Skip to main content
Health Science Reports logoLink to Health Science Reports
. 2023 May 3;6(5):e1238. doi: 10.1002/hsr2.1238

Polymorphisms of the interleukin‐6 (IL‐6) gene contribute to cervical cancer susceptibility in Bangladeshi women: A case‐control study

Monishita Shaswati 1, Fihima Hossain Oeishy 1, Sadia Biswas Mumu 1, Md Zahidul Islam Zahid 1, Murad Hossain 1, Md Aminul Haque 2, Hasan Mahmud Reza 1, Md Shaki Mostaid 1,✉
PMCID: PMC10155201  PMID: 37152226

Abstract

Background and Aims

Cervical cancer is characterized by abnormal cell growth in the lining of cervix and it is the second major cause of cancer‐related deaths among females in Bangladesh. Interleukin‐6 (IL‐6) is a multifunctional cytokine that has been heavily linked with cervical cancer. Our aim was to investigate the association of two promoter single‐nucleotide polymorphisms (SNPs) of IL‐6 (rs1800795 and rs1800797) with the susceptibility of cervical cancer in Bangladeshi women.

Methods

DNA was extracted from venous blood samples from cervical cancer patients (n = 126) and healthy controls (n = 120). Polymerase chain reaction‐restriction fragment length polymorphism was used for genotyping of the selected SNPs. Logistic regression was performed to calculate the odds ratio (OR) with 95% confidence interval (CI) and p values.

Results

We found a significant association between rs1800795 and rs1800797 polymorphisms and cervical cancer. For, rs1800795 (G > C) the GC heterozygous genotype (OR = 2.80, 95% CI = 1.55–5.07, p = 0.0007) and CC mutant homozygous genotype (OR = 3.5, 95% CI = 1.29–9.51, p = 0.014) conferred an increased risk of cervical cancer. In case of rs1800797 (G > A) polymorphism, the AG heterozygous genotype (OR = 6.94, 95% CI = 3.76–12.81, p < 0.0001) and AA mutant homozygous genotype (OR = 3.88, 95% CI = 1.12–13.51, p = 0.0332) also exhibited an elevated risk of cervical cancer. Use of contraceptives was found as risk factor and patients who smoke were carriers of both the risk alleles and thus had an increased risk of cervical cancer.

Conclusion

Our findings suggest that polymorphism of rs1800795 and rs1800797 of the IL‐6 gene play a significant role in cervical cancer susceptibility in Bangladeshi women.

Keywords: Bangladesh, cervical cancer, interleukin‐6, polymorphism, rs1800795, rs1800797

1. INTRODUCTION

Cervical cancer is a major prevalent malignancy among women. In 2020, it was reported as the fourth leading cause of cancer death among females worldwide, which accounts for 6.5% of newly diagnosed cancer cases and 7.7% of cancer‐related deaths. There were 604,127 new cases and 341,831 deaths from cervical cancer, most of which occurred in low‐ and middle‐income countries. 1 In Bangladesh, cervical cancer ranks second for both the most frequently diagnosed malignancy and cancer‐related deaths. 2  Persistent infection from human papillomavirus (HPV) is considered as the main causative agent of cervical cancer. 3 However, HPV alone is insufficient to induce tumor growth, and host immune response and genetic factors play a critical role in the malignant transformation of the cervical epithelium. 4

Chronic inflammation, regulated by immune cells, strongly correlates with tumor growth 5 Studies have shown that immune cell mediators, such as cytokines, are essential modulators in viral replication. 6 Therefore, mutations in genes related to immunity can affect the immune response and influence the development of cervical cancer. Interleukin‐6 (IL‐6) is a pleiotropic cytokine that plays an important role in regulation of immune response, cell proliferation, hematopoiesis, and inflammation. 7 It induces vascular endothelial growth factor gene expression and favors tumor growth. 8 Elevated levels of IL‐6 have been found in tumor tissues 9 , 10 , 11 and several single‐nucleotide polymorphisms (SNPs) in the IL‐6 gene have been implicated with increased risk of cervical cancer. 6 , 12 , 13 , 14

Two promoter polymorphisms, rs1800795 (−174G/C) and rs1800797 (−597A/G), the IL‐6 gene have been associated with a wide variety of malignancies, 15 , 16 including cervical cancer. 14 , 17 , 18 These two SNPs are located in the 5′ flanking region (7p15.3) of the IL‐6 gene promoter. 17 , 19  Polymorphisms in this promoter region can affect the transcription rate and plasma levels of IL‐6. 20 Moreover, IL‐6 −174G>C (rs1800795) has been associated with a negative regulatory effect on reporter gene expression. 21 A single nucleotide change from G to C at position −174 is thought to influence the binding of the glucocorticoid receptor, which results in the suppression of IL‐6 transcriptional activity. 22 The IL‐6 expression in tumor cells is associated with auto and paracrine stimulation of tumor cell proliferation. 23 It also activates several signaling pathways, leading to upregulation of antiapoptotic proteins and induction of proangiogenic cytokines. 24

A recent meta‐analysis found that rs1800795 polymorphism was significantly associated with an increased risk of cervical cancer in Asian (Korean, Chinese, and Indian) women. 25 Several studies have reported that the presence of at least one C allele in the IL‐6 promoter region (−174G>C) increased the risk of cervical cancer in Eastern Chinese 26 and Indian populations. 27 In a different meta‐analysis, the C allele of rs1800795 polymorphism was similarly linked to an increased risk of cervical cancer in women of Han Chinese, Brazilian, Indian, and Caucasian ethnicities. 14 However, negative association of this polymorphism with cervical cancer has also been reported in Caucasian and Brazilian women. 25 , 28

