Abstract
Background
Sauchinone is extracted from the root of Saururus chinensis and exhibits potent antitumor effects in various human cancers. However, how sauchinone is involved in breast cancer has not been well studied.
Methods
Cells apoptosis, cell proliferation, and cycle distribution were evaluated. Xenograft tumor mouse model was constructed to investigate the roles of sauchinone. The relevant protein expression was detected by western blot.
Results
We found that sauchinone significantly reduced proliferation and survival, also induced apoptosis of MCF‐7 and Bcap‐37 cells in vitro. Sauchinone significantly increased miR‐148a‐3p expression, and human epidermal growth factor receptor (HER)‐2 targeted on miR‐148a‐3p. Sauchinone exposure downregulated HER‐2 expression whose overexpression partly eliminated the inhibitory effect of sauchinone. Further, sauchinone efficiently inhibited breast cancer progression through downregulating HER‐2 expression in vivo.
Conclusion
Our results indicate that sauchinone efficiently inhibits breast cancer progression through regulating miR‐148a‐3p/HER‐2 axis, suggesting that sauchinone could be an effective anticancer agent for breast cancer.
Keywords: apoptosis, breast cancer, miR‐148a‐3p, proliferation, sauchinone
Sauchinone efficiently inhibits breast cancer progression through regulating miR‐148a‐3p/HER‐2 axis.

INTRODUCTION
Breast cancer is a common type of cancer and accounts for 16% of cancer deaths among adult women. 1 For breast cancer, current therapies are multimodal majorly including drug therapy, surgery, and radiation. 2 Despite dramatic advances in breast cancer diagnosis, it is still a major health challenge. 3 Therefore, a better understanding of the complex mechanism in this disease contributes to develop efficient anticancer agents for breast cancer.
Sauchinone is isolated from the roots of Saururus chinensis (SC), and is reported to have hepatoprotective, antioxidant, and antitumor properties. 4 However, for breast cancer, sauchinone can downregulate the expression of vascular endothelial growth factor (VEGF), proliferation‐related gene including cyclin D1, and anti‐apoptotic Bcl‐2, which are responsible for apoptosis through the caspase‐3 activation. 5 However, the specific molecular mechanism of sauchinone in breast cancer remains unclear.
Human epidermal growth factor receptor (HER)‐2 is a proto‐oncogene 6 and highly expressed HER‐2 has been observed in prostate, lung, bladder, pancreatic cancer, and osteosarcoma. 7 In breast cancer, ~15% to 20% of patients exhibit obvious overexpression of HER2, which results in a poorer prognosis and survival. 8 Therefore, the identification and development of antitumor agent targeting HER‐2 could be used for HER2‐positive breast cancer patients. MicroRNAs (miRNAs) are reported to be involved in breast cancer. MicroRNA‐223 can promote breast cancer cell proliferation by targeting FOXO 1 and function as a potential tumor marker. 9 In addition, a series of studies have indicated that abnormal miRNA expression involved in invasion, metastasis, and resistance to chemotherapy, and also can act as biomarkers in breast cancer. 10 , 11 MicroRNA‐21 and MicroRNA‐210 are closely involved in breast cancer invasion and poor prognosis. 12 MiR‐148a‐3p inhibits breast cancer progression through downregulating WNT1. 13 Furthermore, the miR‐148a‐3p/HER‐2 axis has been identified as predictive signature to evaluate the breast cancer patients respond to single agent trastuzumab‐based neoadjuvant therapy. 14 However, whether miR‐148a‐3p is involved in sauchinone treatment and the interaction with HER‐2 is still unknown. In this study, the antitumor effect of sauchinone for breast cancer was investigated. In mechanism aspect, the relationship between it and existing miR‐148a‐3p/HER‐2 signature would also be discussed.
MATERIALS AND METHODS
Materials
Sauchinone was obtained from Nature‐standard (purity >98%) and used for subsequent experiments in this study. The structural formula of sauchinone is shown in Figure 1.
FIGURE 1.

