Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2023 May 2.
Published in final edited form as: J Cell Physiol. 2023 Feb 6;238(3):647–658. doi: 10.1002/jcp.30957

Deacetylase-dependent and -independent role of HDAC3 in cardiomyopathy

Jieyu Ren 1,#, Qun Zeng 1,#, Hongmei Wu 1, Xuewen Liu 1, Maria C Guida 2, Wen Huang 3, Yiyuan Zhai 1, Junjie Li 1, Karen Ocorr 2, Rolf Bodmer 2, Min Tang 1
PMCID: PMC10152801  NIHMSID: NIHMS1882545  PMID: 36745702

Abstract

Cardiomyopathy is a common disease of cardiac muscle that negatively affects cardiac function. HDAC3 commonly functions as corepressor by removing acetyl moieties from histone tails. However, a deacetylase-independent role of HDAC3 has also been described. Cardiac deletion of HDAC3 causes reduced cardiac contractility accompanied by lipid accumulation, but the molecular function of HDAC3 in cardiomyopathy remains unknown. We have used powerful genetic tools in Drosophila to investigate the enzymatic and nonenzymatic roles of HDAC3 in cardiomyopathy. Using the Drosophila heart model, we showed that cardiac-specific HDAC3 knockdown (KD) leads to prolonged systoles and reduced cardiac contractility. Immunohistochemistry revealed structural abnormalities characterized by myofiber disruption in HDAC3 KD hearts. Cardiac-specific HDAC3 KD showed increased levels of whole-body triglycerides and increased fibrosis. The introduction of deacetylase-dead HDAC3 mutant in HDAC3 KD background showed comparable results with wild-type HDAC3 in aspects of contractility and Pericardin deposition. However, deacetylase-dead HDAC3 mutants failed to improve triglyceride accumulation. Our data indicate that HDAC3 plays a deacetylase-independent role in maintaining cardiac contractility and preventing Pericardin deposition as well as a deacetylase-dependent role to maintain triglyceride homeostasis.

Keywords: cardiac contractility, cardiomyopathy, deacetylase, Drosophila, fibrosis, Pericardin, triglycerides

1 |. INTRODUCTION

Cardiomyopathies are complex disorders that arise from a heterogeneous group of pathologies in cardiomyocytes. At the cellular level, cardiomyopathies are characterized by structural and functional changes that include imbalances in metabolic pathways (Pasqua et al., 2021), and extracellular matrix (ECM) deposition (L. Li et al., 2018). Histone deacetylases (HDACs) are enzymes that modulate gene transcription and have been shown to play roles in cardiac hypertrophy (Ooi et al., 2015). For example, mice with HDAC2 overexpression are sensitive to hypertrophic stimuli, whereas mice lacking HDAC2 are resistant to hypertrophic stress (Trivedi et al., 2007). On the other hand, mice lacking HDAC5 and HDAC9 are sensitized to cardiac stress signals and develop severe cardiac hypertrophy in response to pressure overload by inducing the re-expression of fetal genes (Zhang et al., 2002), suggesting the different roles for HDACs in cardiomyopathy.

HDAC3 has been shown to play unique roles in maintaining cardiac metabolic balance. Myosin Creatine Kinase (MCK)-Cre mediated cardiac deletion of HDAC3 after birth and has no obvious effect on cardiac function. However, severe cardiac hypertrophy was found in postnatal HDAC3-depleted mice upon switching to a high-fat diet (HFD), and was associated with decreased expression of fatty acid (FA) oxidation enzymes (Sun et al., 2011). Earlier cardiac-specific deletion of HDAC3 during embryo development by Myosin Heavy Chain (MHC)-αCre resulted in cardiac hypertrophy and fibrosis, accompanied by upregulation of genes involved in FA uptake and oxidation (Montgomery et al., 2008).

HDAC3 belongs to class I HDACs and exists as part of a complex that contains either nuclear receptor corepressor (NCoR) or its homolog silencing mediator of retinoic and thyroid receptors (SMRT; Perissi et al., 2010; Watson et al., 2012). HDAC3 is activated by physical interactions with the conserved deacetylase activating domain (DAD) in NCoR and SMRT (Guenther et al., 2001; Watson et al., 2012). HDAC3 commonly functions as a co-repressor by removing acetyl moieties from histone tails. However, a deacetylase-independent role of HDAC3 has also been identified. Global deletion of HDAC3 is embryonic lethal, whereas knock-in mice bearing the mutations in the DADs of both NCoR and SMRT (NS-DADm) live to adulthood despite undetectable deacetylase activity of HDAC3 in the embryo (Bhaskara et al., 2008; You et al., 2013). Furthermore, the nonenzymatic activity of HDAC3 silences the cardiac lineage genes through targeting the nuclear lamina to repress cardiac progenitor differentiation (Poleshko et al., 2017). HDAC3 also coordinates deacetylase-independent epigenetic silencing of Transforming Growth Factor-β1 to prevent the development of cardiac fibrosis (Lewandowski et al., 2015) and deacetylase-dead HDAC3 can partially rescue HDAC3-dependent phenotypes in the mouse liver (Sun et al., 2013). HDAC3 is necessary for epidermal stratification independent of its deacetylase activity (Szigety et al., 2020). However, the catalytic function of HDAC3 in cardiac performance remains unknown. Here we take advantage of Drosophila cardiac model and used deacetylase-dead transgenic mutant to investigate the enzymatic and nonenzymatic roles of HDAC3 in cardiomyopathy.

