Abstract
Septic cardiomyopathy is associated with mechanisms such as excessive inflammation, oxidative stress, regulation of calcium homeostasis, endothelial dysfunction, mitochondrial dysfunction, and cardiomyocyte death, and there is no effective treatment at present. MOTS-c is a mitochondria-derived peptide (MDP) encoded by mitochondrial DNA (mtDNA) that protects cells from stresses in an AMPK-dependent manner. In the present study, we aim to explore the protective effect of MOTS-c on lipopolysaccharide (LPS)-induced septic cardiomyopathy. LPS is used to establish a model of septic cardiomyopathy. Our results demonstrate that MOTS-c treatment reduces the mRNA levels of inflammatory cytokines ( IL-1β, IL-4, IL-6, and TNFα) in cardiomyocytes and the levels of circulating myocardial injury markers, such as CK-MB and TnT, alleviates cardiomyocyte mitochondrial dysfunction and oxidative stress, reduces cardiomyocyte apoptosis, activates cardioprotection-related signaling pathways, including AMPK, AKT, and ERK, and inhibits the inflammation-related signaling pathways JNK and STAT3. However, treatment with the AMPK pathway inhibitor compound C (CC) abolishes the positive effect of MOTS-c on LPS stress. Collectively, our research suggests that MOTS-c may attenuate myocardial injury in septic cardiomyopathy by activating AMPK and provides a new idea for therapeutic strategies in septic cardiomyopathy.
Keywords: MOTS-c, septic cardiomyopathy, inflammation, myocardial apoptosis, AMPK pathway
Introduction
Currently, sepsis is defined as severe organ dysfunction caused by a dysregulated response of the host to infection and is the leading cause of death in hospitalized patients with multiorgan failure due to infection [1]. The cardiovascular system is commonly damaged in sepsis, indeed, septic cardiomyopathy is one of the most life-threatening complications of sepsis and is manifested mainly by reduced left ventricular dilatation and a decreased ejection fraction (EF) due to sepsis syndrome [ 2, 3] . Unfortunately, there is no effective treatment for septic cardiomyopathy. Therefore, identifying approaches to alleviate myocardial injury and improve survival in patients with septic cardiomyopathy has become an urgent need.
Previous studies have shown that the pathophysiological mechanisms of septic cardiomyopathy include both extracellular and intracellular mechanisms, such as myocardial depressant substances, an imbalance in the inflammatory response, dysregulation of calcium regulation, mitochondrial dysfunction, and oxidative stress [ 4‒ 6] . Increased levels of circulating inflammatory factors, oxygen free radicals, and cytotoxic substances lead to impaired mitochondrial function and dysregulation of mitochondrial quality control (MQC) [ 7‒ 9] . Myocardial function is subsequently impaired through mitochondrial dysfunction, oxidative stress, and cardiomyocyte apoptosis [3].
Mitochondria-derived peptides (MDPs) are a series of peptides encoded by mitochondrial DNA (mtDNA). Eight kinds of MDPs, including humanin, mitochondrial open reading frame (ORF) of 12S rDNA type-c (MOTS-c) and small humanin-like peptide 1 to 6 (SHLP-1‒6), have been identified [ 10‒ 12] . In previous studies, MDPs were found to act as metabolic regulators performing various protective functions, such as maintaining mitochondrial functional homeostasis under stress, regulating cellular metabolism, promoting mitochondrial biosynthesis, and responding to inflammation and oxidative stress [ 13‒ 15] . MOTS-c was found to improve insulin sensitivity, regulate energy metabolism, and protect cells from stresses by activating the AMPK signaling pathway [ 11, 16, 17] . There are also reports that the symptoms of acute lung injury can be alleviated by MOTS-c treatment in animal experiments, possibly by reducing the levels of associated proinflammatory factors [18]. In addition, symptoms of acute lung injury can be alleviated by MOTS-c treatment in mice [19]. However, the role of MOTS-c in septic cardiomyopathy is unclear. The above mentioned findings indicate that MOTS-c maintains mitochondrial functional homeostasis through activation of AMPK and attenuates inflammatory responses and oxidative stress, suggesting that it may play a role in septic cardiomyopathy.
In the present study, we showed that MOTS-c treatment significantly attenuates myocardial injury and inflammatory responses in mice with septic cardiomyopathy, reduces myocardial apoptosis, activates myocardial protection-related signaling pathways, and reduces reactive oxygen species (ROS) production. However, the protective effect of MOTS-c is reversed by treatment with dorsomorphin, an AMPK inhibitor.
Materials and Methods
Animal experiment
Mice were obtained from Vital River (Nanjing, China). Mice (8 to 10 weeks old) weighing 20 to 22 g were bred in an SPF facility. The mice were randomized into three groups ( n=8 mice per group): the control group (treated with saline), LPS group (treated with LPS), and MOTS-c group (treated with LPS+MOTS-c). To establish a model of septic cardiomyopathy, mice were intraperitoneally injected with 20 mg/kg LPS (L26680; Sigma, St Louis, USA). For the MOTS-c group, mice were intraperitoneally injected with 15 mg/kg of MOTS-c (Peptide, Shanghai, China) 6 h before LPS injection. The dosage and frequency of MOTS-c used in this study were determined according to previous studies and the results of our pre-experiment. Twelve hours after LPS injection, echocardiography was performed for all mice, after which the heart and serum were collected from each mouse for further analysis. All experimental protocols were approved by the Animal Experiment Committee of Shanghai Chest Hospital of Shanghai Jiao Tong University (Shanghai, China).
