompromised status may have contributed to the infection chronicity, increasing our ability to detect the organism (11,13). PCR and sequencing confirmed the diagnosis.

Our study suggests that B. miyamotoi is an emerging human pathogen in California. Human infection is probably rare, given low seroprevalence in blood donors, even in counties to which I. pacificus ticks are endemic, and low prevalence of B. miyamotoi in ticks that is rarely >2% (1,3). Given limitations of serologic testing, clinicians should maintain an index of suspicion for B. miyamotoi in patients with relapsing fever without a clear etiology, should ask about potential tick exposure, and should consider molecular diagnostic testing.

Biography

Dr. Rubio is an assistant clinical professor at University of California, San Francisco, and provides clinical care there and at the Zuckerberg San Francisco General Hospital and Trauma Center. His interests include general infectious diseases, latent tuberculosis infection, HIV primary care, and medical education.