2 |. MATERIALS AND METHODS

2.1 |. Fly stocks

HDAC3 RNAi line (short Hairpin ID: SH00372.N) and UAS-control line (BL35787) were obtained from the Bloomington Drosophila Stock Center. A second HDAC3 RNAi line (short Hairpin ID: SH03161.N) was obtained from the stock center of Tsinghua University. The heart-specific driver hand 4.2 Gal4, described previously (Han & Olson, 2005), was used to drive HDAC3 short hairpin RNA interference fragment expression. Flies were reared and maintained on a standard cornmeal–yeast diet at 25°C. For HFD experiments, we collected 0- to 5-day-old newly enclosed flies that were collected and split into two groups, one fed the standard cornmeal-yeast diet, normal food (NF), and one fed an HFD consisting of the NF plus 30% coconut oil. Collected flies were maintained on NF or HFD for 5 days at 21°C.

2.2 |. Intravital imaging of Drosophila heart

A transgenic heart marker, R94C02::tdTomato was utilized for capturing movies to monitor heart function (Klassen et al., 2017). Adult flies were anesthetized using FlyNap (Carolina) and then glued to a coverslip through their dorsal side using optical adhesive glue (Noland #61). Heart beating of individual flies was recorded through the dorsal cuticle with a digital camera (Hamamatsu, ORCA-flash4.0LT, C11440) at 280 frames/s. Data were captured using HC Image software (Hamamatsu).

2.3 |. Semi-intact optical heart function analysis

Drosophila semi-intact heart preparations were prepared as described previously (Vogler & Ocorr, 2009). Movies of beating hearts were recorded for 30 s with a high-speed EM-CCD camera (Hamamatsu, C9300) at 130 frames/s. Data were captured using HC Image software (Hamamatsu). Movies were analyzed with Semi-automatic Optical Heartbeat Analysis software to quantify heart periods, systolic and diastolic intervals, systolic and diastolic diameters, fractional shortening, and arrhythmia indexes (defined as the standard deviation of the heart period normalized to the median of each fly) and to produce M-mode records (Cammarato et al., 2015; Fink et al., 2009).

2.4 |. Immunohistochemical staining of Drosophila heart

Semi-intact Drosophila hearts were prepared and fixed as described previously (Alayari et al., 2009). Hearts were stained with mouse monoclonal antibodies against Pericardin (Developmental Studies Hybridoma Bank [DSHB], #EC11) followed by Cy3 tagged secondary antibodies (Jackson ImmunoResearch #144931) or fluorescently tagged phalloidin (Cell Signaling Technology, # 8878S, 330 mM final concentration in PBS) directly. Stained hearts were imaged with the same exposure settings on a confocal microscope (LSM880). Pericardin fluorescent signal of the distal heart was quantified using ImageJ software.

2.5 |. Triglyceride assay

Female flies were starved on filter paper soaked in distilled water for 30 min and then placed into Eppendorf tubes for immediate quantification or frozen at −80°C for later processing. Three female flies per sample were homogenized in 300 μl ethanol and then spun at 4000g on centrifuge for 15 min. About 200 μl supernatant was transferred into a new EP tube and used for conducting the TAG assay (Nanjing Jiancheng in China, #A110–1-1). The 100 μl leftover was kept and added 200 μl PBS. The mixture was spun at 4000g on centrifuge for 15 min. Supernatant was transferred into a new EP tube and used for conducting Bradford protein assay (Solarbio, #PC0020). Relative TAG content was normalized to protein level.

For cardiac TAG assay, 20 female hearts per sample were dissected in artificial hemolymph and put into 100 μl ethanol. After homogenization and centrifugation, 70 μl of the supernatant was transferred into a new EP tube and used for conducting TAG assay. 30 μl leftovers were kept and added 60 μl PBS to conduct Bradford protein assay.

2.6 |. Western blots

For each lane, 10 female hearts were harvested and directly lysed in 10 μl RIPA buffer. Protein was separated by 10% SDS-PAGE gel and transferred to a PVDF membrane. The membrane was then probed with anti-Pericardin (DSHB, #EC11) and anti-actin (Invitrogen, #MA5–11869) antibodies, followed by horseradish peroxidase-conjugated secondary antibodies (Absin, #20001). Protein bands were visualized using enhanced chemiluminescence reagent (Beyotime, #P0018AS). Pericardin band intensity relative to actin was quantified with ImageJ software.

2.7 |. Quantitative PCR

Total RNA was extracted from 15 female hearts of each genotype with TRIzol reagent (Ambion #15596018). The samples were treated with DNase I (Qiagen) to remove DNA. Reverse transcription was performed using the reverse transcription kit (Thermo Fisher Scientific, #k1622) according to the manufacturer’s instructions. SYBR Green (Bimake, #B21202) was used as fluorescent dye for qPCR reaction. Thermal cycling and fluorescence monitoring were performed in StepOne Plus Real-Time PCR instrument (Applied Biosystems). The primers used are listed below.

Primers:

HDAC3-F: 5′TGAACTACGGACTGCACAAGAA3′

HDAC3-R: 5′CTTCGTATAGGCCACGGAATTG3′

2.8 |. Survivorship

The progeny of the hand Gal4 × UAS-control and hand Gal4 × UAS-HDAC3 RNAi crosses were collected and divided into two populations: one fed with NF and one fed with HFD. Flies were maintained at 21°C, and housed separately in groups of 25 flies per vial. Around 180 flies were prepared, and flipped to fresh food every third day; survival was scored following each transfer. Lifespan data are presented as Kaplan–Meier plots, and significance was determined using Mandel–Cox Log-rank test by GraphPad Software.