Several studies reported that the presence of IL‐6 rs1800797 (−597A/G) polymorphism conferred an increased risk of cervical cancer in population from different ethnicities. Studies conducted in Han Chinese and Indian population reported a significant association between this polymorphism and cervical cancer. 29 , 30 Gupta et al. have reported that −597G allele of IL‐6 rs1800797 increased the risk of cervical cancer by up to 6.2 times (p < 0.001) in the North Indian study population. 31 However, negative association between this SNP and cervical cancer has also been reported in Swedish and Lithuanian women of Caucasian ancestry. 32 , 33 Overall, the association between these two putative SNPs of IL‐6 and cervical cancer is inconsistent.

Therefore, the aim of our study was to evaluate the association between two IL‐6 polymorphisms rs1800795 and rs1800797 and cervical cancer in Bangladeshi women. We also investigated the correlation of the SNPs with clinicopathological characteristics.

2. MATERIALS AND METHODS

2.1. Selection of study population

One hundred twenty‐six cervical cancer patients and 120 age‐matched healthy controls (18–65 years) were recruited in this study. Cervical cancer patients were recruited from Dhaka Cancer and General Hospital Dhaka, and Dhaka Medical College and Hospital in Dhaka, Bangladesh. Using the G*Power software, the required sample size was estimated a priori with an effect size of d = 0.8 (large effect) and α = 0.05, which resulted in a total required sample size of 246. After histopathological diagnosis, the patients were staged in accordance with the International Federation of Gynecology and Obstetrics staging standards. 34 Previous medical records were checked and all the patients were non‐HPV infected and practiced abstinence from alcohol throughout their entire lives. After undergoing a complete medical examination, age‐matched healthy controls were recruited, and healthy controls with a history of mental illness, head injury, trauma, pregnancy, substance abuse, or alcohol consumption were excluded from the study. All study participants signed written consent forms and the study was carried out in accordance with the Declaration of Helsinki and its subsequent amendments. 35 The ethical review committee of Dhaka Medical College and Hospital approved the study protocol (ERC‐DMC/2020/151).

2.2. DNA extraction and genotyping

About 5 mL venous blood was collected from each study participant in potassium EDTA tubes (BD Vacutainer® blood collection tubes, Becton and Dickinson and Company). They were stored at −80°C until further experiments. DNA extraction was performed using Bioneer® genomic DNA extraction kit (Bioneer Corporation) using the manufacturer's protocol. The quality of DNA was examined using a NanoDrop spectrophotometer (Thermo Fisher Scientific). The selected SNPs were genotyped using the polymerase chain reaction‐restriction fragment length polymorphism (PCR‐RFLP) using the previously described method. 36 , 37 The PCR products of IL‐6 174G>C (166 bp) and IL‐6 597A>G (525 bp) were digested for 16 h with restriction enzymes Hin1II and FokI, respectively. Then the amplicons were visualized on 2% agarose gel using ethidium bromide by gel electrophoresis. Table 1 contains the details of the PCR protocol and Supporting Information contain RFLP images for both SNPs.

Table 1.

Primers for IL‐6 gene polymorphisms rs1800795 and rs1800797.

Target SNP Primer Sequence PCR product (bp) Restriction enzyme PCR products after digestion (bp)
IL‐6 174G>C (rs1800795)

F 5′‐TGACTTCAGCTTTACTCTTGT‐3′

R 5′‐CTGATTGGACTTATTAAG‐3′

198 Hin1II

GG = 167, 31

GC = 167, 122, 45, 31

CC = 122, 45, 31

IL‐6 597G>A (rs1800797)

F 5′‐GGAGTCACACACTCCACCT‐3′

R 5′‐CTGATTGGAAACCTTATTAAG‐3′

525 FokI

GG = 468

AG = 525, 468

AA = 525

Abbreviations: PCR, polymerase chain reaction; SNP, single‐nucleotide polymorphism.

2.3. Statistical analysis

All statistical analyses were performed using two‐tailed tests. The chi‐square test was used to compare the categorical variables, while t test was used to compare the continuous variables in demographic data, genotype frequencies, and clinicopathological data. The Hardy–Weinberg Equilibrium was calculated using chi‐square test to measure the deviation in the genotype frequencies in the healthy control group from the patients’ group. Multinomial logistic regression was used to calculate the adjusted odds ratio controlling for relevant covariates (age, menstrual status, tobacco use) along with 95% confidence intervals (CIs) and p values. p < 0.05 was considered statistically significant. The statistical analyses were performed using SPSS version 23 (SPSS, Inc.).

3. RESULTS

3.1. Characteristics of the study population

Table 2 describes the demographic and clinicopathological characteristics of the participants. A total of 246 women were selected for this study comprising 126 cervical cancer patients and 120 healthy controls. A marginally significant difference (p = 0.047) was observed between the cases and controls regarding tobacco use as there were more smokers (26.19%) in the case group compared to the healthy control group (15.83%). This is in agreement with previous studies which demonstrated smoking as a risk factor for cervical cancer. 38 , 39 We also found a significant difference (p = 0.013) regarding the use of contraceptives as women who used intrauterine device, cervical cap, barrier, and female condom were more prone to the risk of cancer. This is similar to our findings with a different cohort of cervical cancer patients, where we found that similar contraceptives increase the risk of cervical cancer in Bangladeshi women. 40 However, no statistically significant difference was observed for age, menopausal status, dwelling status, parity, postmenopausal status, number of children, and family history of cancer.

