Skip to main content
Bioinformatics and Biology Insights logoLink to Bioinformatics and Biology Insights
. 2023 May 1;17:11779322231170988. doi: 10.1177/11779322231170988

A Novel c.100C > G Mutation in the FST Gene and Its Relation With the Reproductive Traits of Awassi Ewes

Tahreer M Al-Thuwaini 1,✉, Wefak J Albazi 2, Mohammed Baqur S Al-Shuhaib 1, Layth H Merzah 1, Rihab G Mohammed 1, Fadhil A Rhadi 1, Ali B Abd Al-Hadi 1, Ahmed H Alkhammas 1
PMCID: PMC10159244  PMID: 37153841

Abstract

Reproductive traits are affected by many factors, including ovarian function, hormones, and genetics. Genetic polymorphisms of candidate genes are associated with reproductive traits. Several candidate genes are associated with economic traits, including the follistatin (FST) gene. Thus, this study aimed to evaluate whether the genetic variations in the FST gene are associated with the reproductive traits in Awassi ewes. The genomic DNA was extracted from 109 twin ewes and 123 single-progeny ewes. Therefore, 4 sequence fragments from the FST gene were amplified using polymerase chain reaction (PCR) (exon 2/240, exon 3/268, exon 4/254, and exon 5/266 bp, respectively). For a 254 bp amplicon, 3 genotypes were identified: CC, CG, and GG. Sequencing revealed a novel mutation in CG genotypes c.100C > G. The statistical analysis of c.100C > G showed an association with reproductive characteristics. Ewes carrying the c.100C > G had significantly (P ⩽ .01) lower litter sizes, twinning rates, lambing rates, and more days to lambing compared with CG and CC genotypes. Logistic regression analysis confirmed that the c.100C > G single-nucleotide polymorphism (SNP) is responsible for decreasing litter size. According to these results, the variant c.100C > G negatively affects the traits of interest and is associated with lower reproductive traits in Awassi sheep. As a result of this study, ewes carrying the c.100C > G SNP have lower litter size and are less prolific.

Keywords: Follistatin, litter size, polymorphism, ovary, sheep

Introduction

Reproductive traits play a significant role in sheep productivity.1,2 Genetics and the environment influence reproductive traits. Sheep reproductive traits are regulated predominantly by genetic factors.3-5 Among the candidate genes associated with reproduction in livestock, follistatin (FST) is located on chromosome 7 of caprine, chromosome 20 of cattle, and chromosome 16 of sheep, which is composed of 6 exons.6,7 This gene encodes FST protein, is a monomeric glycoprotein (31-39 kD), that binds receptors on cysteine-rich cells and microenvironments. 8 It is expressed widely in the ovary, skin, and skeletal muscle. 6 The primary function of FST is to bind and neutralize activin through its binding properties.9,10 Since FST binds to activin, it inhibits follicle-stimulating hormone (FSH) secretion by blocking its receptor (Act-RII) from combining with it.8,11 Through suppressing FSH secretion from the anterior pituitary, FST controls granulosa cell differentiation, follicular growth, atresia, and luteinization processes. 12 In livestock species, FST variations affect sheep productivity. 13 According to the findings of Ma et al, 6 2 single-nucleotide polymorphisms (SNPs) (Chr 16. 25 633 662 A > G; Chr 16. 25 633 569 T > C) are associated with traits associated with wool quality in Chinese Merino sheep. In White Leghorn and Aseel chickens, haplogroups KF921968.1, KF921969.1, MK455102, and MK45510 are associated significantly with growth traits (P < .05). 10 Recently, a study by Zhu et al 7 revealed that SNP_chr7-65652612, located at the 3′ untranslated regions (3′ UTR ) of FST-like-4, significantly relating to litter size in Dazu black goats of the first and second parity. However, the relationship between FST variants and reproductive traits in Awassi sheep has not been investigated.

The Awassi breed is dominant mainly in Middle Eastern countries. 14 Despite their ability to cope with harsh conditions in unfavorable situations, 15 Awassi sheep have been reported to be less prolific than Karakul and Assaf sheep in the Middle East. 16 Most breeders in the Middle East are concerned about Awassi sheep’s low reproductive performance, which drives efforts to improve their reproductive quality. The FST gene may be useful in improving breeding efficiency in Awassi sheep. Therefore, this study examined possible associations between FST polymorphisms and reproductive traits in Awassi sheep by examining polymorphisms within its coding regions.