Cell culture
H9c2 cells were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and cultured in DMEM (11965092; Gibco, Carlsbad, USA) supplemented with 10% fetal bovine serum (FBS; 10099141; Gibco) and 1% penicillin/streptomycin (15140122, Gibco). LPS (20 μg/mL) was applied for 24 h to induce cardiomyocyte injury. Based on the results of the pre-experiment, 15 μM MOTS-c was applied in this study.
ELISA
The levels of TNF-α, TnT and CK-MB in serum were detected by ELISA using the corresponding kits (Mlbio, Shanghai, China) according to the manufacturer’s instructions.
Echocardiography
Twelve hours after LPS injection, echocardiography was performed on isoflurane-anaesthetized mice with a high-resolution imaging system (Vevo 3100 Imaging System; Visual Sonics, Tokyo, Japan). The heart rate (HR), fractional shortening (FS), left ventricular ejection fraction (LVEF), left ventricular systolic inner diameter (LVID), and left ventricular diastolic inner diameter (LVIDd) were recorded.
Western blot analysis
The lysate was centrifuged, the supernatant was collected, and the protein concentration was measured with a BCA kit (23225; Thermo Scientific, Waltham, USA). Proteins (20 μg) were separated by SDS-PAGE using a 10%‒12% gradient gel. Next, the samples were transferred to PVDF membranes (Millipore, Billerica, USA). Membranes were blocked for 1 h with 5% skimmed milk, followed by incubation with primary antibodies overnight at 4°C. Then, the membranes were incubated with the corresponding peroxidase-conjugated secondary antibodies (Beyotime, Shanghai, China) for 1 h. Finally, the protein bands were visualized using SuperSignal West Pico PLUS (34580; Thermo Scientific), and images of the protein bands were acquired using a fluorescence imaging system (Amersham Imager 680; GE Healthcare, Wisconsin, USA) and quantified using. The primary antibodies used in this study include: anti-phospho-ERK (4370; 1:1000; Cell Signaling Technology, Beverly, USA), anti-ERK (4695; 1:1000; Cell Signaling Technology), anti-phospho-JNK (4668; 1:500; Cell Signaling Technology), anti-JNK (9252; 1:1000; Cell Signaling Technology), anti-phospho-P38 (9216; 1:1000; Cell Signaling Technology), anti-P38 (8690; 1:1000; Cell Signaling Technology), anti-phospho-AKT (13038; 1:1000; Cell Signaling Technology), anti-AKT (60203-2-Ig; 1:1000; Proteintech, Wuhan, China), anti-phospho-AMPK (50081; 1:1000; Cell Signaling Technology), anti-AMPK (5832; 1:1000; Cell Signaling Technology), anti-phospho-STAT3 (52075; 1:1000; Cell Signaling Technology), anti-STAT3 (9139; 1:1000; Cell Signaling Technology), anti-BAX (1:1000; Proteintech), anti-BCL2 (1:1000; Proteintech), anti-Cleaved-Caspase3 (1:1000; Proteintech) and anti-GAPDH (1:1000; Cell Signaling Technology).
TUNEL staining
Myocardial cell death in vivo was identified using the terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) assay with a TUNEL Cell Apoptosis Detection kit (Servicebio, Wuhan, China). Staining was finished according to the manufacturer’s instructions. Five fields per section in three sections were examined from each experimental group.
Reactive oxygen species assay
The level of ROS in each group was detected by the Reactive Oxygen Species Assay kit (Beyotime) according to the manufacturer’s instructions.
RNA extraction and qRT-PCR
According to manufacturer’s instructions, we used RNA easy Isolation Reagent (Vazyme, Shanghai, China) to extract total RNA from H9C2 cells or myocardial tissues. cDNA was synthesized using RT kit (Vazyme), and then performed qPCR assay. The reaction conditions were as follows: 5 min at 95°C, 40 cycles of 10 s at 95°C, 30 s at 60°C, 15 s at 95°C, 60 s at 60°C, and 15 s at 95°C. Relative gene expression level was calculated using the 2 −ΔΔCt method. The primer sequences used were shown in Table 1.
Table 1 Sequences of primers used in this study
|
Name |
Sequence (5′→3′) |
|
IL-1β (Mouse) |
Forward: AGCTTCCTTGTGCAAGTGTCTG |
|
Reverse: CCACTCTCCAGTACCCACTGA | |
|
IL-4 (Mouse) |
Forward: TCACAGCAACGAAGAACACCA |
|
Reverse: CAGGCATCGAAAGCCCGAA | |
|
IL-6 (Mouse) |
Forward: GACAAAGCCAGAGTCCTTCAGA |
|
Reverse: TGTGACTCCAGCTTATCTCTTGG | |
|
IL-10 (Mouse) |
Forward: CCAAGGTGTCTACAAGGCCA |
|
Reverse: GCTCTGTCTAGGTCCTGGAGT | |
|
TNF-α (Mouse) |
Forward: GATCGGTCCCCAAAGGGATG |
|
Reverse: CCACTTGGTGGTTTGTGAGTG | |
|
IL-1β (Rat) |
Forward: TGGCAACTGTCCCTGAACTC |
|
Reverse: AAGGGCTTGGAAGCAATCCTTA | |
|
IL-6 (Rat) |
Forward: CCAGTTGCCTTCTTGGGACT |
|
Reverse: TGCCATTGCACAACTCTTTTC | |
|
TNF-α (Rat) |
Forward: ATGGGCTCCCTCTCATCAGT |
|
Reverse: GCTTGGTGGTTTGCTACGAC |
Flow cytometric analysis of apoptosis
According to the manufacturer’s instructions, we used an Annexin V-FITC/PI Apoptosis Detection kit (BD, Franklin, USA) to assess apoptotic cells. In brief, H9C2 cells were harvested and washed twice with PBS at 4°C. Then, the cells were resuspended in binding buffer at a concentration of 1×10 6 cells/mL. Transfer 100 μL of the solution (1×10 5 cells) to a 5 mL culture tube. Then, 5 μL of FITC Annexin V and 5 μL PI were added to each tube, and the cells were vortexed and incubated for 15 min at 25°C in the dark. Then, 400 μL of binding buffer was added to each tube, and the cells were counted by a BD CantoII flow cytometer (BD, Franklin Lakes, USA).