Table 2.

Distribution of demographic characteristics of cervical cancer patients and controls.

Characteristics Cases (n = 126) (%) Controls (n = 120) (%) χ2 (p value)
Age (years)
≤45 58 (46.0) 67 (55.8) 2.37 (0.124)
˃45 68 (54.0) 53 (44.2)
Dwelling
Urban 26 (20.6) 21 (17.5) 0.39 (0.627)
Rural 100 (79.4) 99 (82.5)
Menstrual status
Pre‐menopause 72 (57.1) 59 (49.2) 1.57 (0.250)
Post‐menopause 54 (42.9) 61 (50.8)
Tobacco use
Smokers 33 (26.19) 19 (15.83) 3.96 (0.05)
Non‐smokers 93 (73.81) 101 (84.17)
Parity
0–7 122 (96.8) 115 (95.8) 0.17 (0.744)
>7 4 (3.2) 5 (4.2)
Contraception
Oral pills 54 (42.9) 67 (55.8) 1.03 (0.311)
Othersa 15 (11.9) 3 (2.5) 6.15 (0.013 * )
Combinationb 10 (7.9) 6 (5.0) 0.65 (0.422)
None 47 (37.3) 44 (36.7) –
Family history of cancer (first‐degree relatives)
Yes 20 (15.88) 24 (20) 0.71 (0.399)
No 106 (84.12) 96 (80)
Stage of cancer
IA–IB 24 (19.05)
IIA–IIB 67 (53.18)
IIIA–IIIB 35 (27.78)
Histopathology
Squamous cell carcinoma 103 (81.75)
Adenocarcinoma 17 (13.50)
Others 6 (4.75)
Tumor grade
I 11 (8.73)
II 99 (78.58)
III 16 (12.70)
a

Others: Intrauterine device (IUD) + Barrier (cervical cap, diaphragm, and female condom).

b

Combination: Oral pills + condom(male), Oral pills + combined injectable contraceptives (CIC).

*

p < 0.05.

3.2. Analysis of genotype frequencies of rs1800795 and rs1800797 of IL‐6 gene

The distribution of genotype frequencies for both SNPs in cervical cancer patients and healthy controls is summarized in Table 3. For IL‐6 rs1800795 polymorphism, cervical cancer patients had higher frequencies of GC heterozygous genotype compared to controls (36.5% vs. 19.2%). Logistic regression analysis showed 2.80‐fold more risk of developing cervical cancer in carriers of GC genotype (adjusted OR = 2.80, 95% CI = 1.55–5.067, p = 0.0007). Similarly, the prevalence of CC mutant homozygous genotype was higher in cases than in controls (11.9% vs. 5%), showing a statistically significant relationship with cervical cancer development (adjusted OR = 3.5, 95% CI = 1.29–9.51, p = 0.014). The presence of the C allele conferred 2.5 times more risk of cervical cancer (adjusted OR = 2.53, 95% CI = 1.62‐3.96, p < 0.0001).

Table 3.

Genotype frequencies of IL‐6 gene polymorphisms in cervical cancer patients and controls.

Genotypes Cases Controls Adjusted odds ratio 95% CI p Value
rs1800795 n = 126 (%) n = 120 (%)
GG 65 (51.6) 91 (75.8) Ref. – –
GC 46 (36.5) 23 (19.2) 2.80 1.55–5.07 0.0007
CC 15 (11.9) 6 (5.0) 3.50 1.29–9.50 0.0140
GC + CC 61 (48.4) 29 (24.2) 2.95 1.71–5.08 0.0001
C Allele 76 (60.3) 35 (29.2) 2.53 1.61–3.96 <0.0001
rs1800797
GG 50 (39.7) 97 (80.9) Ref. – –
AG 68 (53.9) 19 (15.9) 6.94 3.76–12.81 <0.0001
AA 8 (6.4) 4 (3.2) 3.88 1.12–13.51 0.0332
AG + AA 76 (60.3) 23 (19.2) 6.41 3.60–11.43 <0.0001
A Allele 84 (66.7) 27 (22.5) 3.23 2.01–5.20 <0.0001

Note: Statistically significant values are made bold.

Abbreviation: CI, confidence interval.

Frequencies of AG heterozygous and AA mutant homozygous genotypes of IL‐6 rs1800797 polymorphism were higher in cases compared to controls (53.9% vs. 15.9% and 6.4% vs. 3.2%, respectively). The presence of AA genotype was significantly associated with cervical cancer, increasing risk by 3.88 times (adjusted OR = 3.88, 95% CI = 1.12–13.52, p = 0.0332). AG genotype conferred even greater risk (6.943 times) of developing cervical cancer (adjusted OR = 6.95, 95% CI = 3.76–12.81, p ≤ 0.0001). The dominant model (GG vs. AG + AA) also showed a significant association (adjusted OR = 6.41, 95% CI = 3.60–11.43, p < 0.0001).