2.9 |. Statistics

All statistical analysis was performed using GraphPad Prism version 8.0 (GraphPad Software). Specific tests used are indicated in the figure legends.

3 |. RESULTS

3.1 |. HDAC3 is required to maintain adult heart physiological function

Cardiac-specific HDAC3 knockdown (KD) is achieved by crossing flies expressing heart-specific Gal4 driver (hand4.2 Gal4) with RNA interference line expressing short hairpin RNA targeting HDAC3 (short hairpin ID: SH00372.N), referred as HDAC3 KD. Quantitative polymerase chain reaction of isolated hearts showed that cardiac HDAC3 mRNA expression in KD hearts was 52.3% of that for control hearts (Supporting Information: Figure 1).

The cardiac phenotype induced by HDAC3 KD was quantified from high-speed movies of flies also expressing a transgenic heart marker R94C02::tdTomato (Klassen et al., 2017). Analysis of these movies showed irregular heartbeats and structural abnormalities (Supporting Information: Movies 1 and 2). We quantified the effects of cardiac-specific HDAC3 KD on cardiac function using the Semi-automated optical heartbeat analysis system (Fink et al., 2009). Cardiac-specific HDAC3 KD led to prolonged heart periods (Figure 1a), which was primarily due to prolonged systolic intervals (Figure 1b,c). KD of HDAC3 also affected cardiac contractility, measured as decreased fractional shortening (Figure 1d).

FIGURE 1.

FIGURE 1

Heart-specific HDAC3 KD causes cardiac physiological dysfunction. (a) Heart period, (b) systolic interval, (c) diastolic interval, (d) contractility quantified as fractional shortening, (e) systolic diameter, and (f) diastolic diameter were measured for hearts from wild-type control flies (the progeny of the crosses of Hand-Gal4 × UAS-control line, and flies with cardiac-specific HDAC3 knockdown (Hand>UAS-HDAC3 RNAi, SH00372.N). (g) Five-second M-modes from movies of control, HDAC3 KD. Fibrillation in HDAC3 KD is highlighted with red line. Note the significant systolic interval prolongation and decreased contractility in HDAC3 KD. Significance was determined using unpaired Student’s t tests. Differences relative to the control are indicated by individual asterisks; GraphPad statistical analysis, *p < 0.05, **p < 0.01, ****p < 0.0001. KD, knockdown. ns represents no significance. Sample size was 20–30 flies per genotype.

The cardiac phenotype induced by HDAC3 KD is also illustrated in the M-mode traces obtained from high-speed movies, which show heart wall movements over time. M-modes from HDAC3 KD hearts exhibited long pauses between beats (asystoles), and prolonged or multiple (fibrillatory) contractions (Figure 1g). The percentage of prolonged systoles per fly (>0.4 s, the average systolic interval for wild-type flies ranges from 0.15 to 0.25 s), was markedly elevated in HDAC3 KD flies compared with controls (Table 1). The percentage of prolonged diastoles per fly (>1 s, the average diastolic interval of wild-type flies ranges from 0.2 to 0.6 s), also increased in HDAC3 KD hearts (Table 1). Consistently, the percentage of flies with prolonged diastoles or systoles also increased in HDAC3 KD.

TABLE 1.

The prevalence of prolonged systoles and diastoles in HDAC3 KD.

% Long diastoles (>1 s) % Long systoles (>0.4 s) % Flies with DI > 1 s % Flies with SI > 0.4 s
Control 0.00 0.00 5.88 5.88
HDAC3 KD (SH00372.N) 1.82 3.90 19.23 34.62
HDAC3 KD (SH003161.N) 0.50 2.76 16.67 20.83

To confirm that the phenotype observed in HDAC3 KD flies was not due to off-target effects, another independent HDAC3 KD line (short hairpin ID: SH003161.N) was examined and displayed a similar phenotype of prolonged systolic intervals and reduced contractility (Supporting Information: Figure 2 and Table 1).

3.2 |. HDAC3 KD disrupted myofibrils integrity

The reduction in cardiac contractility with HDAC3 KD suggested that cardiac morphology in HDAC3 KD flies might also be affected. Control hearts stained for F-actin with Phalloidin showed densely organized myocardial fibers organized circumferentially around the heart tube. In contrast, HDAC3 KD hearts exhibited morphological abnormalities, demonstrated by fragmented myofibrils (Figure 2b) and even the vacuoles forming (Figure 2c) within cardiomyocytes.

FIGURE 2.

FIGURE 2

Heart-specific HDAC3 knockdown (KD) compromises structural integrity. (a–c) Phalloidin staining for sarcomeric actin filaments in cardiomyocytes. Anterior is left in all images. (a) Cardiomyocytes from wild-type controls (Hand-Gal4>UAS-control line) contain densely packed and circumferentially organized myofibrils. KD of HDAC3 fragmented myofibrils (b) and even caused vacuoles formation within cardiomyocytes (asterisk) (c). (d) The percentage of cardiomyocytes with normal (green), myofibril fragmentation (pink), or vacuolization (orange) in control, HDAC3 KD, wild-type (wt) HDAC3 rescue flies (hand>UAS-HDAC3 RNAi; shRNA-resistant wt HDAC3 transgene), and HDAC3 K26A mutant rescue flies (hand>UAS-HDAC3 RNAi; shRNA-resistant HDAC3 K26A transgene). More than 20 hearts were observed per genotype.