Mitochondrial membrane potential measurement
After cell processing was complete, the medium was aspirated, and 1 mL of JC-1 working solution was added to each well. The mixtures were then incubated at room temperature for 20 min (protected from light). Then, the JC-1 working solution was removed, and the cells were washed twice with JC-1 1× buffer. Finally, the cells were examined and photographed by fluorescence microscopy (Leica, Wetzlar, Germany) in 30 min.
Statistical analysis
All results in this study are expressed as the mean±standard error (SE) values. According to the KS test, the results are all normally distributed. Unpaired Student’s t test was used for comparisons between two groups. Analysis was performed using GraphPad Prism 8.3.0 software. P<0.05 was considered statistically significant.
Results
MOTS-c reduces the inflammatory response in LPS-induced septic cardiomyopathy
We injected LPS (20 mg/kg) into wild-type (WT) mice to establish a model of septic cardiomyopathy. Mice in the MOTS-c group were also injected with MOTS-c (15 mg/kg) before LPS exposure. Based on previous studies, an imbalance in the inflammatory response is an important mechanism and initial cause of septic cardiomyopathy. Therefore, we assessed changes in inflammatory factors at the mRNA level using qRT-PCR. LPS treatment significantly increased the mRNA levels of IL-1β, IL-4, IL-6, and TNFα compared with those in control mice ( Figure 1A‒E). In contrast, LPS treatment decreased the mRNA level of the anti-inflammatory factor IL-10. Interestingly, MOTS-c treatment reversed the increases of the transcript levels of these inflammatory factors, suggesting that MOTS-c suppressed the inflammatory response in mice with septic cardiomyopathy. Furthermore, the serum levels of myocardial injury markers (CK-MB, TnT and TNF-α) were significantly increased after LPS exposure compared to those in control mice, as detected by ELISA ( Figure 1F‒H). In contrast, treatment with MOTS-c reversed these increases and attenuated myocardial injury. We used small animal ultrasound imaging to detect cardiac function and found that the LVEF and LVFS levels were decreased in LPS-treated mice compared to control mice ( Figure 1I,J). Notably, MOTS-c treatment partially reversed the LPS-induced decrease in cardiac function. Hematoxylin and eosin staining showed significant myocardial injury, myocardial edema, and interstitial inflammatory cell infiltration in the LPS group ( Figure 1K). However, MOTS-c treatment attenuated myocardial injury. Based on these results, we concluded that MOTS-c attenuated myocardial inflammation and ameliorated myocardial dysfunction in mice with LPS-induced septic cardiomyopathy.
Figure 1 .
MOTS-c reduces the inflammatory response in LPS-induced septic cardiomyopathy
(A‒E) RNA was isolated, and the transcription of IL-1β, IL-4, IL-6, IL-10 and TNFα was measured. (F‒H) Blood was isolated, and ELISAs were used to detect alterations in CK-MB, TnT and TNFα. (I,J) Heart function was evaluated by echocardiography. (K) H&E staining of heart tissue. * P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001.
MOTS-c attenuates myocardial apoptosis in LPS-induced septic cardiomyopathy
Increased levels of circulating inflammatory factors, oxygen free radicals and other cytotoxic substances lead to myocardial cell death, an important cause of myocardial dysfunction in sepsis. Western blot analysis showed a decrease in the expression of the anti-apoptotic protein BCL-2 accompanied by a significant increase in the expression of the pro-apoptotic protein BAX and an increase in the level of cleaved Caspase 3 in the LPS group, however, these trends were reversed in the MOTS-c group ( Figure 2A‒C). We used a terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) assay to assess myocardial cell death in vivo. The percentage of TUNEL-positive cells was significantly increased in the LPS group, but MOTS-c treatment decreased LPS-induced myocardial cell death ( Figure 2D,E). This finding was verified by in vitro experiments. To this end, we established a cell model of septic cardiomyopathy using LPS in the H9C2 cell line. Cardiomyocyte viability, as assessed by CCK8 assay, was elevated significantly at an LPS concentration of 20 μg/mL, but this trend was reversed by MOTS-c treatment ( Figure 2F). We then analysed apoptosis by flow cytometry. Stimulation with LPS increased the percentage of apoptotic cells, but the percentage of apoptotic cells was significantly decreased in the MOTS-c group ( Figure 2G,H). Thus, MOTS-c treatment reduced cardiomyocyte death in septic cardiomyopathy by attenuating apoptosis.
Figure 2 .
MOTS-c attenuates myocardial apoptosis in LPS-induced septic cardiomyopathy
(A) Typical western blots of GAPDH, BAX, BCL-2 and cleaved Caspase-3. (B,C) Relative quantitative results of BAX/BCL-2 and cleaved Caspase-3/GAPDH. (D,E) Cell death after LPS induction was assessed by TUNEL staining, and the percentage of TUNEL-positive cells was counted. (F) Cardiomyocyte viability. (G,H) LPS increased the percentage of apoptotic cells, but the percentage of apoptotic cells was significantly decreased in the MOTS-c group. * P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001.
