Skip to main content
BMC Zoology logoLink to BMC Zoology
. 2021 Oct 7;6:29. doi: 10.1186/s40850-021-00093-7

The genetic diversity of the genus Mus (Linnaeus, 1758) in the eastern part of the North Caucasus

Fatimat Tembotova 1,, Ekaterina Kuchinova 1, Albina Amshokova 1, Ekaretina Kononenko 1
PMCID: PMC10127352  PMID: 37170371

Abstract

Background

There are two species of Mus in the Caucasus: M. musculus and M. macedonicus. M. musculus is widespread in the Caucasus, where the species is found everywhere from the Black to the Caspian Sea. M. macedonicus is ubiquitous Transcaucasia. The most north-astern border of its distribution in the Caucasus, according to the literature, is located in the Derbent region, near the border between Dagestan and Azerbaijan.

Results

Cytochrome b mt-DNA of genus Mus research in this study in the Eastern Caucasus. About 70% of M. musculus haplotypes from the lowlands of Dagestan were recorded for the first time. One of these haplotypes accounts for approximately 25% of the total species diversity of haplotypes. M. macedonicus was found in only one locality, the Sarykum barchans, where this species prevails in number and accounts for 70% of the total number mice of the genus Mus. The species is characterized by low values of genetic diversity and nucleotide variability, which may indicate that the population originated from a small number of founders and may explain its relative isolation from the main range. The dating of the appearance of the ancestors of M. musculus in the east of the Russian Caucasus corresponds to 99-66 thousand years ago (at a mutation rate of 3-10% per million years).

Conclusion

The results obtained suggest that the history of the appearance of M. musculus in the Eastern Caucasus is more ancient and is not associated with human agricultural activities.

We believe that possibly the ancestral range of M. musculus covered the eastern and western coasts of the Caspian Sea in the territory of southern Dagestan, Azerbaijan, and Iran. In this paper M. macedonicus, a Balkan-Asia Minor species, was registered for the first time in the North Caucasus. This species was registered in the center of Dagestan, where it inhabits sympatrically (on the territory) and syntopically (on the same biotope) with M. musculus. The low values of genetic diversity of M. macedonicus in the North Caucasus suggest that the population originated from a small group of founders.

Keywords: Species diversity, Mus macedonicus, Mus musculus, Cytochrome b, Genetic diversity, The eastern part of the North Caucasus

Background

The Caucasus, located at the junction of Europe and Asia, plays a very important role in the formation of the climate, natural ecosystems and their components [1, 2]. The interpenetration of flora and fauna taxa occurs across the Caucasian Isthmus. European taxa predominate in the North Caucasus; in Transcaucasia, representatives of the Near-Asian and Mediterranean faunas predominate.

Two species of Mus live in the Caucasus: Mus musculus (Linnaeus 1758) and Mus macedonicus (Petrov and Ruzic 1983). M. musculus has a wide distribution in the North Caucasus, where the species is found everywhere from the Black Sea coast to the Caspian Sea coast [35] and in the mountains up to 2000 m above sea level. Studies have shown [6, 7] that in Transcaucasia hybridization occurs between two taxa of house mice: M. m. musculus and M. m. domesticus. The wild species M. macedonicus also lives in the Transcaucasus.

M. macedonicus, a wild mouse living in the Balkans and Asia Minor, is distributed throughout Transcaucasia [6, 815]. This species is widespread in Adzharia [16], in north-east Georgia [6, 1719], throughout most of Armenia (except the high mountains in the central regions), in valleys in the middle courses of the Araks River, Kura River and Alazani River, and in the western and north-western parts of Azerbaijan [4, 20]. The north-eastern border of the species range in the Caucasus is in Azerbaijan, where it runs along the southern slopes of the Greater (Main) Caucasus Ridge (Zkataly–Sheki) according to Kotenkova [4]. These data were verified by Macholán et al. [19], who found M. macedonicus in the vicinity of Derbent near the Dagestan border with Azerbaijan.

These two Mus species are known as twin species and do not differ in their morphological characteristics. However, different authors have still studied the distribution of Mus throughout most of the range without the use of molecular genetic methods.

We aimed to study the diversity of the genus Mus in the Eastern Caucasus within the Dagestan Nature Reserve based on mtDNA cytochrome b data.

Results

We obtained mtDNA cytochrome b gene sequences of 549 bp for 50 specimens of the genus Mus, which correspond to positions 70–619 of the complete gene sequence. The Mus - identified haplotypes obtained in this study and taken from GenBank (https://www.ncbi.nlm.nih.gov/genbank/) are shown in Table 1. The haplotypes obtained in this study were deposited in GenBank under accession numbers MT036344-MT036364.

Table 1.