Sauchinone significantly inhibited MCF‐7 and Bcap‐37 cell function. (a) The structural formula of sauchinone. (b) MCF‐7 and Bcap‐37 cell viability was detected by ent‐sauchinone (20, 40, 80, 160, and 320 μM) or dimethyl sulfoxide vehicle (control) for 48 h, or treated with sauchinone (0, 50, and 100 μg/mL) for indicated times. (c), (d) Cell proliferation of MCF‐7 (c) and Bcap‐37 cells (d) was measured. (e), (f) The numbers of colony formation of MCF‐7 (e) and Bcap‐37 (f) cells were evaluated and counted by a microscope.
Cell culture
From the American Type Culture Collection, MCF‐7, and Bcap‐37 (human breast cancer cell lines) were obtained and cultured with Roswell Park Memorial Institute (RPMI)‐1640 medium containing 10% fetal bovine serum (FBS) with 5% CO2 at 37°C.
Cell transfection
MCF‐7 and Bcap‐37 cells were transfected with miR‐148a‐3p mimics and negative control miR (miR‐NC) (Sigma Aldrich) by Lipofectamine 2000. MiR‐148a‐3p antagomir was transfected with Lipofectamine RNAi MAX Kit. After 48 h for transfection, the efficiency of transfection was determined by quantitative reverse transcription (qRT)‐polymerase chain reaction (PCR).
Luciferase reporter assay
The fragments of 3′untranslated regions (3′UTR) HER‐2 containing mutant type (MUT) and wild‐type (WT) of binding site with miR‐148a‐3p were inserted into pRL (pRL vectors are wild‐type Renilla luciferase control vectors) reporter plasmid to construct the luciferase reporter plasmids. The luciferase reporter plasmids were co‐transfected with miR‐NC or miR‐148a‐3p mimic into cell lines. Luciferase activity was detected after transfection for 48 h.
Cell viability assay
In 96‐well plates, Bcap‐37 and MCF‐7 Cells (7 × 103 cells/well) were seeded and incubated for 24 h at 37°C. Next, various concentrations of sauchinone were added to cells for 48 h. After incubation, 3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide staining was permed to evaluate the cell viability.
Cell counting kit‐8 assay
In 96‐well plates, approximately 1 × 103 cells were plated, then different concentrations of sauchinone (0, 50, and 100 μg/mL) was incubated cells for different times. Finally, cell viability was detected.
Colony formation assay
As previously described, 15 ~1000 cells were plated in 6‐well plates for 2 weeks. The numbers of colonies were counted after cells were stained with 1% crystal violet dye.
Transwell assay
As previously described, 16 using 24‐well Transwell plates, cell invasiveness was performed. Briefly, approximately 1 × 105 cells were plated into the upper chambers contained medium without serum. However, the medium in the lower chambers were filled with 20% FBS. Crystal violet was used to stain cells after 24 h culture. Without coating the membranes with Matrigel, the migration assay was performed similarly with invasion assay.
Cell‐cycle and apoptosis analysis
In 6‐well plates, approximately 1 × 105 cells/mL MCF‐7 and Bcap‐37 cells were plated and treated with various concentrations of sauchinone. Cells were stained for 30 min with 50 μg/mL propidium iodide (PI) solution and cell percentage at specific phases was detected by a FACSCalibur cytometry. Cells were treated with 100 μg/mL sauchinone, and apoptosis rate was analyzed with a Annexin V‐FITC/PI apoptosis detection kit as previously described. 17
qRT‐PCR
Total RNA samples of cultured cells were extracted. PCR reactions were performed with glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) and U6 as the internal reference. The target gene expression was calculated by 2−ΔΔCt method. 18 MiR‐148a‐3p: 5′‐ CCCGGATTCGCAAACTCAGCTTTAC ‐3′; 5′‐ CGGAATTCGTTGCGACCGTGATACC ‐3′; HER‐2: 5′‐ AGAAAGTGGTGCCATTTTTG ‐3′, 5′‐ AGCAGATGCCCATGCTTTCT ‐3′; U6 forward: 5′‐GACCGATTCGTTCTGTGGCAC‐3′, 5′‐GATTACCCGTCGGCCATCGATC‐3′; GAPDH: 5′‐ GAAGGTGAAGGTCGGAGTC ‐3′, 5′‐ GAAGATGGTGATGGGATTTC ‐3′.