Materials and Methods

Animal

The study was conducted between July 2021 and April 2022 at Al-Qasim Green University according to international guidelines (Agri, No. 015,7, 20). The study included 232 ewes of 3 to 4 years of age that were sexually mature and multiparous. The ewes were classified as 123 singletons and 109 twins according to their reproductive history, weighing 40 to 60 kg. Therefore, 2 stations—Babylon and Karbala—were randomly selected for the ewes. In the studied flocks, 10 to 12 rams were randomly allocated to mate with about 20 to 25 ewes per ram, with male identification recorded. Veterinarians confirmed the rams’ health and demonstrated their fertile status, as they previously produced offspring. A record of lambing dates and litter sizes was kept from 160 to 200 days after the ram was introduced. All animals were fed individually and kept in similar nutrition conditions. The animals were fed daily a concentrated diet composed of 59% barley, 40% bran, and 1% salt in proportion to their body weight of 2.5%. However, 3 kg alfalfa and 1 kg of straw were also fed to each animal. All animals had access to fresh water at all times. Several reproductive traits were recorded at the breeding stations, including twinning rate, lambing rate, days to lambing, survival rate, and litter size.

DNA and polymerase chain reaction

Genetic analysis was performed by collecting blood from the sheep’s jugular vein. Rapid salting-out method was used for the extraction of genomic DNA. 17 NCBI Primer-BLAST 18 was used to amplify the FST genetic sequence for all 232 animals. Polymerase chain reaction (PCR) experiments were performed with Bioneer PreMix (50 μM deoxynucleotide triphosphates [dNTPs], 10, 30, and 1.5 mM Tris-HCl, KCl, and MgCl2, respectively, and 1 U Top DNA polymerase). The optimal PCR amplification conditions were determined using a thermal gradient device (Eppendorf, Germany) (Table 1). The PCR reaction was performed at 94°C for 4 minutes, then 30 cycles (30 seconds each) of 94°C, annealing, and 72°C were conducted. 19 A Chemidoc Gel Imager (Bio-Rad, USA) was used to image agarose gel images of PCR products electrophoresed on agarose gels (2%). 20

Table 1.

The oligonucleotide primer sets designed for the amplification of the ovine FST gene. The symbols “F” and “R” refer to forward and reverse primers, respectively. The design was based on the ovine NCBI Reference Sequence NC_056069.1.

Primer code Locus Sequence (5'-3') Binding coordinate in the genome Amplicon length (bp) Annealing temperature (°C)
Start Stop
FST,exo2-F Exon 2 AGCCCTACCTTTACACGGGA 25761558 25761577 240 61.0
FST,exo2-R CGGCTCACTTGCCTACCTC 25761797 25761779
FST,exo3-F Exon 3 GGGTCTACCTCAAGCAGAAGG 25760867 25760887 268 61.0
FST,exo3-R GAAACGTGTGAGAACGTGGAC 25761134 25761114
FST,exo4-F Exon 4 TCCTTCCTCAATCCAGAATACCT 25760339 25760361 254 59.8
FST,exo4-R TCAGAGACCTGTCGGGATGT 25760592 25760573
FST,exo5-F Exon 5 ACGGCAGCAAGGTTAGAAGT 25759453 25759472 266 58.6
FST,exo5-R TCCTAGAAGCAAAGTCCTGTGA 25759718 25759697

Abbreviation: NCBI, National Center for Biotechnology Information.

Single-strand conformation polymorphism

A genotype-based analysis was performed using the methodology described in Al-Thuwaini et al. 21 Denaturing loading buffers were added equally to each PCR amplicons (95% formamide, 0.05% xylene cyanol, and 20 mM EDTA, pH 8). A PCR amplicon was denatured for 7 minutes, then placed on wet ice and stored for 10 minutes. Samples were loaded in a 0.5 TBE buffer in polyacrylamide gels with a neutral denaturant. Following this step, the gels were electrophoresed at room temperature for 4 hours with 200 mA and 100 V. According to Byun et al 22 protocol, gels were stained using the rapid staining protocol.