3.3. Association of IL‐6 polymorphisms with clinicopathological characteristics

Analysis of rs1800795 with different clinicopathological characteristics of the patients showed that smokers were carriers of the risk allele C at much higher frequency compared to non‐smokers (p = 0.044; Table 4). Similar results were also found for rs1800797, where smokers were carriers of the risk allele A in higher frequency compared to non‐smokers (p = 0.039; Table 5). Moreover, we found that for rs1800797, family history of cancer was a contributing factor. Patients with first‐degree relatives with cancer were more frequent carriers of the mutated allele A compared to patients with no family history of cancer.

Table 4.

Correlation of rs1800795 polymorphisms with clinicopathological characteristics of the patients.

Characteristics rs1800795 carrier rs1800795 noncarrier OR (95% CI) p Value
n = 61 n = 65
Age (years)
≤45 32 26 Ref. 1.000
˃45 29 39 0.61 (0.30–1.23) 0.162
Dwelling status
Rural 45 55 Ref. 1.000
Urban 16 10 1.96 (0.81–4.43) 0.137
Menstrual status
Post‐menopause 30 24 Ref. 1.000
Pre‐menopause 31 41 0.61 (0.30–1.23) 0.166
Tobacco use
Non‐smokers 40 53 Ref. 1.000
Smokers 21 12 2.32 (1.02–5.26) 0.044 *
Parity
0–7 58 64 Ref. 1.000
>7 3 1 3.31 (0.34–32.72) 0.306
Contraception
None 21 26 Ref. 1.000
Oral pills 28 26 1.33 (0.61–2.92) 0.472
Othersa 7 8 1.08 (0.34–3.48) 0.893
Combinationb 5 5 1.24 (0.32–4.86) 0.759
Family history of cancer
No 49 57 Ref. 1.000
Yes 12 8 1.75 (0.66–4.62) 0.262
a

Others: Barrier (cervical cap, diaphragm, female condom) + intrauterine device (IUD).

b

Combination: Oral pills + condom (male), Oral pills + combined injectable contraceptives (CIC).

*

p < 0.05.

Abbreviations: CI, confidence interval; OR, odds ratio.

Table 5.

Correlation of rs1800797 polymorphisms with clinicopathological characteristics of the patients.

Characteristics rs1800797 carrier rs1800797 noncarrier OR (95% CI) p Value
n = 76 n = 50
Age (years)
≤45 31 27 Ref. 1.000
˃45 45 23 1.71 (0.83–3.50) 0.147
Dwelling status
Rural 61 39 Ref. 1.000
Urban 15 11 0.87 (0.37–2.09) 0.759
Menstrual status
Pre‐menopause 43 29 Ref. 1.000
Post‐menopause 33 21 1.06 (0.52–2.18) 0.875
Tobacco use
Non‐smokers 51 42 Ref. 1.000
Smokers 25 8 2.58 (1.05–6.30) 0.039 *
Parity
0–7 74 48 Ref. 1.000
>7 2 2 0.65 (0.09–4.76) 0.670
Contraception
None 29 18 Ref. 1.000
Oral pills 33 21 0.98 (0.44–2.18) 0.952
Othersa 7 8 0.54 (0.17–1.76) 0.308
Combinationb 7 3 1.45 (0.33–6.33) 0.623
Family history of cancer
No 58 48 Ref. 1.000
Yes 16 4 3.31 (1.04–10.57) 0.043 *
a

Others: Barrier (cervical cap, diaphragm, female condom) + Intrauterine device (IUD).

b

Combination: Oral pills+ condom (male), Oral pills+ combined injectable contraceptives (CIC).

*

p < 0.05.

Abbreviations: CI, confidence interval; OR, odds ratio.

4. DISCUSSION

The aim of our study was to explore the association between two IL‐6 gene polymorphisms and the risk of cervical cancer in Bangladeshi women. We investigated two promoter region SNPs rs1800795 and rs1800797 in cervical cancer patients and controls of Bangladeshi ethnicity. These SNPs have the potential to be used as a biomarker for cervical cancer and may act as expression quantitative trait loci for gene and protein expression in cancer tissues. Our analysis showed that polymorphism in both the rs1800795 and rs1800797 SNPs confer an increased risk of developing cervical cancer. Smoking and use of contraception were also found to be significant factors for cervical cancer.

For the SNP rs1800795, we found that the GC and CC genotypes increase the risk of cervical cancer by 2.825 and 3.002 times, respectively. Our finding is in agreement with several previous genetic epidemiological studies where GC and CC genotypes and C allele of the rs1800795 SNP was found to have a significant association with cervical cancer in Indian, 41 Lithuanian, 33 and Tunisian women. 18 This finding is further strengthened by multiple meta‐analysis reports which demonstrated a positive association between the G > C mutation of rs1800795 with cervical cancer. 14 , 25 , 42 , 43 Moreover, a recent meta‐analysis by Harun‐Or‐Roshid et al. found that the presence of C allele increases the risk of cervical cancer in women of Asian and African ancestry. 15

On the other hand, no significant association was found between rs1800795 polymorphism and cervical intraepithelial neoplasia in the Austrian population of Caucasian ancestry. 28 Additionally, Zidi et al. demonstrated that the G allele and GG genotype might have a protective effect against the development of cervical cancer. 18 Overall, the majority of genetic epidemiological studies and meta‐analyses suggest polymorphism at rs1800795 of IL‐6 gene as a prime factor for cervical cancer. But studies need to be done in larger population with larger sample size and different ethnic background to confirm the results.