Identified haplotypes the genus Mus

Haplotype Species Identification number Collection point
1 2 3 4
1 M. m. musculus MT036347a Eastern part of North Caucasus
AB649511b, AB649518b, AB649530b, AB649531b, AB649534b, AB649547b, KF839611b, KF839612b, KF697039b, MG748213b, MG748214b Kazakhstan, Russia (Irkutsk), various provinces of China
2 M. m. musculus MT036348a Eastern part of North Caucasus
AB649508b, AB649509b, AB649515b, AB819917b, AB649521b, KF839627b, KF697034b, KF697035b, KF697042b, KF697043b, KF697056b, KF697058b, Poland, Hungary, Bulgaria, Ukraina, Moldova, Kazakhstan, Russia (Astrakhan, Kazan, Samara Region, Karelia)
3 M. m. musculus MT036349a Eastern part of North Caucasus
AB649507b, AB649517b, AB649529b, AB649536b-AB649539b, AB649543b, AB649545b, AB649552b, KF839629b, KF697067b, AY057804b, KT376856b, KT376857b Slovakia, Czech Republic, Estonia, Kazakhstan, Iran, Russia (Sulak), various provinces of China
4 M. m. musculus MT036350a Eastern part of North Caucasus
5 M. m. musculus MT036351a Eastern part of North Caucasus
6 M. m. musculus MT036352a Eastern part of North Caucasus
7 M. m. musculus MT036353a Eastern part of North Caucasus
8 M. m. musculus MT036354a Eastern part of North Caucasus
AB649520b, KF697053b Rumania, Russia (Primorye)
9 M. m. musculus MT036355a Eastern part of North Caucasus
10 M. m. musculus MT036356a Eastern part of North Caucasus
11 M. m. musculus MT036357a Eastern part of North Caucasus
12 M. m. musculus MT036358a Eastern part of North Caucasus
13 M. m. musculus MT036359a Eastern part of North Caucasus
KF697037b Russia (Moscow)
14 M. m. musculus MT036360a Eastern part of North Caucasus
15 M. m. musculus MT036361a Eastern part of North Caucasus
16 M. m. musculus MT036362a Eastern part of North Caucasus
17 M. m. musculus MT036363a Eastern part of North Caucasus
KF697036b Russia (Rostov region)
18 M. m. musculus MT036364a Eastern part of North Caucasus
19 M. m. musculus AB649510b Afghanistan
20 M. m. musculus AB649512b Uzbekistan
21 M. m. musculus AB649513b Uzbekistan
22 M. m. musculus KT376858- KT376860b Various provinces of Iran
KT376874b
23 M. m. musculus KT376867-KT376869b
24 M. m. musculus KT376865-KT376866b
25 M. m. musculus KT376861-KT376863b
26 M. m. musculus KT376871b Iran (Gorgan)
27 M. m. musculus KT376873b Iran (Mashhad)
28 M. m. musculus KT376872b Iran (Bojnord)
29 M. m. musculus KT376870b Iran (Bojnord)
30 M. m. musculus KT376855b Iran (Bojnord)
31 M. m. musculus KT376854b Iran (Bojnord)
32 M. m. domesticus AY332705b Switzerland
33 M. m. domesticus KT376845-KT376847b, KT376849-KT376852b Various provinces of Iran
34 M. m. domesticus AB649479b Various provinces of Iran
KT376840-844b
35 M. m. domesticus KT376848b Iran (Kordestan)
36 M. m. domesticus KT376853b Iran (Urmia)
37 M. m. domesticus KX790793b Pakistan (Attock)
38 M. m. bactrianus KT376793b Iran (Zahedan)
39 M. m. bactrianus KT376773b Afghanistan (Kabol)
40 M. m. bactrianus KT376753b Iran (Saravan)
41 M. m. bactrianus KT376746b Iran (Saravan)
42 M. m. bactrianus KY661853b Pakistan
43 M. m. bactrianus KY661852b
44 M. m. bactrianus KY661851b
45 M. m. bactrianus KY661850b
46 M. m. bactrianus KY661846b
47 M. m. bactrianus KY661845b
48 M. m. bactrianus KY661836b
49 M. m. bactrianus KY661837-839b
50 M. m. bactrianus KY661840b
51 M. m. bactrianus KY661841b
52 M. m. bactrianus KY661831- KY661835b KY661842- KY661844b, KY661847b, KY661854- KY661856b
53 M. m. bactrianus AB649490b India (Delhi)
54 M. m. castaneus KY418175b Nepal (Lumbini)
55 M. m. castaneus KY418176b Nepal (Lumbini)
56 M. m. castaneus AB819912b India (Ghaziabad)
57 M. m. castaneus AB819908b India (Delhi)
AB819909b Various provinces of India
58 M. m. castaneus AB819911b, AB820897 b, KY418172b, KY418177b Nepal (Lumbini)
59 M. m. castaneus KY418173b Nepal (Lumbini)
60 M. m. castaneus AB649491b Various provinces of India
AB820901b, AB820910b, AB973114-116b, KY418174b Nepal (Lumbini)
61 M. macedonicus MT036344a Eastern part of North Caucasus
62 M. macedonicus MT036345a Eastern part of North Caucasus
63 M. macedonicus MT036346a Eastern part of North Caucasus
64 M. macedonicus AB125770b Israel
65 M. macedonicus AY057808b Former Yugoslavia
66 M. spicilegus AB125775b Bulgaria
67 M. spicilegus KY754048b Austria
68 M. spretus AB033700b Unknown

aOwn data

bGenBank Accession No (https://www.ncbi.nlm.nih.gov/genbank/)

The average nucleotide composition of the studied fragment was 28.9% adenine, 29.6% thymine, 26.0% cytosine and 15.5% guanine. Twenty-one haplotypes were obtained; 15 of these were registered for the first time (Table 1).

Eighteen haplotypes obtained in this study were attributed to M. musculus, and three other haplotypes were attributed to M. macedonicus (Fig. 1). To interpret the results, a Bayesian tree was used (Fig. 1).

Fig. 1.

Fig. 1

Cladogram of relationships between species of the genus Mus in the Eastern Caucasus from a cytochrome b gene fragment of 549 bp retrieved from GenBank with the Bayesian method. The numbers at the nodes indicate the posterior probabilities. Support values exceeding 0.5 are shown. * Data from the present study; ** GenBank Accession No. Abbreviations: SPIC – M. spicilegus; MAC – M. macedonicus; MAC 1 – MT036344 + Israel; MAC 2 – MT036345 + Yugoslavia; CAS – M. m. castaneus; BAC – M. m. bactrianus; MUS – M. m. musculus; DOM – M. m. domesticus; MUS 1 – M. m. musculus 1; MUS 2 – M. m. musculus 2; MUS 1.1 – M. m. musculus 1.1; MUS 1.2. – M. m. musculus 1.2; SPRET – M. spretus

The dendrogram includes three well-differentiated haplogroups corresponding to three species of the genus Mus: M. musculus, M. macedonicus, and M. spicilegus, which is consistent with literature data [15]. Haplogroups in this tree are distinguished with a sufficiently high reliability and have large support (posterior probabilities of 0.514 and more). The outer group is Mus spretus.

The average genetic distance between haplotypes of these three species was as follows: 6.80% between М. musculus and М. macedonicus, 7.00% between М. musculus and М. spicilegus, and 5.23% between M. macedonicus and M. spicilegus (Table 2). The distance in three comparison options: M. spretus − M. musculus, M. spretus − M. spicilegus, and M. spretus − M. macedonicus is 10% or more.

Table 2.