Western blotting
Total protein from cultured cells or tumors was extracted. Approximately 50 μg samples were separated and transferred to polyvinylidene fluoride membranes. Primary antibodies including HER‐2 (1:1000, MA5‐13675, Abcam) and β‐actin (1:1000, Ab8227, Abcam) incubated the membrane at 4°C overnight. The membranes were incubated with horseradish peroxidase ‐labeled immunoglobulin G and visualized with Bio‐Rad imaging system.
Xenograft model
As previously described with minor modulation, 19 a total of 1 × 106 Bcap‐37 cells were subcutaneously inoculated into nude BALB/c mice (4‐week‐old and female). Mice were treated for 3 days with or without miR‐148a‐3p antagomir 80 mg/kg/day via intravenous tail injections, phosphate‐buffered saline (PBS) as the control. In each group, mice were treated with or without 5 mg/kg sauchinone every day for 5 days (PBS was used as control). Tumor volume was calculated: V = 0.524 × L × W2. Finally, mice were euthanized, and then the size and weight of tumors was evaluated.
Ki‐67 staining assay
Xenograft tumors was isolated from mice and embedded in paraffin. With anti‐Ki67 antibody as described previously, 20 these 4 μM‐thick sections were immunohistochemically stained.
Statistical analysis
All data are presented as the means ± standard error (SE) method. Statistical analysis was performed using the SPSS software (version 18.0), and Student's t‐test was conducted to compare the difference between two groups. The value p < 0.05 was considered as the significant threshold.
RESULTS
Sauchinone inhibits breast cancer cell function
The molecular structure of sauchinone was showed in Figure 1(a). The cell viability treated by sauchinone was evaluated in a dose dependent manner (Figure 1(b)). IC50 values of sauchinone against MCF‐7 and Bcap‐37 were 97.8 ± 0.58 μM and 102.1 ± 2.11 L μM. Sauchinone significantly inhibited the MCF‐7 (Figure 1(c)) (p < 0.01) and Bcap‐37 (Figure 1(d)) (p < 0.01) cell viability. Furthermore, the colony formation of MCF‐7 (Figure 1(e)) (p < 0.01) and Bcap‐37 cells (Figure 1f)) (p < 0.01) was significantly decreased by sauchinone treatment. The results indicated that sauchinone can inhibit breast cancer cell viability, cell colony formation, and proliferation via a low dosage.
Sauchinone significantly inhibits breast cancer cell migration and invasion
A total of 100 μM sauchinone significantly inhibited MCF‐7 and Bcap‐37 cell migration and invasion (Figure 2(a),(b)) (p < 0.01), indicating that sauchinone reduced the breast cancer cell migration and invasion. The results indicated that sauchinone may contribute to inhibit breast cancer cell metastasis via a low dosage.
FIGURE 2.

Sauchinone significantly inhibited breast cancer migration and invasion. The MCF‐7 and Bcap‐37 cells were treated with sauchinone (0, 50, and 100 μg/mL). The migration (a) and invasion (b) capacity was detected by transwell assay.
Sauchinone induces breast cancer cell apoptosis
Next, results demonstrate that sauchinone significantly decreased S phase and G2/M phase cells and increased G0/G1 phase cells both in MCF‐7 and Bcap‐37 cells (p < 0.05) (Figure 3(a)). Meanwhile, sauchinone remarkably induced apoptosis of two cell lines (p < 0.01) (Figure 3(b)), suggesting that sauchinone‐induced breast cancer cell apoptosis is followed by arresting cells at the G0/G1 phase.
FIGURE 3.

Sauchinone induced breast cancer cell apoptosis. The MCF‐7 and Bcap‐37 cells were treated with sauchinone (0, 50, and 100 μg/mL). Effect of sauchinone on cell cycle (a) and apoptosis rates (b) was detected.
Sauchinone inhibits breast cancer progression through upregulating microRNA‐148a‐3p
For investigating the specific molecular mechanism of sauchinone in breast cancer progression, MCF‐7 and Bcap‐37 cells were treated with 100 μg/mL sauchinone, and results showed that sauchinone significantly enhanced miR‐148a‐3p expression (p < 0.01) (Figure 4(a)). After MCF‐7 and Bcap‐37 cells were transfected with miR‐148a‐3p antagomir, the efficiency of transfection was determined by qRT‐PCR (Figure 4(b)) (p < 0.01). Moreover, combining miR‐148a‐3p antagomir with sauchinone significantly attenuated sauchinone‐induced cell apoptosis (p < 0.01) (Figure 4(c)). These indicate that sauchinone inhibits breast cancer cell growth through upregulating miR‐148a‐3p.