3.3 |. Cardiac-specific HDAC3 KD increased fibrosis

An accumulation of ECM protein, such as type-IV-like collagen (Pericardin), has been linked to reductions in cardiac contractility in Drosophila, and is reminiscent of cardiac fibrosis (Vaughan et al., 2018). Immunofluorescence staining with Pericardin antibodies revealed an increase in the extracardiac collagen in the distal region of the heart in HDAC3 KD flies (Figure 3a,b) and measurement of the immunofluorescence intensity was used to quantify this increased deposition of Pericardin in response to cardiac HDAC3 KD (Figure 3e). Western blot analysis of lysates of isolated hearts further confirmed an increased level of Pericardin in HDAC3 KD hearts (Figure 3f,g). In addition to the increased protein expression, qPCR of isolated hearts showed a significant increase in Pericardin mRNA expression (Figure 3h).

FIGURE 3.

FIGURE 3

Deacetylase-dead HDAC3 mutant rescued the increased Pericardin deposition in heart-specific HDAC3 KD. Pericardin staining at the distal heart of Drosophila from a control (a), HDAC3 KD (b), HDAC3 WT rescue flies (c), and HDAC3 K26A mutant rescue flies (d). Anterior is to the left in all images. (e) Quantification of Pericardin fluorescent signal at the distal heart. (g) Western blot of heart lysates stained with anti-Pericardin and anti-actin (used as a loading control). (f) Quantification of Pericardin band intensity relative to actin using ImageJ software. n = 5. (h) Relative mRNA expression of Pericardin in hearts was normalized to ribosomal rp49 expression. n = 7. Note that HDAC3 KD showed increased Pericardin expression, which could be rescued by shRNA-resistant wt or deacetylase-dead mutant HDAC3 transgene. Significance of Pericardin fluorescent signal and Pericardin protein expression was determined using one-way ANOVA. Significance of Pericardin mRNA expression was determined using unpaired t test. Differences among each genotype are indicated by individual asterisks; GraphPad statistical analysis, *p < 0.05, **p < 0.01, ***p < 0.001. KD, knockdown; WT, wild-type. ns represents no significance.

3.4 |. HDAC3 KD increased levels of triglycerides in flies

Excessive accumulation of lipids is a high-risk factor for cardiomyopathy (Szendroedi & Roden, 2009; van Herpen & Schrauwen-Hinderling, 2008). HDAC3 plays a distinct role in maintaining myocardial lipid homeostasis compared to other class I HDACs, HDAC1 and HDAC2 in mice (Montgomery et al., 2007, 2008). We quantified triglyceride levels in female hearts with cardiac HDAC3 KD and observed a dramatic increase in myocardial triglycerides (TAG) in HDAC3 KD hearts (Figure 4a). The increase of triglycerides in HDAC3 KD hearts was comparable to that of hearts of WT flies fed with a high-fat diet (Figure 4a). Interestingly, cardiac HDAC3 KD also induced an increase in whole-body triglyceride content (Figure 4b).

FIGURE 4.

FIGURE 4

The deacetylase-dependent role of HDAC3 is required for regulating TAG levels. (a) Relative TAG content (normalized to protein content) of female hearts on standard diet and high-fat diet (HFD). (b) Relative TAG content of the whole body of female flies in control and HDAC3 KD under NF or HFD condition. (c) Relative TAG content (normalized to protein content) of the whole body of female flies in control, HDAC3 KD, HDAC3 WT rescue flies, HDAC3 K26A mutant rescue flies, and Smr KD under NF condition. Note that Cardiac HDAC3 KD caused dramatic increases in TAG levels compared to controls under both NF and HFD conditions. HFD has an additive effect on triglyceride accumulation of HDAC3 KD. The accumulation of TAG in the whole body was rescued by shRNA-resistant HDAC3 WT transgene but not by HDAC3 K26A mutant. Smr KD showed significant increases in TAG levels comparable to that for HDAC3 KD flies. Significance was determined using one-way ANOVA (c) or two-way ANOVA (a, b). Significance between experimental groups is indicated by the capped lines; Differences relative to the control are indicated by asterisks; Graph Pad statistical analysis, *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001. KD, knockdown; NF, normal food; WT, wild-type. ns represents no significance. Five biological samples per genotype.

HDAC3 can form a complex with NCoR and SMRT in mammals, and its enzymatic activity requires interaction with NCoR/SMRT (Guenther et al., 2001; Perissi et al., 2010). Drosophila Smr is homologous to mammalian NCoR and SMRT genes. Cardiac Smr KD showed similar increases in TAG content, consistent with the effects of HDAC3 KD (Figure 4c).

3.5 |. Deacetylase-dead HDAC3 mutants rescue both cardiac physiological and morphological defects

The crystal structure of HDAC3 revealed that residue K25 is a key residue that contacts the DAD domain of NCoR/SMRT (Guenther et al., 2001; Watson et al., 2012; Wen et al., 2000). HDAC3 harboring a K25A mutation disrupted the deacetylase activity (You et al., 2013). The corresponding HDAC3 K26A mutation in Drosophila also disrupted deacetylase activity (Min Tang et al., 2022). To investigate if the cardiac phenotype in HDAC3 KD is dependent on the deacetylase activity, we generated WT or deacetylase-dead mutant HDAC3 transgenic flies under its own endogenous promoter. The transgene was mutated at the RNA interference targeting sites by using a synonymous coden to resist shRNA targeting, hereafter referred to as shRNA-resistant transgene (Min Tang et al., 2022).