MOTS-c reduces mitochondrial damage in LPS-induced septic cardiomyopathy
In sepsis, impaired mitochondrial function in cardiomyocytes is a central pathological mechanism of myocardial injury. In the early stage of impaired mitochondrial function, mitochondrial membrane potential (MMP) can decrease, leading to the release of large amounts of ROS and exacerbating oxidative damage in cardiomyocytes. In our study, we used the JC-1 probe to measure MMP. When MMP is high, JC-1 aggregates in the mitochondrial matrix to produce red fluorescence. After LPS stimulation, MMP decreased, as evidenced by the falling ratio of red: green ( Figure 3A,B). Interestingly, this change was reversed in the MOTS-c group. The results of the ROS assay using the fluorescent probe DCFH-DA showed that ROS production was increased under LPS-induced stress, however, MOTS-c treatment abolished the excess ROS production in cardiomyocytes ( Figure 3C,D). Moreover, the level of cellular antioxidants was decreased after LPS stimulation. However, cellular antioxidant levels were higher in the MOTS-c group than in the LPS group ( Figure 3E,F). In conclusion, LPS-induced mitochondrial functional impairment and oxidative stress in cardiomyocytes were alleviated by MOTS-c treatment.
Figure 3 .
MOTS-c reduces mitochondrial damage in LPS-induced septic cardiomyopathy
(A,B) JC-1 staining in H9c2 cells. (C,D) Cellular ROS production. (E,F) Determination of MDA and SOD in H9C2 cells. * P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001.
MOTS-c activates multiple cardioprotective signaling pathways in LPS-induced septic cardiomyopathy
Based on the role of MOTS-c in attenuating the inflammatory response, we investigated the classical MAPK inflammatory signaling pathway (including p38, JNK and ERK). Western blot analysis showed that the p-P38 and p-JNK levels were increased but the p-ERK level was significantly decreased in the LPS group ( Figure 4A‒D). The p-JNK and p-ERK levels in the MOTS-c group showed the opposite trend to those in the LPS group, but the difference in the p-P38 level was not statistically significant. We examined myocardial AMPK and AKT expressions in mice with septic cardiomyopathy after MOTS-c treatment and found that MOTS-c significantly elevated the decreased p-AMPK and p-AKT levels in the hearts of septic mice ( Figure 4E,F). The expression of P-STAT3 was higher in the LPS group than that in the control group, and MOTS-c treatment decreased the p-STAT3 level ( Figure 4G). Thus, we concluded that MOTS-c activated multiple cardioprotective signaling pathways (including AMPK, AKT and ERK) and inhibited proinflammatory signaling pathways (JNK, P38 and STAT3) in LPS-induced septic cardiomyopathy.
Figure 4 .
MOTS-c activates multiple cardioprotective signaling pathways in LPS-induced septic cardiomyopathy
(A) Typical western blots of GAPDH, P-ERK, ERK, P-JNK, JNK, P-P38, P38, P-AKT, AKT, P-AMPK, AMPK, P-STAT3, and STAT3. (B‒G) Relative quantitative results of GAPDH, P-ERK, ERK, P-JNK, JNK, P-P38, P38, P-AKT, AKT, P-AMPK, AMPK, P-STAT3, and STAT3. * P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001.
MOTS-c treatment does not protect cardiomyocytes from LPS-induced myocardial injury after inhibition of AMPK
AMPK mediates the regulation of various biological processes and is a main signaling target of MOTS-c. In vitro, we mimicked septic cardiomyopathy in a cell model by treating H9C2 cells with LPS (20 μg/mL). Changes of the transcript levels of proinflammatory cytokines ( IL-1β, IL-6, and TNFα) were detected by qRT-PCR ( Figure 5A‒C). LPS-treated cells had higher levels of proinflammatory cytokines than control cells, whereas MOTS-c treatment reversed these increases, consistent with the results in our mouse model. Interestingly, the cardioprotective effect of MOTS-c was not observed in cells treated with the AMPK inhibitor CC. Moreover, the ROS assay results showed that the AMPK inhibitor CC abrogated the protective effect of MOTS-c on reducing ROS generation ( Figure 5D,E). This finding suggests that the positive effect of MOTS-c on reducing myocardial inflammation and ROS generation in LPS-induced septic cardiomyopathy may be mediated through activation of AMPK.
Figure 5 .
MOTS-c treatment fails to protect cardiomyocytes from LPS-induced myocardial injury after inhibition of AMPK
(A‒C) RNA was isolated, and the transcription of IL-1β, IL-6 and TNFα was measured by qRT-PCR. (D,E) Cellular ROS production. * P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001.
Discussion
Sepsis is a clinical syndrome of multiple organ dysfunction resulted from an excessive inflammatory response to infection [1]. Multiorgan dysfunction is the main cause of death in patients with sepsis, and the heart is one of the most vulnerable target organs [ 20‒ 22] . Unfortunately, there is no effective treatment for septic cardiomyopathy. Therefore, it is important to explore effective treatment strategies for sepsis-related myocardial injury. We observed the therapeutic effect of MOTS-c in LPS-induced septic cardiomyopathy in this study. We found that MOTS-c injection may exert a protective effect on LPS-induced myocardial dysfunction by activating the AMPK pathway and that this protective effect may be achieved via inhibition of myocardial inflammation, maintenance of mitochondrial homeostasis and attenuation of cardiomyocyte apoptosis.