FIGURE 4.

Sauchinone downregulated human epidermal growth factor receptor (HER)‐2 expression through inducing miR‐148a‐3p. (a) After treated with or without 100 μg/mL sauchinone, HER‐2 mRNA in MCF‐7 and Bcap‐37 cells were detected. (b) miR‐148a‐3p mRNA level was measured. (c) The apoptosis rate was detected by flow cytometry. (d) The predicted binding site of miR‐148a‐3p with the 3′ untranslated region of HER‐2 based on Targetscan. (e) Luciferase reporter assay. (f), (g) The mRNA (f) and protein (g) expression of HER‐2 was detected. *p < 0. 05, **p < 0.01 versus control group.
HER‐2 was a direct target of microRNA‐148a‐3p
To explore the molecular targets of miR‐148a‐3p, prediction results based on the TargetScan database revealed that there was a putative binding site of miR‐148a‐3p on 3′UTR of HER‐2 (Figure 4(d)). To test this, we found that luciferase activity of HER‐2‐WT in two cell lines was reduced after transfection with miR‐148a‐3p mimic, whereas no obvious change was observed in HER‐2‐MUT (Figure 4(e)) (p < 0.01). Meanwhile, miR‐148a‐3p mimic significantly inhibited HER‐2 expression (Figure 4(f),(g)) (p < 0.01), we also found that HER‐2 expression could significantly inhibited miR‐148a‐3p expression (Figure S1). These suggest that HER‐2 is a target of miR‐148a‐3p.
Sauchinone inhibited breast cancer cell growth through downregulating HER‐2
Next, we explored whether sauchinone inhibits breast cancer progression through HER‐2 and found that sauchinone significantly decreased the mRNA (Figure 5(a)) (p < 0.01) and protein level (Figure 5(b)) (p < 0.01) of HER‐2 compared with control both in two cell lines. Meanwhile, sauchinone significantly decreased HER‐2 expression, and miR‐148a‐3p antagomir could rescue sauchinone‐induced inhibition in HER‐2 expression both in Bcap‐37 and MCF‐7 cells (p < 0.01) (Figure 5(c) and Figure S2). Next, rescue experiments were performed, and qRT‐PCR results showed that HA‐HER‐2 efficiently increased the expression of HER‐2 compared with HA‐vector (negative control) both in two cell lines (Figure 5(d)) (p < 0.01). Moreover, HER‐2 overexpression significantly attenuated the inhibition of sauchinone on the growth of two cell lines (p < 0.01) (Figure 5(e),(f)). These indicate that sauchinone inhibits breast cancer cell growth through miR‐148a‐3p‐mediated downregulation of HER‐2. In addition, we also demonstrated miR‐148a‐3p mediated response to HER2 monoclonal antibody of trastuzumab (Figure S3) (p < 0.01).
FIGURE 5.

Sauchinone inhibited breast cancer cell growth through inhibiting the expression of human epidermal growth factor receptor (HER)‐2. (a), (b) The mRNA (a) and protein (b) expression of HER‐2 was detected. (c) The HER‐2 protein was detected. (d) mRNA level of HER‐2 was detected. (e), (f) Cell viability was measured.
Sauchinone inhibited breast cancer progression through downregulating HER‐2 in vivo
Finally, on a xenograft model in vivo, we evaluated the antitumor effect of sauchinone based. We found that sauchinone could significantly decrease tumor size tumor weight and tumor volume, but these effects were rescued after miR‐148a‐3p transfection (Figure 6(a)–(c)) (p < 0.01). The similar trend was also observed in Ki‐67 staining results (Figure 6(d)). Meanwhile, the expression of HER‐2 was dramatically downregulated in sauchinone treatment group, but it was also rescued by miR‐148a‐3p overexpression (Figure 6(e)) (p < 0.01). All these results further confirm that sauchinone plays a potential antitumor role through miR‐148a‐3p mediated downregulation of HER‐2 in breast cancer.
FIGURE 6.