The introduction of one copy of deacetylase-dead HDAC3 transgene in HDAC3 KD background showed comparable results with the introduction of WT HDAC3 transgene in aspects of systolic interval and contractility (Figure 5a,b). Phalloidin staining also showed that deacetylase-dead HDAC3 K26A mutant rescued cardiac morphology abnormalities in the HDAC3 KD, which is comparable with WT HDAC3 (Figure 2d). In addition, deacetylase-dead HDAC3 K26A mutant significantly reduced the fibrosis associated with HDAC3 KD (Figure 3df). Taken together, deacetylase-dead HDAC3 K26A was able to rescue the functional and morphological defects in HDAC KD hearts.

FIGURE 5.

FIGURE 5

shRNA-resistant deacetylase-dead HDAC3 mutant in HDAC3 KD showed comparable results with wild-type (WT) HDAC3. (a) Systolic Interval and (b) contractility quantified as fractional shortening, were measured for HDAC3 WT rescue flies and HDAC3 K26A mutant rescue flies. Note that deacetylase-dead HDAC3 K26A rescue flies showed comparable results with WT HDAC3 in aspects of systolic interval, and contractility. Significance was determined using unpaired Student’s t tests. ns represents no significance. Sample size was 20–30 flies per genotype.

3.6 |. Deacetylase-dead HDAC3 mutants failed to improve triglycerides accumulation in HDAC3 KD

HDAC KD caused whole-body TAG accumulation. This increase was partially rescued in flies expressing shRNA-resistant WT HDAC3 (Figure 4c). However, deacetylase-dead HDAC3 K26A mutant failed to rescue the elevated TAG content, indicating that the regulation of TAG level by HDAC3 is deacetylase dependent (Figure 4c).

3.7 |. HDAC3 KD decreased the median survival time

Heart function is a key factor for longevity. To test the effects of cardiac HDAC3 KD on fly lifespan, we aged cardiac-specific HDAC3 KD flies and WT control flies in groups of 25 flies each on standard food at 21°C. Cardiac-specific HDAC3 KD decreased the median survival time of the flies by 42% (Figure 6).

FIGURE 6.

FIGURE 6

Cardiac-specific HDAC3 KD reduces life span. Median survivorship was 120 days for control flies (Hand>UAS-control) compared to 69 days for cardiac-specific HDAC3 KD flies (Hand>UAS-HDAC3 RNAi) under NF conditions. Under HFD conditions, the median survival was significantly reduced in controls (to 108 days, a 10% reduction) as well as in HDAC3 KD flies (to 45 days, a 35% reduction). Graph plots % survival versus time (in days) post-eclosion (****p < 0.0001, Mandel–Cox log-rank test). HFD, high-fat diet; KD, knockdown; NF, normal food.

3.8 |. HFD feeding did exacerbate the effects of HDCA3 KD on longevity reduction but not on cardiac contractility and Pericardin deposition

HFD is a high-risk factor for cardiac dysfunction (Birse et al., 2010), which led us to test if HFD has an additive effect on the HDAC3 KD phenotype. HFD resulted in a further increase of TAG content in HDAC KD flies (Figure 4a,b). Survival assays showed that HFD further decreased the median of survival time in HDAC3 KD flies (Figure 6). We also examined the heart function in WT control flies and HDAC3 KD flies that were fed HFD. As expected, hearts from control flies fed HFD exhibited a reduction in contractility (measured as fractional shortening). In the HDAC3 KD hearts’ contractility was reduced compared to controls on NF but was not worsened upon HFD feeding (Figure 7a). In addition, there was no further increase in Pericardin deposition upon HFD feeding (Figure 7b).

FIGURE 7.

FIGURE 7

HFD feeding did not exacerbate the effects of HDCA3 KD on cardiac contractility and Pericardin deposition. (a) Cardiac contractility quantified as fraction shortening in control and HDAC3 KD during NF and HFD condition. Sample size was 20–30 flies per genotype. (b) Western blot of heart lysates stained with anti-Pericardin and anti-actin (used as a loading control). (c) Quantification of Pericardin band intensity relative to actin using ImageJ software. Note that cardiac HDAC3 KD caused a significant reduction in cardiac contractility and increase in Pericardin deposition. HFD failed to have an additional effect on HDAC3 KD hearts. Significance was determined using two-way ANOVA. GraphPad statistical analysis. HFD, high-fat diet; KD, knockdown. *p < 0.05, **p < 0.01.

4 |. DISCUSSION

The results described here provide strong evidence that HDAC3 is required to maintain cardiac physiological function and structural integrity in Drosophila, demonstrated by reduced cardiac contractility, disrupted myofibrils, and fibrosis in response to cardiac-specific HDAC3 KD, which is reminiscent of aspects of cardiomyopathies in humans and in mice (Montgomery et al., 2008), indicating the conservation of HDAC3 function in maintaining adult heart physiology and structure.

The HDAC3 KD-induced reduction in cardiac contractility was consistent with the observed disruption of cardiac myofibrillar structure. In addition, the accumulation of the ECM protein Pericardin was observed in HDAC3 KD hearts. ECM protein surrounding the lateral surfaces of cardiomyocytes accumulates in the aging heart, which accompanies reduced contractility, referred to as cardiac fibrosis (L. Li et al., 2018; Vaughan et al., 2018). The excessive deposition of ECM proteins in HDAC3 KD may also have contributed to decreased cardiac contractility. HDAC3 has been shown to recruit the PRC2 complex to epigenetic silence transforming growth factor-β signaling (Lewandowski et al., 2015). TGF-β signaling plays a central role in cardiac fibrosis (Khalil et al., 2017; Saadat et al., 2020). So we speculated that HDAC3 is required to prevent cardiac fibrosis through inhibition of TGF-β signaling.