Interspecies genetic distances (d, %) of genus Mus for a 549-bp cytochrome b gene region

Species M. musculus M. macedonicus M. spicilegus M. spretus
M. musculus (n = 60) 1,00 1,06 1,46
M. macedonicus (n = 5) 6,8 0,95 1,55
M. spicilegus (n = 2) 7,0 5,2 1,48
M. spretus (n = 1) 11,4 11,0 10,2
Overall groups 4, n = 68

Distance bottom left, standard error top right

The average intraspecies distances were approximately 10 times smaller; d (K2P) was 0.69% for М. musculus and 0.59% for М. macedonicus (Table 3).

Table 3.

Average genetic distances (d, %) between mice of genus Mus populations, Kimura 2-parameter (K2P), calculated for 549-bp participation in cytochrome b

Species d S.E.
M. musculus 0.69 0.15
M. macedonicus 0.59 0.24

S.E. Standard error (%)

Genetic differentiation of M. musculus

M. musculus has a distinct intraspecific structure (Fig. 1). In the basal part of the dendrogram, there are three subspecies with a high posterior probability: M. m. castaneus, M. m. bactrianus and M. m. musculus. Support M. m. domesticus is not so significant (0.643); nevertheless, this taxon is isolated and, probably, if the number of specimens increased, the support would be much higher. Cluster M. m. musculus is well structured; two clades are distinguished here, which correspond to those identified by Suzuki et al. [15] M. m. musculus 1 and M. m. musculus 2 (Fig. 1).

M. musculus in the eastern part of the North Caucasus

All 18 haplotypes of M. musculus obtained in the eastern part of the North Caucasus fell into the cluster of one subspecies M. m. musculus. Seventeen haplotypes are located in the M. m. musculus 1, haplotype МТ036347 fell into the cluster M. m. musculus 2 (Fig. 1). Genetic distance between cluster M. m. musculus 1 and M. m. musculus 2 is 0.80%. Haplotype МТ036347 was identical to haplotypes from Kazakhstan, Uzbekistan, Russia (Irkutsk) and different regions of China and united in the cluster M. m. musculus 2 together with specimens from Iran. Subcluster M. m. musculus 1, which included 17 haplotypes from the eastern part of the North Caucasus, is distinguished by a great variety and structure. The two clades are well subdivided here, although the posterior probability has a low value of 0.565. Four haplotypes of the clade M. m. musculus 1.1 (MUS 1.1) are widespread in Europe (Poland, Hungary, Moldova, Ukraine, Czech Republic, Slovakia, Romania, Bulgaria, Estonia), the European part of Russia, Central Asia (Kazakhstan) and a number of regions of China. Haplotypes from Iran, Uzbekistan and Afghanistan fell into one clade. The second clade of M. m. musculus 1.2 (MUS 1.2) (posterior probability 0.797) includes two haplotypes from Iran and four haplotypes (МТ036350, МТ036351, МТ036353, МТ036364) from the eastern part of the North Caucasus. The distance between the two clades is 0.80%.

M. m. musculus in the eastern part of the North Caucasus is characterized by low values of nucleotide diversity (Table 4) and high values of haplotype diversity.

Table 4.

Parameters of diversity of mtDNA haplotypes according to partial cytochrome b gene (549 bp) in the populations of the genus Mus in Eastern part of North Caucasus

Locality N Number of haplotypes, i Nucleotide diversity π, % Haplotypic diversity, H
M. musculus
 Sarykum barchans 3 3 0.607 1.000
 Agrahansky 7 5 0.312 0.905
 Kizlyar Bay 17 10 0.396 0.904
 North-eastern border of the Republic of Dagestan and the Republic of Kalmykia 16 7 0.325 0.825
M. macedonicus
 Sarykum barchans 7 3 0.052 0.524

Twelve of the 18 M. musculus haplotypes obtained in the eastern part of the North Caucasus were registered for the first time (Fig. 2, Table 1). Three haplotypes (MT036348, MT036349, MT036353) were found the most often in the study area (Fig. 2).

Fig. 2.

Fig. 2

M. musculus haplotypes median-joining network. The length of the branches is 206 proportional to the number of mutations; the circle sizes are proportional to the number of 207 detected haplotypes. The numerals correspond haplotypes names, mv1–mv4 represent the 208 median vectors, hypothetical intermediate haplotypes that were not registered. The outside the 209 studied site variants are marked by asterisk (Table 1)

Only one haplotype (MT036348) of M. musculus was obtained at all localities (Fig. 2); its share of the total sample was 16.3%. This haplotype is known from several European countries: Moldova and Bulgaria [15], Poland, Hungary, Ukraine [15, 21], the cities of Astrakhan and Kazan in Russia [15], Karelia and the Samara regions in Russia [21], and Kazakhstan (https://www.ncbi.nlm.nih.gov/genbank/). The share of the MT036349 haplotype was 25.6%; this haplotype was not found in the Sarykum barchans samples. Haplotype MT036349 is known from another region of Dagestan (Sulak) [15], as well as from other areas in Europe, namely, Slovakia [21], the Czech Republic [22], and Estonia [15]; it has also been found in Asia, in Kazakhstan (NCBI: KF839629), Iran [23] and in several provinces of China (Xiaogan, Laiyang, Shijiazhuang, Qiqihar, Baodi, Hohhot, Hulin) [15]. The haplotype MT036353 was registered to M. musculus for the first time. This haplotype had a high frequency; its share in the total sample was 23.3% in this study. The haplotype MT036353 differs from the MT036348 haplotype by one nucleotide substitution. Four haplotypes (MT036347, MT036354, MT036359, MT036363) were registered in the studied territory in single specimens of house mice, which are also known from Europe, the European part of Russia, and parts of Asia, specifically, Romania [21], Moscow [21], the Rostov region [21], Irkutsk [15], Kazakhstan ([15, 21], https://www.ncbi.nlm.nih.gov/genbank/), Primorsky Krai [15] and various provinces of China [15, 24]. Twelve haplotypes were found once and they are not in GenBank.