An excessive inflammatory response is the initial point in septic cardiomyopathy, and myocardial damage is caused by the massive release of proinflammatory cytokines [ 23, 24] . Previous studies have shown that neutralizing circulating TNFα and IL-6 reduces myocardial dysfunction in septic mice [25]. The modulatory effect of MOTS-c on inflammatory injury has been widely reported in various disease models, including models of acute and neuropathic pain, advanced chronic kidney disease, osteolysis and acute lung injury [ 19, 26‒ 28] . This effect suggests that MOTS-c may help to attenuate sepsis-induced myocardial dysfunction, as confirmed by our findings. LPS treatment significantly elevated the transcript levels of inflammatory factors ( IL-1β, IL-4, IL-6 and TNFα) and the levels of circulating myocardial injury markers (CK-MB and TnT), which were decreased after treatment with MOTS-c [29].
ROS overproduction can directly damage cardiomyocytes by promoting the formation of oxidized protein adducts and lipid peroxides, while persistent oxidative stress promotes inflammatory signaling [30]. The increase in inflammatory factors and oxygen free radicals in the circulation leads to damage to mitochondrial function, which is initially manifested as dissipation of the mitochondrial membrane potential, rendering mitochondria incapable of sufficient conversion of membrane potential into ATP. Disruption of the cellular energy supply further aggravates the impairment of mitochondrial function [ 7, 31] . Our study showed that MOTS-c treatment restored the decreased mitochondrial membrane potential, reduced cardiomyocyte ROS generation, reduced lipid peroxide formation, and increased the content of the antioxidant SOD in cardiomyocytes.
In sepsis, the excessive inflammatory response and increased oxygen free radical production in cardiomyocytes ultimately activate apoptotic pathways, leading to cardiomyocyte death [ 30, 32] . Mitochondria also function as important signaling organelles that play a central role in apoptotic signaling pathways [33]. According to previous research, in the mitochondrial apoptotic pathway, cytochrome c binds to Apaf-1 and dATP, thereby sequentially activating caspase-3. Finally, these events lead to apoptosis [ 34‒ 36] . The mitochondrial apoptotic pathway is regulated by pro- and anti-apoptotic BCL-2 proteins [ 37‒ 39] . In the hearts of mice with septic cardiomyopathy, we found activation of the mitochondrial apoptotic signaling pathway, as indicated by the increased level of BAX, activation of cleaved Caspase-3, decreased level of BCL-2, and increased number of TUNEL-positive cells. Notably, in the MOTS-c treatment group, no obvious activation of the apoptotic signaling pathway was observed. In vitro, we calculated the proportion of apoptotic cells by flow cytometry, and the conclusion was consistent with that of the animal experiments.
MOTS-c regulates insulin sensitivity and metabolic homeostasis by a mechanism that activates AMPK [11]. To probe the molecular mechanism by which MOTS-c protects against septic cardiomyopathy, we performed western blot analysis on a series of cardiac signaling pathways, including the AMPK, MAPK, AKT, and STAT3 pathways. First, we investigated the canonical inflammatory signaling pathway driven by MAPK, whose activation is associated with the production of many proinflammatory cytokines (IL-1β, IL-6, and TNFα) after infection [40]. JNK and p38 are thought to upregulate inflammatory cytokine production and activate mitochondrial apoptotic pathways. Previous studies have shown that melatonin attenuates endoplasmic reticulum stress in LPS-induced septic cardiomyopathy by activating the ERK-BAP31 pathway [41]. In addition, combined administration of melatonin and irisin attenuated LPS-induced myocardial depression by inhibiting the Mst1-JNK pathway [42]. MOTS-c has been reported to attenuate the inflammatory response in LPS-induced acute lung injury by inhibiting the ERK, JNK and p38 pathways [19]. Western blot analysis demonstrated that MOTS-c treatment could reduce the high expression of p-JNK after LPS stimulation and increase the initially low level of p-ERK, while the change trend in the p-P38 level was statistically nonsignificant. STAT3 can be activated in response to stimulation by various cytokines (IL-6 and IFNγ) [43]. Our results showed that LPS stimulation activated STAT3 phosphorylation, whereas the p-STAT3 level was lower in the MOTS-c group. The AKT and AMPK pathways are well-established cardioprotective signaling pathways that may be involved in regulating multiple biological processes, including oxidative stress, apoptosis, inflammation, and energy metabolism [ 44– 47] . Overexpression of SirT3 has been reported to increase AMPK activity and improve mitochondrial biosynthesis, thereby attenuating sepsis-related cardiomyocyte injury [48]. Neferine ameliorates sepsis-induced myocardial dysfunction by activating the anti-apoptotic and antioxidant effects of AKT [49]. Here, western blot analysis showed that LPS stress significantly reduced the phosphorylation levels of AMPK and AKT, while MOTS-c treatment reversed this change. Based on the AMPK-activating properties of MOTS-c, we used the AMPK pathway inhibitor CC to reduce the expression level of AMPK in cardiomyocytes and found that the protective effects of MOTS-c on alleviating excessive inflammatory responses and massive ROS production were reversed after LPS stimulation.
This study has some limitations. Specifically, the use of LPS as the main model for Septic cardiomyopathy, to validate key results in bacterial or CLP model of sepsis would be better. No animal experiments were performed to confirm whether the effect of AMPK inhibition on the protective effect of MOTS-c in septic cardiomyopathy is consistent in vivo.