DNA sequencing

Sequence laboratories (Macrogen, Geumcheon-gu, Korea) performed downstream reactions on all 232 animals once single-strand conformation polymorphism (SSCP) bands were detected on polyacrylamide gels. A sequence of the FST gene was obtained from the NCBI (https://www.ncbi.nlm.nih.gov). DNA polymorphisms within genotypes were visualized and edited with SnapGene Viewer 4.0.4 and BioEdit 7.1 (DNASTAR, Madison). To determine the novelty of observable variants, Ensembl genome browser 96 was used (https://asia.ensembl.org/index.html).

Statistical analysis

A genotype and allele frequency analysis was performed using PopGen32, version 1.31. 23 The Hardy–Weinberg equilibrium (HWE) was calculated, and the polymorphism information content (PIC) was determined according to Botstein et al. 24 Genotype associations were analyzed using IBM SPSS 23.0 (NY, USA) as follows

Yijk=μ+Gι+Pj+eijk

where Yijk are phenotypic traits, μ is mean, Gi is the fixed effect of ith genotypes (i = CC, CG, GG), Pj is the fixed effect of jth parity (j = 1, 2, 3), and eijk is random residual error. Statistical significance was determined at .05 with the Tukey–Kramer test. A chi-square test was conducted on 2 reproductive traits: lambing rate and birth type. The FST polymorphisms and litter size were analyzed using logistic regression. Model results in the preliminary analysis did not show any effect on interactions, lambing season, and age, so these were excluded from the calculation.

Results

Genotyping of FST gene, sequencing analysis, and genetic diversity

Overall, 4 FST gene coding regions corresponding to 240, 268, 254, and 266 bp were screened with PCR designs (Figure 1A). Electrophoresis showed monomorphic migration of all PCR-SSCP patterns containing amplicons covering exons 2, 3, and 5. A 254-bp amplicon designed for exon 4 showed 3 different PCR-SSCP patterns (Figure 1B). Sequencing reactions showed that only one of the SSCP variants contained the c.100C > G SNP, confirming the exon 4 heterogeneity. As a result of this nucleic acid substitution, CC, CG, and GG were assigned to the detected SSCP variants with homozygous C/C and G/G patterns, and the heterozygous C/G patterns found in the PCR-amplified products (Figure 1C). According to SNP bioinformatics analysis, the silent SNP p.205Tyr= had negative influences on the FST protein (Figure 1D).

Figure 1.

Figure 1.

A schematic diagram for the FST gene-based PCR-SSCP-sequencing strategy within Awassi ewes. (A) PCR design of 4 PCR specific primers pairs for the amplification of 240, 268, 254, and 266 bp in exons 2, 3, 4 and 5, respectively. (B) PCR-SSCP genotyping, in which only exon 4 showed 3 genotypes, homozygous and heterozygous. (C) DNA sequencing electropherograms of the detected genotypes, in which 1 SNP, c.100C > G, was detected in the exon 4 in the heterozygous CG genotype. (D) SNP bioinformatics analysis of the observed silent p.205Tyr= SNP in the FST gene.

PCR indicates polymerase chain reaction; SNP, single-nucleotide polymorphism; SSCP, single-strand conformation polymorphism.

Genetic diversity analysis of FST revealed that CC genotype dominated the study population with a frequency of 0.48 (n = 111). The frequency of GG genotype was 0.35 (n = 82), followed by 0.17 (n = 39) for CG genotype. Based on PIC results (0.25 < PIC < 0.50), this study showed moderate polymorphism levels at the c.100C > G locus. Compared with HWE, a chi-square test indicated distinct differences (P ⩽ .05) in the FST polymorphisms (Table 2).

Table 2.

Genetic diversity of the FST gene in Awassi ewes detected by PCR-SSCP.

Observed genotypes Genotype frequencies Allele frequencies Ho He Ne PIC χ2
CC CG GG CC CG GG C G
n = 111 n = 39 n = 82 0.48 0.17 0.35 0.56 0.44 0.16 0.49 1.96 0.37 101.26

All chi-square tests have 2 degrees of freedom and within the significance level P ⩽ .05.