Regarding the SNP rs1800797, we found a significant association with cervical cancer. Compared to GG genotype, AG and AA genotypes confer 6.943 and 3.88 times more risk of developing cervical cancer. Our finding is similar to a previous study conducted in Bangladeshi population which found that the presence of AG and AA genotypes increases the risk of cervical cancer. 29 Moreover, rs1800797 polymorphism was reported to be a risk factor for cervical cancer in Chinese and North Indian populations. 30 , 31 In contrast, a lack of association was observed between polymorphism at this SNP and cervical cancer in the Swedish and Lithuanian population of Caucasian ethnicity. 32 , 33 The differences in results may be due to differences in ethnic background and genotypic variations may alter the expression of IL‐6 differently in women of diverse ethnicity and may act as protective or risk factor for cervical cancer. Both rs1800795 and rs1800797 are located in the promoter region of IL‐6 and genetic polymorphisms in this region increase susceptibility of cervical cancer and prognosis. 17

Environmental factors also influence the risk of cervical cancer. Our study demonstrated that women who used intrauterine devices and barrier methods (cervical cap, diaphragm, female condom) of contraception had a significantly higher risk of developing cervical cancer (p = 0.013). This finding is similar to a previous study of ours with a different cohort of cervical cancer patients. 40 Previous studies reported a high prevalence of cancer among workers in the synthetic rubber industry suggesting that the soft silicone and synthetic latex used in these products may have some carcinogenic properties, contributing to cervical cancer. 44 Interestingly, a meta‐analysis reported a lower chance of cervical cancer with IUD use. 45 Another study found that women who used Copper IUD had a lower risk of high‐grade cervical neoplasms than levonorgestrel‐releasing intrauterine system (LNG‐IUS) users. 46 Further investigations are needed to clarify the exact mechanism of how intrauterine devices and barriers contribute as risk factors for cervical cancer.

Our analysis of the SNPs with different clinicopathological characteristics revealed interesting results. We found that smokers were more carriers of the risk allele C of rs1800795 (p = 0.044) and risk allele A of rs1800797 (p = 0.039). This is similar to a previous study by Zidi et al., who reported a significant association between CC genotype of rs1800795 and smoking in Tunisian cervical cancer patients. 18 Moreover, a recent meta‐analysis with Japanese women also reported a significant association between smoking and cervical cancer. 47 The exact mechanism of smoking in increasing the risk of cervical cancer is not known. However, a recent meta‐analysis suggested that smoking increases the risk of cervical abnormalities. 48 A previous study with healthy volunteers found that carriers of C allele at rs1800795 may suffer particularly from cigarette smoking and smokers with C allele had higher leukocyte and lymphocyte counts. 49 This polymorphism also influences endothelial function and detrimental effect of smoking is more evident in persons with CC genotype. 50 It is well known that smoking is an HPV cofactor for the development of cervical cancer. 51 But in our cohort, all the patients were non‐HPV‐infected cervical cancer patients. So, future studies need to be carried out to find out how smoking influences cervical carcinogenesis.

Additionally, we found that the risk allele A of rs1800797 was more prevalent in patients with first‐degree relatives with cancer. So, women with A allele at rs1800797 and with a family history of cancer are more prone to develop cervical cancer. Future studies with larger sample size and different ethnic background need to be performed to ensure this result.

There were limitations to our study. HPV‐infected cervical cancer patients were not included in our study. So, we cannot confirm if similar findings will be observed in patients infected with HPV. Moreover, our relatively small sample size may be not enough to elucidate robust genotype‐disease interaction. We had no gene or protein expression data, so we could not find if polymorphism of the two SNPs has any cis‐regulatory effect on gene or protein expression.

Despite limitations, our preliminary findings warrant for future cervical cancer‐related studies with larger sample size and different ethnic backgrounds.

5. CONCLUSION

In conclusion, polymorphisms of rs1800795 and rs1800797 of the IL‐6 increase the risk of cervical cancer susceptibility in Bangladeshi women. Future studies with larger sample size and different ethnic background are warranted to validate our findings.

AUTHOR CONTRIBUTIONS

Monishita Shaswati: Data curation; formal analysis; investigation; writing—original draft. Fihima Hossain Oeishy: Data curation; formal analysis; investigation; writing—original draft. Sadia Biswas Mumu: Formal analysis; investigation; resources. Md Zahidul Islam Zahid: Formal analysis; investigation; resources. Murad Hossain: Investigation; resources; software. Md Aminul Haque: Resources; writing—review and editing. Hasan Mahmud Reza: Supervision; writing—review and editing. Md Shaki Mostaid: Conceptualization; supervision; writing—review and editing.

CONFLICT OF INTEREST STATEMENT

The authors declare no conflicts of interest.

TRANSPARENCY STATEMENT

The lead author Md Shaki Mostaid affirms that this manuscript is an honest, accurate, and transparent account of the study being reported; that no important aspects of the study have been omitted; and that any discrepancies from the study as planned (and, if relevant, registered) have been explained.

Supporting information

Supporting information.

ACKNOWLEDGMENTS

The authors would like to thank all the study participants, doctors, nurses, research assistants, and others involved in this study.

Shaswati M, Oeishy FH, Mumu SB, et al. Polymorphisms of the interleukin‐6 (IL‐6) gene contribute to cervical cancer susceptibility in Bangladeshi women: A case‐control study. Health Sci Rep. 2023;6:e1238. 10.1002/hsr2.1238

Monishita Shaswati and Fihima Hossain Oeishy contributed equally to this study.