In summary, we found that MOTS-c injection may have a protective effect against LPS-induced myocardial dysfunction by activating the AMPK pathway and that this protective effect may be achieved via attenuation of the inflammatory response in cardiomyocytes, inhibition of cardiomyocyte apoptosis, and maintenance of mitochondrial homeostasis.
Supporting information
COMPETING INTERESTS
These authors declare that they have no conflict of interest.
Funding Statement
This work was supported by the grants from the National Natural Science Foundation of China (No. 82172156) and the Shanghai Hospital Development Center Clinical Science and Technology Innovation project (No. SHDC12019X22).
References
- 1.Seymour CW, Liu VX, Iwashyna TJ, Brunkhorst FM, Rea TD, Scherag A, Rubenfeld G, et al. Assessment of clinical criteria for sepsis. JAMA. . 2016;315:762. doi: 10.1001/jama.2016.0288. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Ehrman RR, Sullivan AN, Favot MJ, Sherwin RL, Reynolds CA, Abidov A, Levy PD. Pathophysiology, echocardiographic evaluation, biomarker findings, and prognostic implications of septic cardiomyopathy: a review of the literature. Crit Care. . 2018;22:112. doi: 10.1186/s13054-018-2043-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Hollenberg SM, Singer M. Pathophysiology of sepsis-induced cardiomyopathy. Nat Rev Cardiol. . 2021;18:424–434. doi: 10.1038/s41569-020-00492-2. [DOI] [PubMed] [Google Scholar]
- 4.Liu YC, Yu MM, Shou ST, Chai YF. Sepsis-induced cardiomyopathy: mechanisms and treatments. Front Immunol. . 2017;8:1021. doi: 10.3389/fimmu.2017.01021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Martin L, Derwall M, Al Zoubi S, Zechendorf E, Reuter DA, Thiemermann C, Schuerholz T. The septic heart. Chest. . 2019;155:427–437. doi: 10.1016/j.chest.2018.08.1037. [DOI] [PubMed] [Google Scholar]
- 6.Beesley SJ, Weber G, Sarge T, Nikravan S, Grissom CK, Lanspa MJ, Shahul S, et al. Septic cardiomyopathy. Crit Care Med. . 2018;46:625–634. doi: 10.1097/CCM.0000000000002851. [DOI] [PubMed] [Google Scholar]
- 7.Stanzani G, Duchen MR, Singer M. The role of mitochondria in sepsis-induced cardiomyopathy. Biochim Biophys Acta Mol Basis Dis. . 2019;1865:759–773. doi: 10.1016/j.bbadis.2018.10.011. [DOI] [PubMed] [Google Scholar]
- 8.Chang X, Lochner A, Wang HH, Wang S, Zhu H, Ren J, Zhou H. Coronary microvascular injury in myocardial infarction: perception and knowledge for mitochondrial quality control. Theranostics. . 2021;11:6766–6785. doi: 10.7150/thno.60143. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Zhu H, Tan Y, Du W, Li Y, Toan S, Mui D, Tian F, et al. Phosphoglycerate mutase 5 exacerbates cardiac ischemia-reperfusion injury through disrupting mitochondrial quality control. Redox Biol. . 2021;38:101777. doi: 10.1016/j.redox.2020.101777. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Hashimoto Y, Niikura T, Tajima H, Yasukawa T, Sudo H, Ito Y, Kita Y, et al. A rescue factor abolishing neuronal cell death by a wide spectrum of familial Alzheimer′s disease genes and Aβ. Proc Natl Acad Sci USA. . 2001;98:6336–6341. doi: 10.1073/pnas.101133498. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Lee C, Zeng J, Drew BG, Sallam T, Martin-Montalvo A, Wan J, Kim SJ, et al. The mitochondrial-derived peptide MOTS-c promotes metabolic homeostasis and reduces obesity and insulin resistance. Cell Metab. . 2015;21:443–454. doi: 10.1016/j.cmet.2015.02.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Cobb LJ, Lee C, Xiao J, Yen K, Wong RG, Nakamura HK, Mehta HH, et al. Naturally occurring mitochondrial-derived peptides are age-dependent regulators of apoptosis, insulin sensitivity, and inflammatory markers. Aging. . 2016;8:796–809. doi: 10.18632/aging.100943. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Guo B, Zhai D, Cabezas E, Welsh K, Nouraini S, Satterthwait AC, Reed JC. Humanin peptide suppresses apoptosis by interfering with Bax activation. Nature. . 2003;423:456–461. doi: 10.1038/nature01627. [DOI] [PubMed] [Google Scholar]
- 14.Gong Z, Tasset I, Diaz A, Anguiano J, Tas E, Cui L, Kuliawat R, et al. Humanin is an endogenous activator of chaperone-mediated autophagy. J Cell Biol. . 2018;217:635–647. doi: 10.1083/jcb.201606095. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Qin Q, Jin J, He F, Zheng Y, Li T, Zhang Y, He J. Humanin promotes mitochondrial biogenesis in pancreatic MIN6 β-cells. Biochem Biophys Res Commun. . 2018;497:292–297. doi: 10.1016/j.bbrc.2018.02.071. [DOI] [PubMed] [Google Scholar]