HDAC3 plays a distinct role in cardiac metabolism compared to other class I HDACs (Montgomery et al., 2007, 2008). HDAC3 participates in FA oxidation (Papazyan et al., 2016; Sun et al., 2011) and the defect in FA oxidation is expected to lead to lipotoxicity, accompanied by increased TAG levels. Loss of HDAC3 also caused hepatic steatosis by rerouting metabolites towards lipid synthesis and inhibiting FA oxidation (Sun et al., 2012). In flies, cardiac-specific HDAC3 KD also increased TAG levels and the bradycardia in response to HDAC3 KD may be due to reduced supply of the energy substrate that was rerouted to TAG synthesis.

Interestingly, cardiac HDAC3 KD induced an increase of triglyceride content in whole body. The heart, as a major energy-consuming organ, is expected to have an impact on the whole body TAG in Drosophila with low metabolite rates. Additionally, it would also be possible that HDAC3 may regulate the nonautonomous crosstalk factors, such as metabolites, which may contribute to the changes of TAG levels in the whole body.

The deacetylase-dead mutant K26A could rescue the contractility defects and cardiac fibrosis-like phenotypes, indicating the role of HDAC3 in these aspects of cardiac function is deacetylase independent. Previous studies have shown that HDAC3 plays a deacetylase-independent role in inhibiting ECM scaffold protein expression during mouse heart development, mediated by the transforming growth factor-β pathway (Lewandowski et al., 2015). Based on our observations that the deacetylase-dead mutation K26A still retains the repressor activity of HDAC3 during embryo development in Drosophila (Min Tang et al., 2022), we speculated that the nonenzymatic role of HDAC3 is involved in maintaining adult heart function through inhibiting ECM protein Pericardin in Drosophila.

The deacetylase-dead mutant K26A failed to rescue the increased whole-body TAG levels in HDAC3 KD, indicating that the regulation of TAG levels is dependent on acetylation activity. This result was confirmed by KD of Smr, the homolog of mammalian NCoR/SMRT that is required for the enzymatic activity of HDAC3 (Guenther et al., 2001; Watson et al., 2012). Taken together, our results showed the deacetylase-dependent role of HDAC3 in lipid homeostasis and deacetylase-independent role in ECM accumulation (Figure 8).

FIGURE 8.

FIGURE 8

The deacetylase-dependent and deacetylase-independent role in maintaining cardiac performance. HDAC3 plays deacetylase-dependent role in lipid homeostasis by promoting fatty acid (FA) oxidation. The defects of FA oxidation in HDAC3 KD would reroute the lipid intermediates to TAG synthesis. The increase of lipid intermediate S1P would promote ECM accumulation. The nonenzymatic function of HDAC3 would silence the TGF-β signaling to directly prevent ECM accumulation. Additionally, TGF-β signaling would indirectly promote cardiac fibrosis through increasing the lipid intermediate SIP.

Lipotoxicity promotes the development of cardiomyopathy (Goldberg et al., 2012). Deacetylase-dead mutant K26A failed to rescue the TAG levels but succeeded in improving cardiac function (Figure 1E, Figure 2D, Figure 3), indicating TAG accumulation is not equivalent to lipotoxicity. Several studies found that lipid intermediates, but not TAGs themselves, caused lipotoxicity (Liu et al., 2009; Papazyan et al., 2016; Suzuki et al., 2009). Knockout of HSL (hormone-sensitive lipase) that caused TAG accumulation failed to show toxicity to cardiac function (Suzuki et al., 2009). Similarly, elevated TAG levels in HDAC3 KO mice are not enough to cause lipotoxicity in the liver (Papazyan et al., 2016). However, the lipid intermediate sphingosine-1-phosphate (S1P) has been demonstrated to promote the fibrotic development in heart (Jimenez-Uribe et al., 2021) and TGF-β signaling promoted fibrosis by stimulating SphK1 activity that catalyzes ceramide to generate S1P (Jimenez-Uribe et al., 2021). So we speculated that HDAC3 prevents cardiac fibrosis by inhibiting TGF-β signaling and reducing the lipid intermediates by increasing FA oxidation (Figure 8). It will be interesting to compare the lipid composition between the K26A rescue mutant and HDAC3 KD to find the true biomarker for HDAC3 cardiac lipotoxicity.

Our results showed that hearts with HDAC3 KD did not exhibit a more serious cardiac contractility defect nor more increased Pericardin expression upon HFD feeding, even though TAG levels were further increased by HFD in HDAC KD flies, suggesting that HDAC3 and not TAG, mediates the HFD-induced effects on cardiac function. A recent study showed that NADPH inhibits HDAC3-DAD domain complex formation by competing with IP4 (W. Li et al., 2021). Thus, the metabolic state may participate in maintaining cardiac performance through mediating HDAC3 activity.

Supplementary Material

Figure s1
Movie s2
Download video file (3.3MB, avi)
Figure s2
Movie s1
Download video file (3.4MB, avi)

ACKNOWLEDGMENTS

The authors thank Mattias Mannervik from Stockholm University for reagents and useful discussions. This work was funded by grants from the National Natural Science Foundation of China and the Hunan Provincial Education Department to Dr. Tang.

Funding information

Education Deparment of Hunan Province; National Natural Science Foundation of China

Footnotes

SUPPORTING INFORMATION

Additional supporting information can be found online in the Supporting Information section at the end of this article.