DATA AVAILABILITY STATEMENT

The authors confirm that the data supporting the findings of this study are available within the article and its Supporting Information. All authors have read and approved the final version of the manuscript. Monishita Shaswati and Fihima Hossain Oeishy had full access to all of the data in this study and took complete responsibility for the integrity of the data and the accuracy of the data analysis.

REFERENCES

  • 1. Sung H, Ferlay J, Siegel RL, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021;71:209‐249. 10.3322/CAAC.21660 [DOI] [PubMed] [Google Scholar]
  • 2.GLOBOCAN. Cervix Uteri Fact Sheet: Bangladesh [WWW Document]. 2020. Accessed October 18, 2022. https://gco.iarc.fr/today/data/factsheets/populations/50-bangladesh-fact-sheets.pdf
  • 3. Jones SA. Directing transition from innate to acquired immunity: defining a role for IL‐6. J Immunol. 2005;175:3463‐3468. 10.4049/JIMMUNOL.175.6.3463 [DOI] [PubMed] [Google Scholar]
  • 4. Ramachandran D, Dörk T. Genomic risk factors for cervical cancer. Cancers. 2021;13:5137. 10.3390/CANCERS13205137 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Landskron G, De La Fuente M, Thuwajit P, Thuwajit C, Hermoso MA. Chronic inflammation and cytokines in the tumor microenvironment. J Immunol Res. 2014;2014:1‐19. 10.1155/2014/149185 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Wagh P, Kulkarni P, Kerkar S, et al. Polymorphism of interleukin‐6 −174 G/C (rs1800795) & the corresponding interleukin‐6 level as a prognostic marker of cervical cancer. Indian J Med Res. 2021;154:391. 10.4103/IJMR.IJMR_1111_19 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Tanaka T, Narazaki M, Kishimoto T. IL‐6 in inflammation, immunity, and disease. Cold Spring Harbor Perspect Biol. 2014;6:a016295. 10.1101/CSHPERSPECT.A016295 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Wei LH, Kuo ML, Chen CA, et al. Interleukin‐6 promotes cervical tumor growth by VEGF‐dependent angiogenesis via a STAT3 pathway. Oncogene. 2003;22:1517‐1527. 10.1038/sj.onc.1206226 [DOI] [PubMed] [Google Scholar]
  • 9. Culig Z, Puhr M. Interleukin‐6: a multifunctional targetable cytokine in human prostate cancer. Mol Cell Endocrinol. 2012;360:52‐58. 10.1016/J.MCE.2011.05.033 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Kumari N, Dwarakanath BS, Das A, Bhatt AN. Role of interleukin‐6 in cancer progression and therapeutic resistance. Tumor Biol. 2016;37:11553‐11572. 10.1007/S13277-016-5098-7 [DOI] [PubMed] [Google Scholar]
  • 11. Miura T, Mitsunaga S, Ikeda M, et al. Characterization of patients with advanced pancreatic cancer and high serum interleukin‐6 levels. Pancreas. 2015;44:756‐763. 10.1097/MPA.0000000000000335 [DOI] [PubMed] [Google Scholar]
  • 12. Gangwar R, Mittal B, Mittal RD. Association of interleukin‐6 −174G>C promoter polymorphism with risk of cervical cancer. Int J Biol Markers. 2009;24:11‐16. 10.1177/172460080902400102 [DOI] [PubMed] [Google Scholar]
  • 13. Hashemzehi A, Karimi‐Zarchi M, Parsaeian SF, et al. Association of IL‐6 ‐174G>C and ‐572G>C polymorphisms with susceptibility to cervical cancer and ovarian cancer. Asian Pacific J Cancer Prev. 2021;22:2867‐2871. 10.31557/APJCP.2021.22.9.2867 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Liu H, Lyu D, Zhang Y, Sheng L, Tang N. Association between the IL‐6 rs1800795 polymorphism and the risk of cervical cancer: a meta‐analysis of 1210 cases and 1525 controls. Technol Cancer Res Treat. 2017;16:662‐667. 10.1177/1533034616672806 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Harun‐Or‐Roshid M, Ali MB, Jesmin, Mollah MNH. Statistical meta‐analysis to investigate the association between the Interleukin‐6 (IL‐6) gene polymorphisms and cancer risk. PLoS One. 2021;16:e0247055. 10.1371/JOURNAL.PONE.0247055 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Peng X, Shi J, Sun W, et al. Genetic polymorphisms of IL‐6 promoter in cancer susceptibility and prognosis: a meta‐analysis. Oncotarget. 2018;9:12351‐12364. 10.18632/ONCOTARGET.24033 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Peng X, Shi J, Sun W, et al. Genetic polymorphisms of IL‐6 promoter in cancer susceptibility and prognosis: a meta‐analysis. Oncotarget. 2018;9:12351. 10.18632/ONCOTARGET.24033 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Zidi S, Stayoussef M, Alsaleh BL, et al. Relationships between common and novel interleukin‐6 gene polymorphisms and risk of cervical cancer: a case‐control study. Pathol Oncol Res. 2017;23:385‐392. 10.1007/S12253-016-0127-9 [DOI] [PubMed] [Google Scholar]