Abbreviations: χ2, chi-square; He, expected heterozygosity; Ho, observed heterozygosity; n, number of individuals; Ne, effective allele frequency; PCR, polymerase chain reaction; PIC, polymorphism information content; SSCP, single-strand conformation polymorphism.

Association analysis of FST gene with reproductive traits

In the association analysis between p.205Tyr= SNP locus and reproductive traits, CC genotype ewes, and CG and GG genotype ewes did not differ significantly (P ⩾ .05) concerning survival rate. Meanwhile, at the same p.205Tyr= SNP locus, individuals with CC genotype had statistically higher (P ⩽ .01) litter size, twinning ratio, lambing rate, and fewer days to lambing than individuals with CG and GG genotypes (Table 3). The logistic regression analysis provided further insight into the relationship between p.205Tyr= SNP and litter size. Ewes with the CC genotype had 1.65 lambs per animal compared with CG and GG genotypes. In this case, p.205Tyr= SNP adversely affected these traits.

Table 3.

The association between FST genetic polymorphism at locus c.100C > G and reproductive performance in Awassi ewes. (A) Reproductive performance for each genotype is shown. (B) Logistic regression analysis of FST genotypes and litter size in Awassi ewes is shown.

A/Genotypes Progeny type (%) Lambing rate (%) Days to lambing (LSM ± SE) Survival rate %
Singleton Twin
TT 28 (28.87) 69 (71.13) 94 159 ± 11.9a 164 (98.79)
TC 34 (64.15) 19 (35.84) 86 170 ± 12.3 a,b 70 (97.22)
CC 61 (74.39) 21 (25.60) 82 178 ± 14.6b 100 (97.08)
P-value .001 .001 .02 .01 .23
B/Genotypes Litter size
(LSM ± SE)
Logistic regression analysis P-value
β Odds ratio (95% CI)
TT 1.71 ± 0.10a 1.00 Reference —
TC 1.35 ± 0.03 a,b −1.48 1.77 (1.11-4.63) .001
CC 1.26 ± 0.12b −1.96 2.15 (1.40-6.51) .001

The P-value with statistical significance is indicated in bold numbers. Twinning rate (is the propensity to have more twin litters per 100 ewes at the same average lambing percentage). Number of days to lambing (number of days between the joining of rams until the subsequent lambing).

Survival rates of the lambs (the numbers of dead lambs were determined until weaning). Litter size (the number of lambs born per ewe lambing).

Abbreviations: CI, confidence interval; LSM ± SE, least square means ± standard error; β, regression coefficients.

a,b

Significant differences in means represent by differences in the same column within each classification.

Discussion

Polymorphism of FST gene and SNP bioinformatics

Molecular genotyping and genetic diversity analyses revealed polymorphisms in exon 4 of the FST gene in Awassi sheep. In livestock, FST gene variations have been investigated in several studies. According to Ma et al, 6 sequencing analysis of Chinese Merino sheep (Junken type) identified 7 SNPs in the FST gene. Dushyanth et al 10 reported polymorphisms in the FST gene coding region (exons 2 and 5) of native American (Aseel) and white leghorn chickens. The SNaPshot software is used by Zhu et al 7 to detect 26 SNPs and 1 deletion in UTRs from 186 Dazu black goats. However, there is a lack of literature on FST polymorphism and Awassi sheep. Accordingly, this study will provide genotypic details and new associations applicable to selecting sheep for marker-assisted selection, enabling future programs to measure functional traits more effectively.

Concerning SNP bioinformatics, the results revealed that silent mutation p.205Tyr= SNP negatively affected reproductive traits. This situation could be explained by the fact that silent mutations have previously been shown to be involved in biological processes. 25 Although silent mutations do not change amino acids, they can interfere with RNA splicing, affecting protein production negatively. Furthermore, it can alter regulatory sequences and lower gene expression. 26 According to Manning and Cooper, 27 silent variants can influence RNA synthesis and translation initiation. Changes in RNA secondary structures can affect many functions of the genome, including protein folding, accessibility of RNA to functional sites, and alternative splicing. 28 However, silent SNPs have been rarely reported to affect phenotypic traits in the literature.