Sauchinone inhibited breast cancer progression via miR‐148a‐3p in vivo. (a) Representative xenograft tumor images. (b), (c) Tumor weight and volume of xenograft tumors. (d) Ki‐67 staining of xenograft tumors. (e) The human epidermal growth factor receptor‐2 protein expression in xenograft tumors was detected.
DISCUSSION
In the last decades, several natural products, including sauchinone, curcumin, lycopene, genipin, denbinobin, capsaicin, and ursolic acid, have been identified to show potent antitumor effect in breast cancer. 21 Lycopene exerts antitumor effects by inactivating of AKT and ERKs signaling pathways. 22 Genipin was reported to induce apoptosis through upregulating Bax expression and downregulating Bcl‐2 expression. 23 Through regulating Src‐mediated signaling pathways, denbinobin can inhibit breast cancer metastasis. 24 Capsaicin could induce apoptosis through regulating epidermal growth factor receptor/HER‐2 pathway. 25 Ursolic acid has been reported to inhibit progression of breast cancer through affecting apoptosis related protein expression. 26 , 27 Therefore, the identification of potential anticancer agents for breast cancer is still urgent.
In various human cancers, sauchinone has also been shown to act a crucial antitumor role. Sauchinone has been identified to prevent gastric cancer progression through inhibiting transforming growth factor‐β‐induced metastasis. 28 Sauchinone exerts a potential anticancer effect in hepatocellular carcinoma through modulating AMPK signaling pathway. 29 Whereas in breast cancer, sauchinone has also been reported to exhibit antitumor effect and the specific mechanism is not well known. Only one previous study has demonstrated that sauchinone exerts anticancer effect through regulating proliferation and apoptosis‐related gene expression. 5 In this study, we revealed a new mechanism of sauchinone involved in breast cancer and found it efficiently inhibits breast cancer progression through downregulating HER‐2 by inducing miR‐148a‐3p.
MiR‐148a‐3p has been reported to participate in many biological processes in various human cancers. For example, miR‐148a‐3p can inhibit progression of epithelial ovarian cancer through directly inhibiting the expression of c‐Met, 30 inhibit esophageal cancer invasion and proliferation by targeting DNMT1, 31 and repress proliferation and Epithelial‐Mesenchymal Transition (EMT) through regulating ERBB3/c‐Myc pathway in bladder cancer. 32 In addition, the abnormal miR‐148a‐3p expression suggests it as a biomarker in multiple human cancers, including prostate cancer, colorectal cancer, and osteosarcoma cell. 33 , 34 , 35 Here, in breast cancer cell lines, our results demonstrate that sauchinone significantly induces miR‐148a‐3p and miR‐148a‐3p antagomir efficiently rescues sauchinone‐induced inhibition.
HER‐2 is often highly expressed in human cancers and serves as a direct target gene of miRNAs to affect human cancer progression, including breast cancer. MiR‐9 inhibits tumor engraftment, migration and colony formation of breast cancer cells by directly targeting HER‐2. 36 Long noncoding RNAs SNHG20 can promote breast cancer progression by targeting miR‐495/HER‐2 axis. 37 However, in breast cancer, the role of miR‐148a‐3p/HER‐2 remains unclear. Here, HER‐2 is identified to be a direct target of miR‐148a‐3p. Meanwhile, sauchinone significantly downregulated HER‐2 expression, and miR‐148a‐3p antagomir could reverse sauchinone‐induced inhibition in HER‐2 expression. Overexpression of HER‐2 significantly attenuated the effect of sauchinone on breast cancer. Finally, sauchinone was found to be able to efficiently prevent breast cancer progression with a significant decrease of HER‐2 expression in vivo. Although HER‐2 overexpression significantly attenuates the inhibitory effect of sauchinone in vitro, further experiment is needed to apply HER‐2 overexpression in the xenograft model to further confirm the role of sauchinone in breast cancer.
In this study, we have revealed the potential target for sauchinone. In the future possible clinical application, the expression of HER‐2/miR‐148a‐3p may be a prognostic biomarker. However, there may be more biomarkers for sauchinone. The mechanisms of sauchinone in breast cancer should also be identified in future work. More biomarker molecular about sauchinone should also be identified in future work. These markers together would form a panel to provide a more complete perspective or the pharmacology, toxicology, and drug resistance of sauchinone in future.