Genetic differentiation of M. macedonicus

In this paper, M. macedonicus, a Balkan-Asia Minor species, was first recorded in the North Caucasus and in only one locality, the Sarykum barchans. Three haplotypes (MT036344-MT036346) were recorded among seven studied mice (Table 1) for the first time. The MT036345 haplotype was detected in 5 specimens, and the sequences MT036344 and MT036346, differing from MT036345 by 1–3 synonymous substitutions, were found in one specimen each. The average intraspecific distance for M. macedonicus in the eastern part of the North Caucasus was 0.49%. Three haplotypes were divided into two subclusters (Fig. 1). Haplotype MT036344 merged with a haplotype from Israel (MAC 1), MT036345 and MT036346 ended up in a subcluster with a haplotype from the former Yugoslavia (MAC 2). The distance between two subclusters (node 3) is 0.73%, which corresponds to the distance between two haplogroups M. m. musculus 1 and M. m. musculus 2 (0.78%).

Time of divergence between M. musculus haplogroups and within them

In this study, we were unable to isolate the whole sequence of cytochrome b mtDNA; therefore, all the calculated dates are approximate. We will conduct more research in the future.

The divergence estimates obtained in BEAST are calculated for 5 variants of substitutions per million years: 3, 5, 10, 20, 40% (Table 5). Time estimates of 1.7 Ma for the root node divergence of Mus spretus and other species of the genus Mus were used as a calibration point, as suggested by Suzuki et al. [18]. The date of divergence of two haplogroups M. m. musculus 1 and M. m. musculus 2 (MUS 1 - MUS 2, 12 node) 150 ka ago [18]. According to our calculations, MUS 1 and MUS 2 diverged from a common ancestor ~ 185-131 thousand years ago, which corresponds to a mutation rate of 3-10% per million years ago. The age of the common ancestor of M. m. musculus 1.2 of the eastern Caucasus and related haplotypes from Iran dates back to 99-66 thousand years ago (node 13, Fig. 1, Table 5) for models calculated for a mutation rate of 3-10% per million years ago.

Table 5.

Calculated divergence time of the nodes of the Mus dendrogram

Tree node number / substitution rate 3% 5% 10% 20% 40%
1 SPRET – 3SP 2.0332 1.8319 1.5881 1.3749 1.0884
2 MAC – SPIC 0.8064 0.737 0.6533 0.5782 0.4886
3 MAC 0.1233 0.1075 0.0882 0.0718 0.0586
4 MAC 1 0.0541 0.0474 0.0381 0.0311 0.0237
5 MAC 2 0.0345 0.0298 0.0246 0.0199 0.0163
6 SPIC 0.0287 0.0246 0.0209 0.0171 0.0137
7 CAS + BAC – MUS 0.4367 0.3945 0.3441 0.2985 0.2467
8 BAC 0.1072 0.0935 0.0746 0.0618 0.0485
9 BAC – CAS 0.2171 0.1918 0.1578 0.1316 0.1037
10 CAS 0.196 0.1725 0.1416 0.1172 0.0923
11 DOM 0.1022 0.0891 0.074 0.0596 0.0475
12 MUS 1 – MUS 2 0.1846 0.1611 0.1308 0.1049 0.0831
13 MUS 1.2 0.0991 0.085 0.0655 0.0571 0.0435

Abbreviations: SPRET M. spretus, 3SP M. macedonicus + M. spicilegus + M. musculus, MAC M. macedonicus, SPIC M. spicilegus, MAC 1MT036344 + Israel, MAC 2MT036345 + Yugoslavia, CAS M. m. castaneus, BAC M. m. bactrianus, MUS M. m. musculus, DOM M. m. domesticus, MUS 1 M. m. musculus 1, MUS 2 M. m. musculus 2, MUS 1.2 M. m. musculus 1.2

Time of divergence between M. macedonicus haplogroups

M. macedonicus and M. spicilegus diverged ~ 806-653 thousand years ago (mutation rate 3-10% per million years) (Table 5). The age of the M. macedonicus found in the Transcaucasia corresponds to ~ 123-88 thousand years ago (mutation rate is 3-10% per million years). The age of haplogroups MAC 1 and MAC 2 found in the Eastern Caucasus are ~ 54-38 thousand years and 35-25 thousand years, respectively, with a mutation rate of 3 -10% per million years (nodes 4-5, Fig. 1, Table 5).

Discussion

We recorded M. musculus in all three sites under study in the Dagestansky Nature Reserve and around the northeastern border between the Republic of Dagestan and the Republic of Kalmykia. We applied Fst and Фst criteria to study the genetic differentiation of the M. musculus populations from 4 localities. The comparison of haplotype frequencies (Fst) shows the lack of significant differences; i.e., Fst values range from 2.40 to 7.74% at the significance level p (Fst) of 0.264–0.8896 (Table 6) between the populations.

Table 6.

Frequency of occurrence of haplotypes (Fst) in the studied populations of M. musculus, calculated for 549-bp participation in cytochrome b

Locality Sarykum barchans Agrahansky Kizlyar Bay North-eastern border of the Republic of Dagestan and the Republic of Kalmykia
Sarykum barchans 0.7480 0.3453 0.2640
Agrahansky − 0.0420 0.8350 0.7222
Kizlyar Bay 0.0240 −0.0451 0.8896
North-eastern border of the Republic of Dagestan and the Republic of Kalmykia 0.0774 −0.0382 −0.0317

At the bottom left are the estimates of Fst, at the top right the level of their significance

Pairwise Фst values varied from 0.14 to 2.04; the differences related to Фst values were also unreliable (Table 7).

Table 7.

Pairwise estimates of genetic differentiation (Фst) between the studied populations of M. musculus, calculated from the 549-bp region of the cytochrome b gene

Locality Sarykum barchans Agrahansky Kizlyar Bay North-eastern border of the Republic of Dagestan and the Republic of Kalmykia
Sarykum barchans 0.4225 0.4782 0.4014
Agrahansky − 0.0081 0.4443 0.3203
Kizlyar Bay −0.0169 −0.0038 0.2088
North-eastern border of the Republic of Dagestan and the Republic of Kalmykia −0.0014 0.0091 0.0204

The estimates of Фst are at the bottom-left; the levels of their significance are at the top-right

These results demonstrate that the four studied populations of house mice in the Eastern Caucasus are panmictic, with a high level of gene exchange between them. This is facilitated by the abundance of the species. M. musculus, in the four studied localities, represents 1.1-9.9% or more of the total abundance of small mammals (Rodentia, Eulipotyphla) [25, 26].