Association analysis of the FST genotypes with reproductive traits of Awassi ewes

There was a highly significant (P ⩽ .01) association between the SNP and reproductive traits in those ewes with the p.205Tyr= SNP had higher litter size, twinning ratio, lambing rate, and fewer days to lambing than ewes with CG and GG genotypes. Mammalian FST controls steroidogenesis, oocyte development, and follicular cell division and differentiation. 29 A previous study by Lee et al 30 suggested that FST derived from the oocyte is crucial for determining the competence of oocytes in cattle by speeding up their development into blastocysts. Based on O’Connell et al, 31 activins and FST facilitate luteinization and conceptus implantation by interfering with multiple reproductive processes. Activin-FST influences the production of gonadotropin receptors and steroid hormones, which are responsible for the differentiation and growth of antral follicles. 32 FST, activin, and inhibin interact with autocrine/paracrine to regulate anterior pituitary FSH secretion. 33 Activin internalization and degradation are inhibited by FST, decreasing their bioavailability and preventing FSH secretion. 34 High levels of FSH and luteinizing hormone (LH) affect ovarian follicle development and maturation, resulting in increased litter size.35,36 In Dazu black goats, FST polymorphisms are associated with litter sizes. 7 Despite this, there has been little study of the relationship between FST variants and reproductive traits in livestock, and little is known about FST polymorphisms and their impact on sheep reproduction. As a result of these results, FST appears to be a promising candidate gene for sheep marker selection.

Conclusions

There was an association between genotype variations of the FST gene and reproduction in Awassi sheep. Animals of the CC genotype had higher twinning rates, higher lambing rates, and shorter days to lambing than animals of the CG and GG genotypes. These traits are adversely affected by the silent variant p.205Tyr= SNP. Identifying genetic polymorphisms in the FST gene can be recommended to improve sheep reproductive performance using a marker-assisted selection program.

Acknowledgments

The authors express great appreciation for the ewes provided by sheep stations in Babylon and Karbala.

Footnotes

Author Contributions: All authors contributed equally.

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding: The author(s) received no financial support for the research, authorship, and/or publication of this article.