CONCLUSION
In summary, our study showed that sauchinone inhibited breast cancer progression through downregulating HER‐2 expression by inducing miR‐148a‐3p. This study suggests that sauchinone acts as an efficient anticancer agent for breast cancer, and miR‐148a‐3p/HER‐2 axis may be a potential target for breast cancer treatment.
AUTHOR CONTRIBUTIONS
Xiaolei Hu, Jie Wang, Pei Shang, Guangyu Yao: Concept, manuscript writing, editing and review. Shan Wang, Lujia Chen, Changsheng Ye: Data collection and analysis, manuscript preparation. All authors have read and approve the submission of the manuscript.
CONFLICT OF INTEREST STATEMENT
The authors declare no conflicts of interest.
Supporting information
Figure S1. The mRNA expression of miR‐148a‐3p was detected.
Figure S2. Sauchinone inhibits breast cancer cell growth through miR‐148a‐3p‐mediated downregulation of HER‐2.
Figure S3. Trastuzumab inhibits breast cancer cell growth through miR‐148a‐3p‐mediated downregulation of HER‐2.
ACKNOWLEDGMENTS
We thank the financial support from Natural Science Foundation of Guangdong Province (2019A1515011331).
Hu X, Wang J, Shang P, Wang S, Chen L, Ye C, et al. Sauchinone inhibits breast cancer cell proliferation through regulating microRNA‐148a‐3p/HER‐2 axis. Thorac Cancer. 2023;14(13):1135–1144. 10.1111/1759-7714.14834
Xiaolei Hu, Jie Wang, and Pei Shang contributed equally to this work.
Contributor Information
Xiaolei Hu, Email: xlhu@smu.edu.cn.
Guangyu Yao, Email: ygy531@hotmail.com.
DATA AVAILABILITY STATEMENT
The data that support the findings of this study are available on request from the corresponding author.
REFERENCES
- 1. Anderson BO, Braun S, Lim S, Smith RA, Taplin S, Thomas DB. Early detection of breast cancer in countries with limited resources. Breast J. 2003;9(Suppl 2):S51–9. [DOI] [PubMed] [Google Scholar]
- 2. Wormann B. Breast cancer: basics, screening, diagnostics and treatment. Med Monatsschr Pharm. 2017;40:55–64. [PubMed] [Google Scholar]
- 3. Anastasiadi Z, Lianos GD, Ignatiadou E, Harissis HV, Mitsis M. Breast cancer in young women: an overview. Updates Surg. 2017;69:313–7. [DOI] [PubMed] [Google Scholar]
- 4. Deng Y, Jin F, Li X, Park SJ, Chang JH, Kim DY, et al. Sauchinone suppresses FcεRI‐mediated mast cell signaling and anaphylaxis through regulation of LKB1/AMPK axis and SHP‐1‐Syk signaling module. Int Immunopharmacol. 2019;74:105702. [DOI] [PubMed] [Google Scholar]
- 5. Kim HY, Choi TW, Kim HJ, Kim SM, Park KR, Jang HJ, et al. A methylene chloride fraction of Saururus chinensis induces apoptosis through the activation of caspase‐3 in prostate and breast cancer cells. Phytomedicine. 2011;18:567–74. [DOI] [PubMed] [Google Scholar]
- 6. Slamon DJ, Godolphin W, Jones LA, Holt JA, Wong SG, Keith DE, et al. Studies of the HER‐2/neu proto‐oncogene in human breast and ovarian cancer. Science (New York, NY). 1989;244:707–12. [DOI] [PubMed] [Google Scholar]
- 7. Fanotto V, Ongaro E, Rihawi K, Avallone A, Silvestris N, Fornaro L, et al. HER‐2 inhibition in gastric and colorectal cancers: tangible achievements, novel acquisitions and future perspectives. Oncotarget. 2016;7:69060–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Robidoux A, Tang G, Rastogi P, Geyer CE Jr, Azar CA, Atkins JN, et al. Lapatinib as a component of neoadjuvant therapy for HER2‐positive operable breast cancer (NSABP protocol B‐41): an open‐label, randomised phase 3 trial. Lancet Oncol. 2013;14:1183–92. [DOI] [PubMed] [Google Scholar]