The registered 11 unique haplotypes and MT036353, found only in Dagestan, together accounted for about 70% of the haplotype diversity in the four house mice populations of the Eastern Caucasus. This indicates that the populations of M. musculus in eastern Dagestan are, to a certain extent, isolated from the populations of domestic mice in the European part of Russia. It can be assumed that haplotype MT036353 is endemic for M. musculus of eastern Dagestan since its frequency represents approximately 25% of the total diversity of haplotypes and it is found at the edge of the species range.

The results obtained in BEAST (Table 5) showed that the common ancestor of the clade M. m. musculus 1 and M. m. musculus 2 (12 node, Fig. 1) appeared on the territory of the eastern part of the North Caucasus ~ 185-131 thousand years ago (3-10% of substitutions per million years), but not earlier than ~ 83 thousand years (40% of substitutions per million years). In general, these dates are comparable to those of Suzuki et al. [15].

The common ancestor of the MUS 1.2 cluster separated from the main part of M. m. musculus 1 (node 13) within ~ 99-66 thousand years ago (3-10% of substitutions per million years) but not earlier than ~ 43 thousand years (40% of substitutions per million years) (Table 5).

Thus, it can be assumed that the common ancestor of M. m. musculus 1 appeared in the Caucasus ~ 185-131 thousand years ago in the Upper Pleistocene, and MUS 1.2 during the last ice age ~ 99-66 thousand years ago, but before LGM. These results are consistent with the data of N.K. Vereshchagin [27], who dated the paleontological material for M. musculus from foothill Dagestan to the Middle Pleistocene.

The results obtained suggest that the distribution of M. musculus in the Eastern Caucasus is not associated with human agricultural activity. We believe that, perhaps, the ancient range of M. musculus covered the eastern and western coasts of the Caspian Sea, in the eastern part of the Russian Caucasus, Azerbaijan and Iran.

We identified M. macedonicus, as opposed to the house mouse, only in one locality, i.e., ‘Sarykum barchans’, where the species was dominant in number and accounted for 70% of the total number of mice genus Mus. The vicinity of Makhachkala is known today as the northernmost border of the distribution of M. macedonicus. The species is characterized by low values of gene diversity and nucleotide variation (Table 2), which may indicate the origin of the population from a small number of founders and its relative isolation from the main range of the species. The identified clear tree structure of the species (Fig. 1) is probably also explained by the high level of ancestral polymorphism in the discovered population of M. macedonicus.

The common ancestor of the MAC 1 and MAC 2 subclusters (node 3) has an age of ~ 123-88 thousand years ago, which corresponds to a mutation rate of 3-10% per million years.

Age of haplogroup MAC 1 (node 4, Fig. 1, Table 5) corresponds to ~ 54-38 thousand years ago (mutation rate 3-10% per million years), haplogroup MAC 2 (node 5) corresponds to ~ 35-25 thousand years ago (mutation rate 3-10% per million years). This suggests the appearance of M. macedonicus in the Transcaucasia not later than in the Upper Pleistocene. Now it is difficult to conclude whether the haplotypes of M. macedonicus first recorded by us are unique and how long ago they appeared in the eastern part of the North Caucasus. Further researches are needed.

Conclusion

Our study of the cytochrome b mtDNA gene region in mice of the genus Mus showed that two species inhabit the lowland of the eastern part of the North Caucasus: M. musculus and M. macedonicus. In this paper M. macedonicus, a Balkan-Asia Minor species, was registered for the first time in the North Caucasus.

M. musculus is widespread in the lowland Dagestan and its range covers various localities in which it is numerous or common. M. macedonicus is limited in its distribution to the southernmost point in the studied area of the Dagestan reserve near the town of Makhachkala. The populations of M. musculus in the Eastern Caucasus are panmictic, with a high level of gene exchange between them. Only about 30% of the Eastern Caucasus house mouse haplotype diversity is identical to the diversity of haplotypes from other areas of the species range in Eurasia, from Western Europe to the Far East. About 70% of haplotypes were registered for the first time which perhaps allows them to be considered endemic for the eastern part of the North Caucasus. This also indicates a high degree of isolation of the genetic diversity of M. musculus in the eastern part of the Caucasus from European diversity (Western and Eastern Europe, including the European part of Russia).

It is more likely that the dating of the appearance of the ancestors of M. musculus in the eastern Caucasus corresponds to one of three models calculated for 3-10% substitutions per million years, which allows us to propose a dating of ~ 185-131 thousand years, but not earlier than ~ 43 thousand years, i.e. to LGM.

The results obtained suggest that the distribution of M. musculus in the Eastern Caucasus is not associated with human agricultural activities. We believe that perhaps the ancestral range of M. musculus covered the eastern and western coasts of the Caspian Sea in the territory of southern Dagestan, Azerbaijan, and Iran.

The low values of the genetic and nucleotide diversity of the population of M. macedonicus from the Sarykum barchans region suggest the origin of this population from a small number of founder individuals as a result of natural or accidental introduction. It could be considered, the border of the expanding range of this species could be located anywhere in central Dagestan; to provide support for this view, further studies in the Eastern Caucasus are necessary.

M. macedonicus probably appeared in the Transcaucasia ~ 123-88 thousand years ago (mutation frequency 3-10% per million years), but not earlier than ~ 57 thousand years ago, which corresponds to the period of the Upper Pleistocene. The age of haplogroup MAC 1 corresponds to ~ 54-38 thousand years ago (mutation rate 3-10% per million years), haplogroup MAC 2 corresponds to ~ 35-25 thousand years ago (mutation frequency 3-10% per million years). Now it is difficult to conclude whether the haplotypes of M. macedonicus first recorded by us are unique and how long ago they appeared in the eastern part of the North Caucasus. Further researches are needed.