References

  • 1.Esmaeili-Fard SM, Gholizadeh M, Hafezian SH, Abdollahi-Arpanahi R. Genome-wide association study and pathway analysis identify NTRK2 as a novel candidate gene for litter size in sheep. PLoS ONE. 2021;16:e0244408. doi: 10.1371/journal.pone.0244408 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Al-Thuwaini TM, Kareem ZA. Novel missense variant L46Q of fatty acid synthase gene and fatty acids content in Awassi sheep. Acta Sci Anim Sci. 2022;44:e56273. doi: 10.4025/actascianimsci.v44i1.56273 [DOI] [Google Scholar]
  • 3.Murphy TW, Keele JW, Freking BA. Genetic and nongenetic factors influencing ewe prolificacy and lamb body weight in a closed Romanov flock. J Anim Sci. 2020;98:skaa283. doi: 10.1093/jas/skaa283 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.AL-Thuwaini TM. Adiponectin and its physiological function in ruminant livestock. Rev Agric Sci. 2022;10:115-122. doi: 10.7831/ras.10.0_115 [DOI] [Google Scholar]
  • 5.Al-Thuwaini TM, Al-Hadi ABA. Association of lamb sex with body measurements in single and twin on the Awassi ewes. Adv Anim Vet Sci. 2022;10:1849-1853. doi: 10.17582/journal.aavs/2022/10.8.1849.1853 [DOI] [Google Scholar]
  • 6.Ma GW, Chu YK, Zhang WJ, et al. Polymorphisms of FST gene and their association with wool quality traits in Chinese Merino sheep. PLoS ONE. 2017;12:e0174868. doi: 10.1371/journal.pone.0174868 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Zhu JY, E GX, Wang JB, Xu SS, Yang XQ. Single nucleotide polymorphisms in the 3′ UTR of follistatin-like 4 and scavenger receptor class B member 1 are associated with Dazu black goat litter size. Can J Anim Sci. 2022;102:473-479. doi: 10.1139/cjas-2020-0170 [DOI] [Google Scholar]
  • 8.Parfenova OK, Kukes VG, Grishin DV. Follistatin-like proteins: structure, functions and biomedical importance. Biomedicines. 2021;9:999. doi: 10.3390/biomedicines9080999 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Walpurgis K, Weigand T, Knoop A, et al. Detection of follistatin-based inhibitors of the TGF-β signaling pathways in serum/plasma by means of LC-HRMS/MS and Western blotting. Drug Test Anal. 2020;12:1636-1648. doi: 10.1002/dta.2925 [DOI] [PubMed] [Google Scholar]
  • 10.Dushyanth K, Shukla R, Chatterjee RN, Bhattacharya TK. Expression and polymorphism of Follistatin (FST) gene and its association with growth traits in native and exotic chicken. Anim Biotechnol. 2022;33:824-834. doi: 10.1080/10495398.2020.1838917 [DOI] [PubMed] [Google Scholar]
  • 11.Pang M, Tong J, Yu X, Fu B, Zhou Y. Molecular cloning, expression pattern of follistatin gene and association analysis with growth traits in bighead carp (Hypophthalmichthys nobilis). Comp Biochem Physiol B Biochem Mol Biol. 2018;218:44-53. doi: 10.1016/j.cbpb.2018.02.003 [DOI] [PubMed] [Google Scholar]
  • 12.Shen C, Iskenderian A, Lundberg D, et al. Protein engineering on human recombinant follistatin: enhancing pharmacokinetic characteristics for therapeutic application. J Pharmacol Exp Ther. 2018;366:291-302. doi: 10.1124/jpet.118.248195 [DOI] [PubMed] [Google Scholar]
  • 13.Gebreselassie G, Berihulay H, Jiang L, Ma Y. Review on genomic regions and candidate genes associated with economically important production and reproduction traits in sheep (Ovies aries). Animals. 2019;10:33. doi: 10.3390/ani10010033 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Imran FS, Al-Thuwaini TM, Al-Shuhaib MBS, Lepretre F. A novel missense single nucleotide polymorphism in the GREM1 gene is highly associated with higher reproductive traits in Awassi sheep. Biochem Genet. 2021;59:422-436. doi: 10.1007/s10528-020-10006-x [DOI] [PubMed] [Google Scholar]
  • 15.Al-Thuwaini TM. The relationship of hematological parameters with adaptation and reproduction in sheep; a review study. Iraqi J Vet Sci. 2021;35:575-580. doi: 10.33899/ijvs.2020.127253.1490 [DOI] [Google Scholar]
  • 16.Mohammed MM, Al-Thuwaini TM, Al-Shuhaib MBS. A novel p. K116Q SNP in the OLR1 gene and its relation to fecundity in Awassi ewes. Theriogenology. 2022;184:185-190. doi: 10.1016/j.theriogenology.2022.03.014 [DOI] [PubMed] [Google Scholar]
  • 17.Al-Shuhaib Mohammed Baqur SA. A universal, rapid, and inexpensive method for genomic DNA isolation from the whole blood of mammals and birds. J Genet. 2017;96:171-176. doi: 10.1007/s12041-017-0750-6 [DOI] [PubMed] [Google Scholar]