- 9. Wei YT, Guo DW, Hou XZ, Jiang DQ. miRNA‐223 suppresses FOXO1 and functions as a potential tumor marker in breast cancer. Cell Mol Biol (Noisy‐le‐grand). 2017;63:113–8. [DOI] [PubMed] [Google Scholar]
- 10. Graveel CR, Calderone HM, Westerhuis JJ, Winn ME, Sempere LF. Critical analysis of the potential for microRNA biomarkers in breast cancer management. Breast Cancer. 2015;7:59–79. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Iorio MV, Casalini P, Piovan C, Braccioli L, Tagliabue E. Breast cancer and microRNAs: therapeutic impact. Breast. 2011;20(Suppl 3):S63–70. [DOI] [PubMed] [Google Scholar]
- 12. Tang Y, Zhou X, Ji J, Chen L, Cao J, Luo J, et al. High expression levels of miR‐21 and miR‐210 predict unfavorable survival in breast cancer: a systemic review and meta‐analysis. Int J Biol Markers. 2015;30:e347–58. [DOI] [PubMed] [Google Scholar]
- 13. Han L, Yan Y, Zhao L, Liu Y, Lv X, Zhang L, et al. LncRNA HOTTIP facilitates the stemness of breast cancer via regulation of miR‐148a‐3p/WNT1 pathway. J Cell Mol Med. 2020;24(11):6242–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Di Cosimo S, Appierto V, Pizzamiglio S, Silvestri M, Baselga J, Piccart M, et al. Early modulation of circulating MicroRNAs levels in HER2‐positive breast cancer patients treated with trastuzumab‐based neoadjuvant therapy. Int J Mol Sci. 2020;21:1386. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Zheng A, Song X, Zhang L, Zhao L, Mao X, Wei M, et al. Long non‐coding RNA LUCAT1/miR‐5582‐3p/TCF7L2 axis regulates breast cancer stemness via Wnt/beta‐catenin pathway. J Exp Clin Cancer Res. 2019;38:305. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Sun X, Hu Y, Wu J, Shi L, Zhu L, Xi PW, et al. RBMS2 inhibits the proliferation by stabilizing P21 mRNA in breast cancer. J Exp Clin Cancer Res. 2018;37:298. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Sharma P, Kumar S. Metformin inhibits human breast cancer cell growth by promoting apoptosis via a ROS‐independent pathway involving mitochondrial dysfunction: pivotal role of superoxide dismutase (SOD). Cell Oncol (Dordr). 2018;41:637–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Arocho A, Chen B, Ladanyi M, Pan Q. Validation of the 2‐DeltaDeltaCt calculation as an alternate method of data analysis for quantitative PCR of BCR‐ABL P210 transcripts. Diagn Mol Pathol. 2006;15:56–61. [DOI] [PubMed] [Google Scholar]
- 19. Liang Y, Song X, Li Y, Chen B, Zhao W, Wang L, et al. LncRNA BCRT1 promotes breast cancer progression by targeting miR‐1303/PTBP3 axis. Mol Cancer. 2020;19:85. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 20. Gao X, Qin T, Mao J, Zhang J, Fan S, Lu Y, et al. PTENP1/miR‐20a/PTEN axis contributes to breast cancer progression by regulating PTEN via PI3K/AKT pathway. J Exp Clin Cancer Res. 2019;38:256. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Ko EY, Moon A. Natural products for chemoprevention of breast cancer. J Cancer Prev. 2015;20:223–31. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Holzapfel NP, Holzapfel BM, Theodoropoulos C, Kaemmerer E, Rausch T, Feldthusen J, et al. Lycopene's effects on cancer cell functions within monolayer and spheroid cultures. Nutr Cancer. 2016;68:350–63. [DOI] [PubMed] [Google Scholar]
- 23. Kim ES, Jeong CS, Moon A. Genipin, a constituent of Gardenia jasminoides Ellis, induces apoptosis and inhibits invasion in MDA‐MB‐231 breast cancer cells. Oncol Rep. 2012;27:567–72. [DOI] [PubMed] [Google Scholar]
- 24. Chen PH, Peng CY, Pai HC, Teng CM, Chen CC, Yang CR. Denbinobin suppresses breast cancer metastasis through the inhibition of Src‐mediated signaling pathways. J Nutr Biochem. 2011;22:732–40. [DOI] [PubMed] [Google Scholar]