Methods

Study area

The research was carried out in the Eastern Caucasus in the Dagestan Reserve. The reserve is a protected area of 5 plots, 4 of which are located in the lowlands: Sarykum barchans (1.175 thousand hectares), Agrahansky (39.0 thousand hectares), Kizlyar Bay (land 9.185 thousand hectares), Samursky (11.200 thousand hectares). The natural landscapes of the reserve are distinguished by the high diversity and complexity of the ecosystems, the main types of which are sand barchans, dry foothills, delta forests and high mountains [28]. The studies were conducted in the lowland areas of the reserve: locality 1 – Sarykum barchans (geographical coordinates 43°00.472′ N, 47°13.808′ E; 100 m a.s.l.), locality 2 – Agrahansky (43°48.255′ N, 47°26.866′ E; 50 m a.s.l.), locality 3 – Kizlyar Bay (44°30.995′ N, 46°47.656′ E; 50 m a.s.l.), and locality 4 – the border area between Dagestan and Kalmykia (44°46.452′ N, 46°57.900′ E; 30 m a.s.l.) (Fig. 3). Distance between localities (km, in a straight line): 1–2 – 90 km; 1–3 – 175 km; 1–4 – 200 km.

Fig. 3.

Fig. 3

Map of the study area in the eastern part of the North Caucasus: 1–Sarykum barchans (geographical coordinates 43°00.472′ N, 47°13.808′ E), 2–Agrahansky (43°48.255′ N, 47°26.866′ E); 3–Kizlyar Bay (44°30.995′ N, 46°47.656′ E); 4–the border area between Dagestan and Kalmykia (44°46.452′ N, 46°57.900′ E). The red line indicate the Republic of Dagestan border. Open access Caucasus map used in the paper (“© OpenStreetMap contributors”. https://www.openstreetmap.org/copyright)

A visual description studied biotopes of four localities is below. Grassy tiers were recorded in all localities. 1) The Sarykum barchans phytocenoses are represented by various forest-steppe areas. The first community of plants includes a tree tier of Robinia pseudoacacia with hybrid poplar, a shrub tier of Tamarix ramosissima. The second community of plants includes a wood tier of a few hybrid poplar trees and a shrub tier of Elaeagnus caspica and T. ramosissima. The third community of plants includes artificial plantings of Ailanthus altissima with an admixture of hawthorn and Populus alba. 2) The plant communities in Kizlyar Bay include the reed Phragmites australis and wormwood. 3) The locality of Agrahansky covers the territories of several plant communities. The biotope include a shrub tier, represented by islets of T. ramosissima. The second community includes a shrub layer of T. ramosissima. The third community includes a shrub tier of T. ramosissima. The fourth community is represented by a Tugai forest of Morus sp., Amorpha fruticosa and Salix triandra; the shrub tier is dominated by Rubus. 4) Plant communities on the border between the Republics of Dagestan and Kalmykia include the shrub tier, represented by T. ramosissima and Tamarix gracilis.

Materials

In total, 50 wildlife mice of the genus Mus were studied: 10 specimens from locality 1, 7 specimens from locality 2, 17 specimens from locality 3 and 16 specimens from locality 4.

All Mus specimens were identified by body size, fur colouration and structure of the skull and teeth [2]. Mice were euthanized with 8% sevoflurane under special conditions, after which the animals were sacrificed by decapitation.

Methods

Total DNA was extracted from muscle tissue and preserved in 96% ethanol using a Diatom™ DNA Prep 100 kit (Izogen Laboratory Ltd., Moscow, Russia) according to the manufacturer’s protocol. The resulting DNA solutions were stored at − 18°С. The amplification of fragments of the mitochondrial cytochrome b gene was conducted by MasterMix Х5 (Dialat Ltd., Moscow). We used primers L14115: GACATGAAAAATCATCGTTG and H15300: GTTTACAAGACCAGAGTAAT for PCR under the parameters outlined in Yasuda et al. [29]. The resulting PCR products were purified by precipitation in a 0.15 M CH3COONa solution in 90% ethanol and then rinsed with 70% ethanol. The products were visualized by 1.5% agarose gel electrophoresis with ethidium bromide.

Sequencing of the nucleotide sequences of the mtDNA cytochrome b gene region was performed according to Senger using the BigDye Terminator v3.1 commercial kit (ThermoFisher) and the ABI 3130xl genetic analyser (ThermoFisher) at Sintol CJSC (Moscow).

We aligned the resulting sequences using BioEdit 7.09.0 [30]. We determined similar sequences (haplotypes) using the online toolbox FaBox 1.5 [31]. The phylogenetic tree was built in the program in MrBayes 3.2.6 [32] for 1,000,000 iterations and 1000 iterations of burn in. We used the HKY with gamma distribution and invariant sites (HKY + G + I) model. We performed the determination of the appropriate model in MEGA 6 [33].

For the analyses we also retrieved homologous mtDNA haplotypes from GenBank of mice from the genus Mus: М. musculus; М. macedonicus; М. spicilegus (Table 1). M. spretus was used as an outgroup taxa; the south-eastern border of the contemporary range of this species in European Russia is in the Rostov region, which borders the Western Caucasus.

We estimated the age of the most recent common ancestors (TMRCAs) for mtDNA clades in BEAST V1.10.4 [34] by the Bayesian Markov-chain Monte-Carlo (MCMC) method, using the HKY + G + I substitution model as selected in MEGA 6. We used strict clock as clock model and constants size as coalescent model. We took all the calibration points used in the estimations from Suzuki et al. [15]. For the analysis, we used M. spretus as outgroup taxa. We used as calibration point the time estimates of 1.7 mya for the root node of the divergence of M. spretus and the other species of M. musculus species group. We used as calibration point the time estimates of 0.914 mya for the root node of the divergence of M. macedonicus and M. spicilegus. At last, we used as calibration point the time estimates of 0.459 mya for the root node of the divergence of subspecies of M. musculus. We run MCMC for 10,000,000 iterations and 1000 iterations of burn in.

We used the ARLEQUIN V.3.11 package [35] to evaluate genetic variation within species samples by assessing the parameters for haplotypic diversity (H) [36] and nucleotide diversity (π) [37]; statistical estimates of the differences between the populations based on the frequency of haplotypes (Fst); values of the pairwise distances between nucleotide sequences in the samples (Φst); and the degree of statistical validity in the obtained differences. We constructed median-joining networks of haplotypes using the NETWORK v.4.6.1.1 package [38].

Acknowledgements

The authors are indebted to Meshcherskiy IG (Severtsov IEEP RAS) for his consultations and assistance in the preparation of the manuscript. The authors thank Kuniev KM and Dzhamirzoev GS (‘Dagestanskiy’ SNR) for their assistance in field studies. We also thank the anonymous reviewers for their critical but friendly comments that helped us to improve the manuscript.