  • 18.Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 2012;13:134. doi: 10.1186/1471-2105-13-134 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Ajafar MH, Al-Thuwaini TM, Dakhel HH. Association of OLR1 gene polymorphism with live body weight and body morphometric traits in Awassi ewes. Mol Biol Rep. 2022;49:4149-4153. doi: 10.1007/s11033-022-07481-3 [DOI] [PubMed] [Google Scholar]
  • 20.Al-Thuwaini T. Association between polymorphism in BMP15 and GDF9 genes and impairing female fecundity in diabetes type 2. Middle East Fertil Soc J. 2020;25:1-10. doi: 10.1186/s43043-020-00032-5 [DOI] [Google Scholar]
  • 21.Al-Thuwaini TM, Al-Shuhaib MBS, Hussein ZM. A novel T177P missense variant in the HSPA8 gene associated with the low tolerance of Awassi sheep to heat stress. Trop Anim Health Prod. 2020;52:2405-2416. doi: 10.1007/s11250-020-02267-w [DOI] [PubMed] [Google Scholar]
  • 22.Byun SO, Fang Q, Zhou H, Hickford JGH. An effective method for silver-staining DNA in large numbers of polyacrylamide gels. Anal Biochem. 2009;385:174-175. doi: 10.1016/j.ab.2008.10.024 [DOI] [PubMed] [Google Scholar]
  • 23.Yeh FC, Yang RC, Boyle T. Microsoft Window-Based Freeware for Population Genetic Analysis (POPGENE) (Version 1.31). University of Alberta; 1999. [Google Scholar]
  • 24.Botstein D, White RL, Skolnick M, Davis RW. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet. 1980;32:314-331. [PMC free article] [PubMed] [Google Scholar]
  • 25.Alexander RP, Fang G, Rozowsky J, Snyder M, Gerstein MB. Annotating non-coding regions of the genome. Nat Rev Genet. 2010;11:559-571. doi: 10.1038/nrg2814 [DOI] [PubMed] [Google Scholar]
  • 26.Li D, McIntosh CS, Mastaglia FL, Wilton SD, Aung-Htut MT. Neurodegenerative diseases: a hotbed for splicing defects and the potential therapies. Transl Neurodegener. 2021;10:1-18. doi: 10.1186/s40035-021-00240-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Manning KS, Cooper TA. The roles of RNA processing in translating genotype to phenotype. Nat Rev Mol Cell Biol. 2017;18:102-114. doi: 10.1038/nrm.2016.139 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Li MJ, Yan B, Sham PC, Wang J. Exploring the function of genetic variants in the non-coding genomic regions: approaches for identifying human regulatory variants affecting gene expression. Brief Bioinform. 2015;16:393-412. doi: 10.1093/bib/bbu018 [DOI] [PubMed] [Google Scholar]
  • 29.Stangaferro ML, Matiller V, Díaz PU, et al. Role of activin, inhibin, and follistatin in the pathogenesis of bovine cystic ovarian disease. Anim Reprod Sci. 2014;148:97-108. doi: 10.1016/j.anireprosci.2014.06.005 [DOI] [PubMed] [Google Scholar]
  • 30.Lee KB, Bettegowda A, Wee G, Ireland JJ, Smith GW. Molecular determinants of oocyte competence: potential functional role for maternal (oocyte-derived) follistatin in promoting bovine early embryogenesis. Endocrinology. 2009;150:2463-2471. doi: 10.1210/en.2008-1574 [DOI] [PubMed] [Google Scholar]
  • 31.O’Connell AR, McNatty KP, Hurst PR, et al. Activin A and follistatin during the oestrous cycle and early pregnancy in ewes. J Endocrinol. 2016;228:193-203. doi: 10.1530/joe-15-0367 [DOI] [PubMed] [Google Scholar]
  • 32.Tian H, Ren P, Liu K, et al. Transcriptomic comparison of ovarian granulosa cells between adult sheep and prepubertal lambs. BMC Genomics. 2022;23:1-17. doi: 10.1186/s12864-022-08379-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Padmanabhan V, Cardoso RC. Neuroendocrine, autocrine, and paracrine control of follicle-stimulating hormone secretion. Mol Cell Endocrinol. 2020;500:110632. doi: 10.1016/j.mce.2019.110632 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Cash JN, Rejon CA, McPherron AC, Bernard DJ, Thompson TB. The structure of myostatin: follistatin 288: insights into receptor utilization and heparin binding. EMBO J. 2009;28:2662-2676. doi: 10.1038/emboj.2009.205 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Luo HQ, Gu WW, Huang LW, et al. Effect of prepregnancy obesity on litter size in primiparous minipigs. J Am Assoc Lab Anim Sci. 2018;57:115-123. [PMC free article] [PubMed] [Google Scholar]
  • 36.Ajafar MH, Kadhim AH, AL-Thuwaini TM. The reproductive traits of sheep and their influencing factors. Rev Agric Sci. 2022;10:82-89. doi: 10.7831/ras.10.0_82 [DOI] [Google Scholar]

Articles from Bioinformatics and Biology Insights are provided here courtesy of SAGE Publications

RESOURCES