  • 19. Chen Y, Hu Y, Song Z. The association between interleukin‐6 gene ‐174G/C single nucleotide polymorphism and sepsis: an updated meta‐analysis with trial sequential analysis. BMC Med Genet. 2019;20:35. 10.1186/S12881-019-0766-2/FIGURES/3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Kim SK, Chung JH, Kwon OY. Promoter polymorphism (−174, G/C) of interleukin‐6 and arterial thromboembolic events: a meta‐analysis. Med Sci Monit. 2016;22:4345‐4353. 10.12659/MSM.901467 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Ray A, LaForge KS, Sehgal PB. On the mechanism for efficient repression of the interleukin‐6 promoter by glucocorticoids: enhancer, TATA box, and RNA start site (Inr motif) occlusion. Mol Cell Biol. 1990;10:5736‐5746. 10.1128/MCB.10.11.5736-5746.1990 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Fishman D, Faulds G, Jeffery R, et al. The effect of novel polymorphisms in the interleukin‐6 (IL‐6) gene on IL‐6 transcription and plasma IL‐6 levels, and an association with systemic‐onset juvenile chronic arthritis. J Clin Invest. 1998;102:1369‐1376. 10.1172/JCI2629 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Salgado R, Junius S, Benoy I, et al. Circulating interleukin‐6 predicts survival in patients with metastatic breast cancer. Int J Cancer. 2003;103:642‐646. 10.1002/IJC.10833 [DOI] [PubMed] [Google Scholar]
  • 24. Wei LH, Kuo ML, Chen CA, et al. The anti‐apoptotic role of interleukin‐6 in human cervical cancer is mediated by up‐regulation of Mcl‐1 through a PI 3‐K/Akt pathway. Oncogene. 2001;20:5799‐5809. 10.1038/SJ.ONC.1204733 [DOI] [PubMed] [Google Scholar]
  • 25. Karimi‐Zarchi M, Abbasi H, Javaheri A, et al. Association of IL‐12B rs3212227 and IL‐6 rs1800795 polymorphisms with susceptibility to cervical cancer: a systematic review and meta‐analysis. Asian Pac J Cancer Prev. 2020;21:1197‐1206. 10.31557/APJCP.2020.21.5.1197 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Pu X, Gu Z, Wang X. Polymorphisms of the interleukin 6 gene and additional gene‐gene interaction contribute to cervical cancer susceptibility in Eastern Chinese women. Arch Gynecol Obstet. 2016;294:1305‐1310. 10.1007/S00404-016-4175-X [DOI] [PubMed] [Google Scholar]
  • 27. Gangwar R, Mittal B, Mittal DrRD. Association of interleukin‐6 ‐174G>C promoter polymorphism with risk of cervical cancer. Int J Biol Markers. 2018;24:11‐16. 10.1177/172460080902400102 [DOI] [PubMed] [Google Scholar]
  • 28. Grimm C, Watrowski R, Baumühlner K, et al. Genetic variations of interleukin‐1 and ‐6 genes and risk of cervical intraepithelial neoplasia. Gynecol Oncol. 2011;121:537‐541. 10.1016/J.YGYNO.2011.02.019 [DOI] [PubMed] [Google Scholar]
  • 29. Muhammad SB, Hassan F, Bhowmik KK, et al. Detection of association of IL1β, IL4R, and IL6 gene polymorphisms with cervical cancer in the Bangladeshi women by tetra‐primer ARMS‐PCR method. Int Immunopharmacol. 2021;90:107131. 10.1016/J.INTIMP.2020.107131 [DOI] [PubMed] [Google Scholar]
  • 30. Shi WJ, Liu H, Wu D, Tang ZH, Shen YC, Guo L. Stratification analysis and case‐control study of relationships between interleukin‐6 gene polymorphisms and cervical cancer risk in a Chinese population. Asian Pacific J Cancer Prev. 2014;15:7357‐7362. 10.7314/APJCP.2014.15.17.7357 [DOI] [PubMed] [Google Scholar]
  • 31. Gupta MK, Singh R, Banerjee M. Cytokine gene polymorphisms and their association with cervical cancer: a North Indian study. Egypt J Med Human Gen. 2016;17:155‐163. 10.1016/J.EJMHG.2015.10.005 [DOI] [Google Scholar]
  • 32. Castro FA, Haimila K, Sareneva I, et al. Association of HLA‐DRB1, interleukin‐6 and cyclin D1 polymorphisms with cervical cancer in the Swedish population‐‐a candidate gene approach. Int J Cancer. 2009;125:1851‐1858. 10.1002/IJC.24529 [DOI] [PubMed] [Google Scholar]
  • 33. Vitkauskaite A, Celiesiute J, Juseviciute V, et al. IL‐6 597A/G (rs1800797) and 174G/C (rs1800795) gene polymorphisms in the development of cervical cancer in Lithuanian women. Medicina. 2021;57:1025. 10.3390/MEDICINA57101025 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Kim HS, Song YS. International Federation of Gynecology and Obstetrics (FIGO) staging system revised: what should be considered critically for gynecologic cancer. J Gynecol Oncol. 2009;20:135‐136. 10.3802/JGO.2009.20.3.135 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. World Medical Association . World Medical Association Declaration of Helsinki: ethical principles for medical research involving human subjects. JAMA. 2013;310:2191‐2194. 10.1001/JAMA.2013.281053 [DOI] [PubMed] [Google Scholar]