We are grateful to VS Lebedev, employee of the Zoological Museum of Moscow State University for help in mastering the BEAST program, Karmokov MKh, employee of Tembotov Institute of Ecology of Mountain Territories of the Russian Academy of Sciences, for the calculations performed in the BEAST program.

Abbreviations

mtDNA

Mitochondrial DNA

PCR

Polymerase chain reaction

NCBI

National Center for Biotechnology Information

K2P

Kimura2 Parameter

H

Haplotype diversity

π

Nucleotide diversity

bp

Base pair

Fst

Frequency of haplotypes

Фst

Phylogenetic proximity of all haplotypes

Authors’ contributions

TF conceived the study. KEA, AA, and KEP contributed to data acquisition and processing of data. All authors contributed to data analysis. TF and KEA wrote the initial draft of the manuscript. All authors contributed to the manuscript revision and approved the final version.

Funding

The study was carried out with government funding Tembotov Institute of Ecology of Mountain Territories of Russian Academy of Sciences. The funding bodies played no role in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript.

Availability of data and materials

The Mus haplotypes registered by us were deposited in the GenBank (https://www.ncbi.nlm.nih.gov/genbank/)

MT036344- MT036364

Declarations

Ethics approval and consent to participate

The study was carried out in compliance with the international principles of the Helsinki Declaration on the humane treatment of animals. The work was carried out on the basis of the permission of the Bioethics Commission of the Tembotov Institute of Ecology of Mountain Territories of Russian Academy of Sciences in 2016 (protocol No. 1 dated 03/04/2016). The commission of 5 people was guided by the Regulations on the Commission on Bioethics, developed at the Institute.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Sokolov VE, Tembotov AK. Mammals of the Caucasus: insectivores. Moscow: Science; 1989. p. 548. [In Russian with English summary].
  • 2.Tembotova FA. Mammals of the Caucasus and adjacent seas. Moscow: KMK Scientific Press; 2015. p. 352. [Google Scholar]
  • 3.Tembotov AK. Geography of mammals of the North Caucasus. Nalchik: Elbrus; 1972. p. 245. [Google Scholar]
  • 4.Kotenkova EV. Synanthropic and wild mice of the superspecies complex in Mus musculus s. 1: systematics, distribution, life pattern, isolation mechanisms and evolution. Dissertation of Dr of biological sciences. Moscow: Severtsov IPEE RAS; 2000. p. 459. [Google Scholar]
  • 5.Kotenkova EV. Hybridization of commensal species of house mice and its role in their evolution. Uspekhi Sovremennoi Biologii. 2002;122(6):580–593. [Google Scholar]
  • 6.Milishnikov AN, Lavrenchenko LA, Lebedev VS. Origin of the house mice (superspecies complex Mus musculus sensu lato) from the Transcaucasia region: a newlook at dispersal routes and evolution. Russ J Genet. 2004;40:1011–1026. doi: 10.1023/B:RUGE.0000041381.47924.f3. [DOI] [PubMed] [Google Scholar]
  • 7.Orth A, Lyapunova E, Kandaurov A, Boissinot S, Boursot P, Vorontsov N, Bonhomme F. L’espèce polytypique Mus musculus in Transcaucasia. Comptes Rendus de l’Acacémie des Sciences de Paris. Serie 3: Sciences de la vie. 1996;319:435–441. [PubMed] [Google Scholar]
  • 8.Petrov B, Ruzic A. Preliminary report on the taxonomic status of members of the genus Mus in Yugoslavia with description of a new subspecies (Mus hortulanus macedonicus ssp.n. Rodentia, Mammalia) Beograd: Drugi Sympozijum o Fauni SR Serbije: Zbornik; 1983. pp. 175–177. [Google Scholar]
  • 9.Kratochvil J. Mus abbotti–eine kleinasiatisch–balkanisch Art (Muridae, Mammalia) Folia Zool. 1986;35(1):3–20. [Google Scholar]
  • 10.Vanlerberghe F, Boursot P, Nielsen JT, Bonhomme F. A steep cline for mitochondrial DNA in Danish mice. Genet Res. 1988;52(3):185–193. doi: 10.1017/S0016672300027646. [DOI] [PubMed] [Google Scholar]
  • 11.Macholán M, Vohralik V. Note on the distribution of Mus spicilegus (Mammalia: Rodentia) in the south-western Balkans. Acta Soc Zool Bohemoslov. 1997;61:219–226. [Google Scholar]
  • 12.Kryštufek B, Macholán M. Morphological differentiation in Mus spicilegus and the taxonomic status of mound-building mice from the Adriatic coast of Yugoslavia. J Zool. 1998;245:185–196. doi: 10.1111/j.1469-7998.1998.tb00086.x. [DOI] [Google Scholar]
  • 13.Prager EM, Orrego C, Sage RD. Genetic variation and phylogeography of central Asian and other house mice, including a major new mitochondrial lineage in Yemen. Genetics. 1998;150(2):835–861. doi: 10.1093/genetics/150.2.835. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Rajabi-Maham H, Orth A, Siahsarvie R, Boursot P, Darvish J, Bonhomme F. The south-eastern house mouse Mus musculus castaneus (Rodentia: Muridae) is a polytypic subspecies. Biol J Linn Soc. 2012;107(2):295–306. doi: 10.1111/j.1095-8312.2012.01957.x. [DOI] [Google Scholar]
  • 15.Suzuki H, Nunome M, Kinoshita G, Aplin KP, Vogel P, Kryukov AP, Jin M-L, Han S-H, Maryanto I, Tsuchiya K, Ikeda H, Shiroishi T, Yonekawa H, Moriwaki K. Evolutionary and dispersal history of Eurasian house mice Mus musculus clarified by more extensive geographic sampling of mitochondrial DNA. Heredity. 2013;111:375–390. doi: 10.1038/hdy.2013.60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Gromov IM, Erbaeva MA. The mammals of Russia and adjacent territories. Lagomorphs and rodents. Sankt Petersburg; Publishing House of the Zoological Institute RAS; 1995. p. 522. [In Russian].