REFERENCES

  1. Alayari NN, Vogler V, Taghli-Lamallem O, Ocorr K, Bodmer R, & Cammarato A. (2009). Fluorescent labeling of Drosophila heart structures. Journal of Visualized Experiments, (32), 1423. https://pubmed.ncbi.nlm.nih.gov/19826399/ [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bhaskara S, Chyla BJ, Amann JM, Knutson SK, Cortez D, Sun ZW, & Hiebert SW (2008). Deletion of histone deacetylase 3 reveals critical roles in S phase progression and DNA damage control. Molecular Cell, 30(1), 61–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Birse RT, Choi J, Reardon K, Rodriguez J, Graham S, Diop S, Ocorr K, Bodmer R, & Oldham S. (2010). High-fat-diet-induced obesity and heart dysfunction are regulated by the TOR pathway in Drosophila. Cell Metabolism, 12(5), 533–544. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Cammarato A, Ocorr S, & Ocorr K. (2015). Enhanced assessment of contractile dynamics in Drosophila hearts. Biotechniques, 58(2), 77–80. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Fink M, Callol-Massot C, Chu A, Ruiz-Lozano P, Belmonte JCI, Giles W, Bodmer R, & Ocorr K. (2009). A new method for detection and quantification of heartbeat parameters in Drosophila, zebrafish, and embryonic mouse hearts. Biotechniques, 46(2), 101–113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Goldberg IJ, Trent CM, & Schulze PC (2012). Lipid metabolism and toxicity in the heart. Cell Metabolism, 15(6), 805–812. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Guenther MG, Barak O, & Lazar MA (2001). The SMRT and N-CoR corepressors are activating cofactors for histone deacetylase 3. Molecular and Cellular Biology, 21(18), 6091–6101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Han Z, & Olson EN (2005). Hand is a direct target of Tinman and GATA factors during Drosophila cardiogenesis and hematopoiesis. Development, 132(15), 3525–3536. [DOI] [PubMed] [Google Scholar]
  9. Jimenez-Uribe AP, Gómez-Sierra T, Aparicio-Trejo OE, Orozco-Ibarra M, & Pedraza-Chaverri J. (2021). Backstage players of fibrosis: NOX4, mTOR, HDAC, and S1P; companions of TGF-beta. Cellular Signalling, 87, 110123. [DOI] [PubMed] [Google Scholar]
  10. Khalil H, Kanisicak O, Prasad V, Correll RN, Fu X, Schips T, Vagnozzi RJ, Liu R, Huynh T, Lee SJ, Karch J, & Molkentin JD (2017). Fibroblast-specific TGF-β–Smad2/3 signaling underlies cardiac fibrosis. Journal of Clinical Investigation, 127(10), 3770–3783. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Klassen MP, Peters CJ, Zhou S, Williams HH, Jan LY, & Jan YN (2017). Age-dependent diastolic heart failure in an in vivo Drosophila model. eLife, 6, e20851. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Lewandowski SL, Janardhan HP, & Trivedi CM (2015). Histone deacetylase 3 coordinates deacetylase-independent epigenetic silencing of transforming growth factor-β1 (TGF-β1) to orchestrate second heart field development. Journal of Biological Chemistry, 290(45), 27067–27089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Li L, Zhao Q, & Kong W. (2018). Extracellular matrix remodeling and cardiac fibrosis. Matrix Biology, 68–69, 490–506. [DOI] [PubMed] [Google Scholar]
  14. Li W, Kou J, Qin J, Li L, Zhang Z, Pan Y, Xue Y, & Du W. (2021). NADPH levels affect cellular epigenetic state by inhibiting HDAC3-Ncor complex. Nature Metabolism, 3(1), 75–89. [DOI] [PubMed] [Google Scholar]
  15. Liu L, Shi X, Bharadwaj KG, Ikeda S, Yamashita H, Yagyu H, Schaffer JE, Yu YH, & Goldberg IJ (2009). DGAT1 expression increases heart triglyceride content but ameliorates lipotoxicity. Journal of Biological Chemistry, 284(52), 36312–36323. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. MinTang IR, Belikov S, Shilkova O, Xu L, Wernersson E, Liu X, Wu H, Bienko M, & Mannervik M. (2022). Separation of transcriptional repressor and activator functions in HDAC3. bioRxiv. 10.1101/2022.06.11.495646v1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Montgomery RL, Davis CA, Potthoff MJ, Haberland M, Fielitz J, Qi X, Hill JA, Richardson JA, & Olson EN (2007). Histone deacetylases 1 and 2 redundantly regulate cardiac morphogenesis, growth, and contractility. Genes & Development, 21(14), 1790–1802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Montgomery RL, Potthoff MJ, Haberland M, Qi X, Matsuzaki S, Humphries KM, Richardson JA, Bassel-Duby R, & Olson EN (2008). Maintenance of cardiac energy metabolism by histone deacetylase 3 in mice. Journal of Clinical Investigation, 118(11), 3588–3597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Ooi JYY, Tuano NK, Rafehi H, Gao XM, Ziemann M, Du XJ, & El-Osta A. (2015). HDAC inhibition attenuates cardiac hypertrophy by acetylation and deacetylation of target genes. Epigenetics, 10(5), 418–430. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Papazyan R, Sun Z, Kim YH, Titchenell PM, Hill DA, Lu W, Damle M, Wan M, Zhang Y, Briggs ER, Rabinowitz JD, & Lazar MA (2016). Physiological suppression of lipotoxic liver damage by complementary actions of HDAC3 and SCAP/SREBP. Cell Metabolism, 24(6), 863–874. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Pasqua T, Rocca C, Giglio A, & Angelone T. (2021). Cardiometabolism as an interlocking puzzle between the healthy and diseased heart: New frontiers in therapeutic applications. Journal of Clinical Medicine, 10, 721. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Perissi V, Jepsen K, Glass CK, & Rosenfeld MG (2010). Deconstructing repression: Evolving models of co-repressor action. Nature Reviews Genetics, 11(2), 109–123. [DOI] [PubMed] [Google Scholar]