  • 36. Godarzi EM, Sarvestani EK, Aflaki E, Amirghofran Z. Interleukin‐6 gene polymorphism in Iranian patients with systemic lupus erythematosus. Clin Rheumatol. 2011;30:179‐184. 10.1007/S10067-010-1452-0 [DOI] [PubMed] [Google Scholar]
  • 37. Tala ZZ, Arrasyid NK, Sanny S, Sari MI. The polymorphism in Interleukin‐6‐597 G/A gene and their levels on type 2 diabetic patients. Open Access Maced J Med Sci. 2021;9:57‐60. 10.3889/oamjms.2021.5632 [DOI] [Google Scholar]
  • 38. Collins S, Rollason TP, Young LS, Woodman CBJ. Cigarette smoking is an independent risk factor for cervical intraepithelial neoplasia in young women: a longitudinal study. Eur J Cancer. 2010;46:405‐411. 10.1016/J.EJCA.2009.09.015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Roura E, Castellsagué X, Pawlita M, et al. Smoking as a major risk factor for cervical cancer and pre‐cancer: results from the EPIC cohort. Int J Cancer. 2014;135:453‐466. 10.1002/IJC.28666 [DOI] [PubMed] [Google Scholar]
  • 40. Mostaid MS, Mumu SB, Haque MA, et al. Elevated serum expression of p53 and association of TP53 codon 72 polymorphisms with risk of cervical cancer in Bangladeshi women. PLoS One. 2021;16:e0261984. 10.1371/JOURNAL.PONE.0261984 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Gangwar R, Mittal B, Mittal RD. Association of interleukin‐6 ‐174G>C promoter polymorphism with risk of cervical cancer. Int J Biol Markers. 2009;24:11‐16. 10.1177/172460080902400102 [DOI] [PubMed] [Google Scholar]
  • 42. Duan HX, Chen YY, Shi JZ, Ren NN, Li XJ. Association of IL‐6 −174G>C (rs1800795) polymorphism with cervical cancer susceptibility. Biosci Rep. 2018;38:BSR20181071. 10.1042/BSR20181071/87533 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Parsaeian SF, Asadian F, Karimi‐Zarchi M, et al. A meta‐analysis for association of XRCC3 rs861539, MTHFR rs1801133, IL‐6 rs1800795, IL‐12B rs3212227, TNF‐α rs1800629, and TLR9 rs352140 polymorphisms with susceptibility to cervical carcinoma. Asian Pacific J Cancer Prev. 2021;22:3419‐3431. 10.31557/APJCP.2021.22.11.3419 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Alder N, Fenty J, Warren F, et al. Meta‐analysis of mortality and cancer incidence among workers in the synthetic rubber‐producing industry. Am J Epidemiol. 2006;164:405‐420. 10.1093/AJE/KWJ252 [DOI] [PubMed] [Google Scholar]
  • 45. Cortessis VK, Barrett M, BrownWade N, et al. Intrauterine device use and cervical cancer risk: a systematic review and meta‐analysis. Obstetrics Gynecol. 2017;130:1226‐1236. 10.1097/AOG.0000000000002307 [DOI] [PubMed] [Google Scholar]
  • 46. Spotnitz ME, Natarajan K, Ryan PB, Westhoff CL. Relative risk of cervical neoplasms among copper and levonorgestrel‐releasing intrauterine system users. Obstetrics Gynecol. 2020;135:319‐327. 10.1097/AOG.0000000000003656 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Sugawara Y, Tsuji I, Mizoue T, et al. Cigarette smoking and cervical cancer risk: an evaluation based on a systematic review and meta‐analysis among Japanese women. Jpn J Clin Oncol. 2019;49:77‐86. 10.1093/JJCO/HYY158 [DOI] [PubMed] [Google Scholar]
  • 48. Nagelhout G, Ebisch RM, Van Der Hel O, et al. Is smoking an independent risk factor for developing cervical intra‐epithelial neoplasia and cervical cancer? A systematic review and meta‐analysis. Expert Rev Anticancer Ther. 2021;21:781‐794. 10.1080/14737140.2021.1888719 [DOI] [PubMed] [Google Scholar]
  • 49. Ortlepp JR, Metrikat J, Vesper K, et al. The interleukin‐6 promoter polymorphism is associated with elevated leukocyte, lymphocyte, and monocyte counts and reduced physical fitness in young healthy smokers. J Mol Med. 2003;81:578‐584. 10.1007/S00109-003-0471-6 [DOI] [PubMed] [Google Scholar]
  • 50. Brull DJ, Lesson CPM, Montgomery HE, et al. The effect of the Interleukin‐6‐174G > C promoter gene polymorphism on endothelial function in healthy volunteers: ILb genotype and endothelial function. Eur J Clin Invest. 2002;32:153‐157. 10.1046/J.1365-2362.2002.00966.X [DOI] [PubMed] [Google Scholar]
  • 51. Castle PE. How does tobacco smoke contribute to cervical carcinogenesis? J Virol. 2008;82:6084‐6086. 10.1128/JVI.00103-08 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting information.

Data Availability Statement

The authors confirm that the data supporting the findings of this study are available within the article and its Supporting Information. All authors have read and approved the final version of the manuscript. Monishita Shaswati and Fihima Hossain Oeishy had full access to all of the data in this study and took complete responsibility for the integrity of the data and the accuracy of the data analysis.


Articles from Health Science Reports are provided here courtesy of Wiley

RESOURCES