- 16.Guo Q, Chang B, Yu Q, Xu S, Yi X, Cao S. Adiponectin treatment improves insulin resistance in mice by regulating the expression of the mitochondrial-derived peptide MOTS-c and its response to exercise via APPL1–SIRT1–PGC-1α. Diabetologia. . 2020;63:2675–2688. doi: 10.1007/s00125-020-05269-3. [DOI] [PubMed] [Google Scholar]
- 17.Yang B, Yu Q, Chang B, Guo Q, Xu S, Yi X, Cao S. MOTS-c interacts synergistically with exercise intervention to regulate PGC-1α expression, attenuate insulin resistance and enhance glucose metabolism in mice via AMPK signaling pathway. Biochim Biophys Acta Mol Basis Dis. . 2021;1867:166126. doi: 10.1016/j.bbadis.2021.166126. [DOI] [PubMed] [Google Scholar]
- 18.Zhai D, Ye Z, Jiang Y, Xu C, Ruan B, Yang Y, Lei X, et al. MOTS-c peptide increases survival and decreases bacterial load in mice infected with MRSA. Mol Immunol. . 2017;92:151–160. doi: 10.1016/j.molimm.2017.10.017. [DOI] [PubMed] [Google Scholar]
- 19.Xinqiang Y, Quan C, Yuanyuan J, Hanmei X. Protective effect of MOTS-c on acute lung injury induced by lipopolysaccharide in mice. Int Immunopharmacol. . 2020;80:106174. doi: 10.1016/j.intimp.2019.106174. [DOI] [PubMed] [Google Scholar]
- 20.Hochstadt A, Meroz Y, Landesberg G. Myocardial dysfunction in severe sepsis and septic shock: more questions than answers? J Cardiothoracic Vascular Anesth. . 2011;25:526–535. doi: 10.1053/j.jvca.2010.11.026. [DOI] [PubMed] [Google Scholar]
- 21.Sui X, Liu W, Liu Z. Exosomal lncRNA-p21 derived from mesenchymal stem cells protects epithelial cells during LPS-induced acute lung injury by sponging miR-181. Acta Biochim Biophys Sin. . 2021;53:748–757. doi: 10.1093/abbs/gmab043. [DOI] [PubMed] [Google Scholar]
- 22.Yang N, Wang H, Zhang L, Lv J, Niu Z, Liu J, Zhang Z. Long non-coding RNA SNHG14 aggravates LPS-induced acute kidney injury through regulating miR-495-3p/HIPK1. Acta Biochim Biophys Sin. . 2021;53:719–728. doi: 10.1093/abbs/gmab034. [DOI] [PubMed] [Google Scholar]
- 23.Schulte W, Bernhagen J, Bucala R. Cytokines in sepsis: potent immunoregulators and potential therapeutic targets—an updated view. Mediators Inflamm. . 2013;2013:1–16. doi: 10.1155/2013/165974. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Fattahi F, Ward PA. Complement and sepsis-induced heart dysfunction. Mol Immunol. . 2017;84:57–64. doi: 10.1016/j.molimm.2016.11.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Remick DG, Call DR, Ebong SJ, Newcomb DE, Nybom P, Nemzek JA, Bolgos GE. Combination immunotherapy with soluble tumor necrosis factor receptors plus interleukin 1 receptor antagonist decreases sepsis mortality. Crit Care Med. . 2001;29:473–481. doi: 10.1097/00003246-200103000-00001. [DOI] [PubMed] [Google Scholar]
- 26.Liu C, Gidlund EK, Witasp A, Qureshi AR, Söderberg M, Thorell A, Nader GA, et al. Reduced skeletal muscle expression of mitochondrial-derived peptides humanin and MOTS-C and Nrf2 in chronic kidney disease. Am J Physiol-Renal Physiol. . 2019;317:F1122–F1131. doi: 10.1152/ajprenal.00202.2019. [DOI] [PubMed] [Google Scholar]
- 27.Yan Z, Zhu S, Wang H, Wang L, Du T, Ye Z, Zhai D, et al. MOTS-c inhibits osteolysis in the mouse calvaria by affecting osteocyte-osteoclast crosstalk and inhibiting inflammation. Pharmacol Res. . 2019;147:104381. doi: 10.1016/j.phrs.2019.104381. [DOI] [PubMed] [Google Scholar]
- 28.Yin X, Jing Y, Chen Q, Abbas AB, Hu J, Xu H. The intraperitoneal administration of MOTS-c produces antinociceptive and anti-inflammatory effects through the activation of AMPK pathway in the mouse formalin test. Eur J Pharmacol. . 2020;870:172909. doi: 10.1016/j.ejphar.2020.172909. [DOI] [PubMed] [Google Scholar]
- 29.Sun M, Han X, Zhou D, Zhong J, Liu L, Wang Y, Ni J, et al. BIG1 mediates sepsis-induced lung injury by modulating lipid raft-dependent macrophage inflammatory responses. Acta Biochim Biophys Sin. . 2021;53:1088–1097. doi: 10.1093/abbs/gmab085. [DOI] [PubMed] [Google Scholar]
- 30.Galley HF. Oxidative stress and mitochondrial dysfunction in sepsis. Br J Anaesthesia. . 2011;107:57–64. doi: 10.1093/bja/aer093. [DOI] [PubMed] [Google Scholar]
- 31.Gu J, Luo L, Wang Q, Yan S, Lin J, Li D, Cao B, et al. Maresin 1 attenuates mitochondrial dysfunction through the ALX/cAMP/ROS pathway in the cecal ligation and puncture mouse model and sepsis patients. Lab Invest. . 2018;98:715–733. doi: 10.1038/s41374-018-0031-x. [DOI] [PubMed] [Google Scholar]
- 32.Giustina AD, Bonfante S, Zarbato GF, Danielski LG, Mathias K, de Oliveira Jr AN, Garbossa L, et al. Dimethyl fumarate modulates oxidative stress and inflammation in organs after sepsis in rats. Inflammation. . 2018;41:315–327. doi: 10.1007/s10753-017-0689-z. [DOI] [PubMed] [Google Scholar]