  23. Poleshko A, Shah PP, Gupta M, Babu A, Morley MP, Manderfield LJ, Ifkovits JL, Calderon D, Aghajanian H, Sierra-Pagán JE, Sun Z, Wang Q, Li L, Dubois NC, Morrisey EE, Lazar MA, Smith CL, Epstein JA, & Jain R. (2017). Genome-nuclear lamina interactions regulate cardiac stem cell lineage restriction. Cell, 171(3), 573–587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Saadat S, Mahjoubin-Tehran M, Nazemi S, Shojaie L, Aschner M, Maleki B, Abbasi-Kolli M, Rajabi Moghadam H, Alani B, & Mirzaei H. (2020). Pivotal role of TGF-beta/Smad signaling in cardiac fibrosis: Non-coding RNAs as effectual players. Frontiers in Cardiovascular Medicine, 7, 588347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Sun Z, Singh N, Mullican SE, Everett LJ, Li L, Yuan L, Liu X, Epstein JA, & Lazar MA (2011). Diet-induced lethality due to deletion of the Hdac3 gene in heart and skeletal muscle. Journal of Biological Chemistry, 286(38), 33301–33309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Sun Z, Feng D, Fang B, Mullican SE, You SH, Lim HW, Everett LJ, Nabel CS, Li Y, Selvakumaran V, Won KJ, & Lazar MA (2013). Deacetylase-independent function of HDAC3 in transcription and metabolism requires nuclear receptor corepressor. Molecular Cell, 52(6), 769–782. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Sun Z, Miller RA, Patel RT, Chen J, Dhir R, Wang H, Zhang D, Graham MJ, Unterman TG, Shulman GI, Sztalryd C, Bennett MJ, Ahima RS, Birnbaum MJ, & Lazar MA (2012). Hepatic Hdac3 promotes gluconeogenesis by repressing lipid synthesis and sequestration. Nature Medicine, 18(6), 934–942. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Suzuki J, Ueno M, Uno M, Hirose Y, Zenimaru Y, Takahashi S, Osuga J, Ishibashi S, Takahashi M, Hirose M, Yamada M, Kraemer FB, & Miyamori I. (2009). Effects of hormone-sensitive lipase disruption on cardiac energy metabolism in response to fasting and refeeding. American Journal of Physiology-Endocrinology and Metabolism, 297(5), E1115–E1124. [DOI] [PubMed] [Google Scholar]
  29. Szendroedi J, & Roden M. (2009). Ectopic lipids and organ function. Current Opinion in Lipidology, 20(1), 50–56. [DOI] [PubMed] [Google Scholar]
  30. Szigety KM, Liu F, Yuan CY, Moran DJ, Horrell J, Gochnauer HR, Cohen RN, Katz JP, Kaestner KH, Seykora JT, Tobias JW, Lazar MA, Xu M, & Millar SE (2020). HDAC3 ensures stepwise epidermal stratification via NCoR/SMRT-reliant mechanisms independent of its histone deacetylase activity. Genes & Development, 34(13–14), 973–988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Trivedi CM., Luo Y., Yin Z., Zhang M., Zhu W., Wang T., Floss T., Goettlicher M., Noppinger PR., Wurst W., Ferrari VA., Abrams CS., Gruber PJ., & Epstein JA. (2007). Hdac2 regulates the cardiac hypertrophic response by modulating Gsk3β activity. Nature Medicine, 13(3), 324–331. [DOI] [PubMed] [Google Scholar]
  32. van Herpen NA, & Schrauwen-Hinderling VB (2008). Lipid accumulation in non-adipose tissue and lipotoxicity. Physiology & Behavior, 94(2), 231–241. [DOI] [PubMed] [Google Scholar]
  33. Vaughan L, Marley R, Miellet S, & Hartley PS (2018). The impact of SPARC on age-related cardiac dysfunction and fibrosis in Drosophila. Experimental Gerontology, 109, 59–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Vogler G, & Ocorr K. (2009). Visualizing the beating heart in Drosophila. Journal of Visualized Experiments, (31), 1425. https://pubmed.ncbi.nlm.nih.gov/19786947/ [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Watson PJ, Fairall L, Santos GM, & Schwabe JWR (2012). Structure of HDAC3 bound to co-repressor and inositol tetraphosphate. Nature, 481(7381), 335–340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Wen YD, Perissi V, Staszewski LM, Yang WM, Krones A, Glass CK, Rosenfeld MG, & Seto E. (2000). The histone deacetylase-3 complex contains nuclear receptor corepressors. Proceedings of the National Academy of Sciences of the United States of America, 97(13), 7202–7207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. You SH, Lim HW, Sun Z, Broache M, Won KJ, & Lazar MA (2013). Nuclear receptor co-repressors are required for the histone-deacetylase activity of HDAC3 in vivo. Nature Structural & Molecular Biology, 20(2), 182–187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Zhang CL, McKinsey TA, Chang S, Antos CL, Hill JA, & Olson EN (2002). Class II histone deacetylases act as signal-responsive repressors of cardiac hypertrophy. Cell, 110(4), 479–488. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure s1
Movie s2
Download video file (3.3MB, avi)
Figure s2
Movie s1
Download video file (3.4MB, avi)

RESOURCES