  • 17.Orth A, Auffray J-C, Bonhomme F. Two deeply divergent mitochondrial clades in the wild mouse Mus macedonicus reveal multiple glacial refuges south of Caucasus. Heredity. 2002;89(5):353–357. doi: 10.1038/sj.hdy.6800147. [DOI] [PubMed] [Google Scholar]
  • 18.Suzuki H, Shimada T, Terashima M, Tsuchiya K, Aplinc K. Temporal, spatial, and ecological modes of evolution of Eurasian Mus based on mitochondrial and nuclear gene sequences. Mol Phylogenet Evol. 2004;33(3):626–646. doi: 10.1016/j.ympev.2004.08.003. [DOI] [PubMed] [Google Scholar]
  • 19.Macholán M, Mikula O, Vohralik V. Geographic phenetic variation of two eastern Mediterranean non-commensal mouse species, Mus macedonicus and M. cypriacus (Rodentia: Muridae) based on traditional and geometric approaches to morphometrics. Zool Anz. 2008;247(1):67–80. doi: 10.1016/j.jcz.2007.07.003. [DOI] [Google Scholar]
  • 20.Orlov VN, Nadjafova RS, Bulatova NS. Taxonomic isolation of Mus abbotti (Muridae, Rodentia) from Azerbaijan. Zoologichesky Zhurnal. 1992;71(7):116–122. [Google Scholar]
  • 21.Fornuskova A, Bryia J, Vinkler M, Macholán M, Pialek J. Contrasting patterns of polymorphism and selection in bacterial-sensing toll-like receptor 4 in two house mouse subspecies. Ecol Evol. 2014;4(14):2944–2931. doi: 10.1002/ece3.1137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Lundrigan B, Jansa S, Tucker P. Phylogenetic relationships in the genus Mus, based on paternally, maternally, and biparentally inherited characters. Syst Biol. 2002;51(3):410–431. doi: 10.1080/10635150290069878. [DOI] [PubMed] [Google Scholar]
  • 23.Shad HH, Darvish J, Pouyani ER, Mahmoudi A. Subspecies differentiation of the house mouse Mus musculus Linnaeus, 1758 in the center and east of the Iranian plateau and Afghanistan. Mammalia. 2016;81(2):147–168. doi: 10.1515/mammalia-2015-0041. [DOI] [Google Scholar]
  • 24.Liu SY, He K, Chen SD, Jin W, Murphy RW, Tang MK, Liao R, Li FJ. How many species of Apodemus and Rattus occur in China? A survey based on mitochondrial cyt b and morphological analyses. Zool Res. 2018;39(5):309–320. doi: 10.24272/j.issn.2095-8137.2018.053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Tembotova FA, Gudova MS, Dyshekova LS, Kuchinova EA, Bottaeva ZK, Chapaev AK. On the structure of small mammal communities in the section “Sarykum Barchans” of ‘Dagestanskiy’ State Nature Reserve. ‘Dagestan’ State Pedagogical University. J Nat Techn Sci. 2017;11(4):62–69. [Google Scholar]
  • 26.Gudova MS, Emkuzheva MM, Kononenko EP. Ecological peculiarities of small mammals from different ecological groups in agrocenoses of foothills in the Central Caucasus. Proc Samara Sci Centre RAS. 2018;20(5):442–446. [Google Scholar]
  • 27.Vereshchagin NK. Mammals of the Caucasus. Moscow-Leningrad: Publisher of the USSR Academy of Sciences; 1959. p. 703. [Google Scholar]
  • 28.Ilyina EV, Aliyev MA, Gasanova NM. The results of the inventory of the insect fauna of the reserve ‘Dagestanskiy’: section ‘Sarykum Barkhans’. Vestnik Tambovskogo universiteta. Seriya Estestvennye i tekhnicheskie nauki. Tambov Univ Rep Ser Nat Tech Sci. 2017;22(5):901–905. doi: 10.20310/1810-0198-2017-22-5-901-905. [DOI] [Google Scholar]
  • 29.Yasuda SP, Vogel P, Tsuchiya K, Han S-H, Lin L-K, Suzuki H. Phylogeographic patterning of mtDNA in the widely distributed harvest mouse (Micromys minutus) suggests dramatic cycles of range contraction and expansion during the mid-to-late Pleistocene. Can J Zool. 2005;83:1411–1420. doi: 10.1139/z05-139. [DOI] [Google Scholar]
  • 30.Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser. 1999;41:95–98. [Google Scholar]
  • 31.Villesen P. FaBox: an online toolbox for FASTA sequences. Mol Ecol Notes. 2007;7(6):965–968. doi: 10.1111/j.1471-8286.2007.01821.x. [DOI] [Google Scholar]
  • 32.Ronquist F, Huelsenbeck JP. MRBAYES3: Bayesian phylogenetic inference under mixed models. Bioinformatics. 2003;19:1572–1574. doi: 10.1093/bioinformatics/btg180. [DOI] [PubMed] [Google Scholar]
  • 33.Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol. 2013;30(12):2725–2729. doi: 10.1093/molbel/mst197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Suchard MA, Lemey P, Baele G, Ayres DL, Drummond AJ, Rambaut A. Bayesian phylogenetic and phylodynamic data integration using BEAST 1.10. Virus Evol. 2018;4:vey016. doi: 10.1093/ve/vey016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Excoffier L, Laval G, Schneider S. ARLEQUIN, version 3.11: an integrated software package for population genetics data analysis. Evol Bioinformatics Online. 2005;1:47–50. [PMC free article] [PubMed] [Google Scholar]
  • 36.Nei M. Molecular evolutionary genetics. New York: Columbia University Press; 1987. p. 407. [Google Scholar]
  • 37.Tajima F. Evolutionary relationship of DNA sequences in finite populations. Genetics. 1983;105:437–460. doi: 10.1093/genetics/105.2.437. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Bandelt HJ, Forster P, Rohl A. Median-joining networks for inferring intraspecific phylogenies. Mol Biol Evol. 1999;16:37–48. doi: 10.1093/oxfordjournals.molbev.a026036. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The Mus haplotypes registered by us were deposited in the GenBank (https://www.ncbi.nlm.nih.gov/genbank/)

MT036344- MT036364


Articles from BMC Zoology are provided here courtesy of BMC

RESOURCES