- 33.Vakifahmetoglu-Norberg H, Ouchida AT, Norberg E. The role of mitochondria in metabolism and cell death. Biochem Biophys Res Commun. . 2017;482:426–431. doi: 10.1016/j.bbrc.2016.11.088. [DOI] [PubMed] [Google Scholar]
- 34.Li P, Nijhawan D, Budihardjo I, Srinivasula SM, Ahmad M, Alnemri ES, Wang X. Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade. Cell. . 1997;91:479–489. doi: 10.1016/S0092-8674(00)80434-1. [DOI] [PubMed] [Google Scholar]
- 35.Acehan D, Jiang X, Morgan DG, Heuser JE, Wang X, Akey CW. Three-dimensional structure of the apoptosome. Mol Cell. . 2002;9:423–432. doi: 10.1016/S1097-2765(02)00442-2. [DOI] [PubMed] [Google Scholar]
- 36.Jiang X, Wang X. Cytochrome c promotes caspase-9 activation by inducing nucleotide binding to Apaf-1. J Biol Chem. . 2000;275:31199–31203. doi: 10.1074/jbc.C000405200. [DOI] [PubMed] [Google Scholar]
- 37.Imahashi K, Schneider MD, Steenbergen C, Murphy E. Transgenic expression of Bcl-2 modulates energy metabolism, prevents cytosolic acidification during ischemia, and reduces ischemia/reperfusion injury. Circ Res. . 2004;95:734–741. doi: 10.1161/01.RES.0000143898.67182.4c. [DOI] [PubMed] [Google Scholar]
- 38.Reeve JL, Szegezdi E, Logue SE, Chonghaile TN, O?Brien T, Ritter T, Samali A. Distinct mechanisms of cardiomyocyte apoptosis induced by doxorubicin and hypoxia converge on mitochondria and are inhibited by Bcl-xL. J Cell Mol Med. . 2007;11:509–520. doi: 10.1111/j.1582-4934.2007.00042.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Kubli DA, Ycaza JE, Gustafsson ÅB. Bnip3 mediates mitochondrial dysfunction and cell death through Bax and Bak. Biochem J. . 2007;405:407–415. doi: 10.1042/BJ20070319. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Emre Y, Hurtaud C, Nübel T, Criscuolo F, Ricquier D, Cassard-Doulcier AM. Mitochondria contribute to LPS-induced MAPK activation via uncoupling protein UCP2 in macrophages. Biochem J. . 2007;402:271–278. doi: 10.1042/BJ20061430. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Zhang J, Wang L, Xie W, Hu S, Zhou H, Zhu P, Zhu H. Melatonin attenuates ER stress and mitochondrial damage in septic cardiomyopathy: a new mechanism involving BAP31 upregulation and MAPK‐ERK pathway. J Cell Physiol. . 2020;235:2847–2856. doi: 10.1002/jcp.29190. [DOI] [PubMed] [Google Scholar]
- 42.Ouyang H, Li Q, Zhong J, Xia F, Zheng S, Lu J, Deng Y, et al. Combination of melatonin and irisin ameliorates lipopolysaccharide‐induced cardiac dysfunction through suppressing the Mst1–JNK pathways. J Cell Physiol. . 2020;235:6647–6659. doi: 10.1002/jcp.29561. [DOI] [PubMed] [Google Scholar]
- 43.Zhong Z, Wen Z, Darnell James E. J. Stat3: a STAT family member activated by tyrosine phosphorylation in response to epidermal growth factor and interleukin-6. Science. . 1994;264:95–98. doi: 10.1126/science.8140422. [DOI] [PubMed] [Google Scholar]
- 44.Jager S, Handschin C, St.-Pierre J, Spiegelman BM. AMP-activated protein kinase (AMPK) action in skeletal muscle via direct phosphorylation of PGC-1α. Proc Natl Acad Sci USA. . 2007;104:12017–12022. doi: 10.1073/pnas.0705070104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Lejay A, Fang F, John R, Van JA, Barr M, Thaveau F, Chakfe N, et al. Ischemia reperfusion injury, ischemic conditioning and diabetes mellitus. J Mol Cell Cardiol. . 2016;91:11–22. doi: 10.1016/j.yjmcc.2015.12.020. [DOI] [PubMed] [Google Scholar]
- 46.Qi D, Hu X, Wu X, Merk M, Leng L, Bucala R, Young LH. Cardiac macrophage migration inhibitory factor inhibits JNK pathway activation and injury during ischemia/reperfusion. J Clin Invest. . 2009;119:3807–3816. doi: 10.1172/JCI39738. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Tong XX, Wu D, Wang X, Chen HL, Chen JX, Wang XX, Wang XL, et al. Ghrelin protects against cobalt chloride-induced hypoxic injury in cardiac H9c2 cells by inhibiting oxidative stress and inducing autophagy. Peptides. . 2012;38:217–227. doi: 10.1016/j.peptides.2012.06.020. [DOI] [PubMed] [Google Scholar]
- 48.Xin T, Lu C. SirT3 activates AMPK-related mitochondrial biogenesis and ameliorates sepsis-induced myocardial injury. Aging. . 2020;12:16224–16237. doi: 10.18632/aging.103644. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Qi Z, Wang R, Liao R, Xue S, Wang Y. Neferine ameliorates sepsis-induced myocardial dysfunction through anti-apoptotic and antioxidative effects by regulating the PI3K/AKT/mTOR signaling pathway. Front Pharmacol. . 2021;12:706251. doi: 10.3389/fphar.2021.706251. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.