- 25. Thoennissen NH, O'Kelly J, Lu D, Iwanski GB, La DT, Abbassi S, et al. Capsaicin causes cell‐cycle arrest and apoptosis in ER‐positive and ‐negative breast cancer cells by modulating the EGFR/HER‐2 pathway. Oncogene. 2010;29:285–96. [DOI] [PubMed] [Google Scholar]
- 26. Wang JS, Ren TN, Xi T. Ursolic acid induces apoptosis by suppressing the expression of FoxM1 in MCF‐7 human breast cancer cells. Med Oncol. 2012;29:10–5. [DOI] [PubMed] [Google Scholar]
- 27. Yeh CT, Wu CH, Yen GC. Ursolic acid, a naturally occurring triterpenoid, suppresses migration and invasion of human breast cancer cells by modulating c‐Jun N‐terminal kinase, Akt and mammalian target of rapamycin signaling. Mol Nutr Food Res. 2010;54:1285–95. [DOI] [PubMed] [Google Scholar]
- 28. He Z, Dong W, Li Q, Qin C, Li Y. Sauchinone prevents TGF‐β‐induced EMT and metastasis in gastric cancer cells. Biomed Pharmacother. 2018;101:355–61. [DOI] [PubMed] [Google Scholar]
- 29. Kim YW, Jang EJ, Kim CH, Lee JH. Sauchinone exerts anticancer effects by targeting AMPK signaling in hepatocellular carcinoma cells. Chem Biol Interact. 2017;261:108–17. [DOI] [PubMed] [Google Scholar]
- 30. Wang W, Dong J, Wang M, Yao S, Tian X, Cui X, et al. miR‐148a‐3p suppresses epithelial ovarian cancer progression primarily by targeting c‐met. Oncol Lett. 2018;15:6131–6. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 31. Wang Y, Hu Y, Guo J, Wang L. miR‐148a‐3p suppresses the proliferation and invasion of esophageal cancer by targeting DNMT1. Genet Test Mol Biomarkers. 2019;23:98–104. [DOI] [PubMed] [Google Scholar]
- 32. Wang X, Liang Z, Xu X, Li J, Zhu Y, Meng S, et al. miR‐148a‐3p represses proliferation and EMT by establishing regulatory circuits between ERBB3/AKT2/c‐myc and DNMT1 in bladder cancer. Cell Death Dis. 2016;7:e2503. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Ardila HJ, Sanabria‐Salas MC, Meneses X, Rios R, Huertas‐Salgado A, Serrano ML. Circulating miR‐141‐3p, miR‐143‐3p and miR‐200c‐3p are differentially expressed in colorectal cancer and advanced adenomas. Mol Clin Oncol. 2019;11:201–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Bhattacharya S, Chalk AM, Ng AJM, Martin TJ, Zannettino AC, Purton LE, et al. Increased miR‐155‐5p and reduced miR‐148a‐3p contribute to the suppression of osteosarcoma cell death. Oncogene. 2016;35:5282–94. [DOI] [PubMed] [Google Scholar]
- 35. Dybos SA, Flatberg A, Halgunset J, Viset T, Rolfseng T, Kvam S, et al. Increased levels of serum miR‐148a‐3p are associated with prostate cancer. APMIS. 2018;126:722–31. [DOI] [PubMed] [Google Scholar]
- 36. Sun G, Sun L, Liu Y, Xing H, Wang K. Her‐2 expression regulated by downregulation of miR‐9 and which affects chemotherapeutic effect in breast cancer. Cancer Gene Ther. 2017;24:194–202. [DOI] [PubMed] [Google Scholar]
- 37. Guan YX, Zhang MZ, Chen XZ, Zhang Q, Liu SZ, Zhang YL. Lnc RNA SNHG20 participated in proliferation, invasion, and migration of breast cancer cells via miR‐495. J Cell Biochem. 2018;119:7971–81. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Figure S1. The mRNA expression of miR‐148a‐3p was detected.
Figure S2. Sauchinone inhibits breast cancer cell growth through miR‐148a‐3p‐mediated downregulation of HER‐2.
Figure S3. Trastuzumab inhibits breast cancer cell growth through miR‐148a‐3p‐mediated downregulation of HER‐2.
Data Availability Statement
The data that support the findings of this study are available on request from the corresponding author.
