miR-424(322)-5p targets Ezh1 to inhibit the proliferation and differentiation of myoblasts

Abstract

The proliferation and differentiation of myoblasts are considered the key biological processes in muscle development and muscle-related diseases, in which the miRNAs involved remain incompletely understood. Previous research reported that miR-424(322)-5p is highly expressed in mouse skeletal muscle. Therefore, C2C12 cells are used as a model to clarify the effect of miR-424(322)-5p on the proliferation and differentiation of myoblasts. The data show that miR-424(322)-5p exhibits a decreasing trend upon myogenic differentiation. Overexpression of miR-424(322)-5p inhibits the proliferation of myoblasts, manifested by downregulation of proliferation marker genes ( CCNB1, CCND2, and CDK4), decreased percentage of EdU ⁺ cells, and reduced cell viability. In contrast, these phenotypes are promoted in myoblasts treated with an inhibitor of miR-424(322)-5p. Interestingly, its gain of function inhibits the expression of myogenic regulators, including MyoD, MyoG, MyHC, and Myf5. Additionally, immunofluorescence staining of MyHC and MyoD shows that overexpression of miR-424(322)-5p reduces the number of myotubes and decreases the myotube fusion index. Consistently, inhibition of its function mediated by an inhibitor promotes the expressions of myogenic markers and myotube fusion. Mechanistically, gene prediction and dual-luciferase reporter experiments confirm that enhancer of zeste homolog 1 ( Ezh1) is one of the targets of miR-424(322)-5p. Furthermore, knockdown of Ezh1 inhibits the proliferation and differentiation of myoblasts. Compared with NC and inhibitor treatment, inhibitor+si- EZH1 treatment rescues the phenotypes of proliferation and differentiation mediated by the miR-424(322)-5p inhibitor. Taken together, these data indicate that miR-424(322)-5p targets Ezh1 to negatively regulate the proliferation and differentiation of myoblasts.

Introduction

Skeletal muscle is an essential tissue and organ in the body, and normal growth and development perform a vital function in maintaining the stability of the body. It is disbursed in distinct components of the physique and participates in a variety of existing activities, such as thermoregulation, exercise, and respiration [ 1, 2] . The development, maintenance, and regeneration of skeletal muscle are complex biological processes that are mainly achieved through the proliferation and differentiation of skeletal muscle progenitor cells and the hypertrophy and thickening of skeletal muscle fibres [ 3– 6] . This process is regulated by many factors, including transcription factors [7], methylation transferase [8], and signal pathways. In recent years, noncoding RNAs have been shown to play regulatory roles in the growth and improvement of skeletal muscle. However, the exact noncoding RNAs and the functional mechanism remain largely unknown.

miRNA is a category of noncoding and evolutionarily conserved small RNA molecules with a length of 22 nt [9]. It degrades the mRNA of a target gene or suppresses its protein translation by binding with the 3′-UTR sites of the target genes [10]. The expression levels of these miRNAs have significant variations in different tissues and developmental stages and are involved in a range of important life activities, including cell differentiation, early development, cell proliferation, apoptosis and cancer [ 11– 14] . According to previous reports, miRNAs play a vital role in the process of muscle development. In particular, muscle-specific miRNAs, such as miR-1, miR-126, miR-133, and miR-128, are critical in muscle development [ 15– 17] . miR-133 promotes the proliferation of myoblasts by targeting serum response factor ( SRF) [16], and the expression of miR-1 and miR-206 promotes the proliferation and differentiation of skeletal muscle satellite cells [ 18, 19] . Furthermore, muscle-nonspecific miRNAs additionally play an important role in muscle development. For example, miR-143 promotes the differentiation of bovine skeletal muscle satellite cells (SMSCs) by targeting the IGFBP5 gene [20], and miR-27b was recognized as a differentiation activator and proliferation inhibitor in porcine satellite cells by targeting MDFI [21]. All of these findings suggest that miRNAs play an extremely necessary role in muscle development. Wang et al. [22] showed that miR-424(322)-5p is one of the most abundant miRNAs in the muscle tissues of fetal and six-month-old goats. This suggests that miR-424(322)-5p may have important biological functions during myoblast proliferation and differentiation. Ji et al. [23] conducted high-throughput sequencing of skeletal muscle of yaks aged 0.5, 2.5, 4.5, and 7.5 years and found that miR-424(322)-5p probably plays an important role in the skeletal muscle development of yaks. The exact role and mechanism of miR-424(322)-5p in regulating myoblast proliferation and differentiation is not yet clear.

Here, we aim to measure the expression pattern of miR-424(322)-5p during C2C12 myoblast myogenic differentiation and reveal the possible role of miR-424(322)-5p in the proliferation and differentiation of myoblasts via miR-424(322)-5p gain and loss of function. Our results show that miR-424(322)-5p targets Ezh1 to negatively regulate the proliferation and differentiation of C2C12 myoblasts.

Materials and Methods

Tissue collection

Three 3-month-old C57BL/6J male mice were from Chengdu Dossy Experimental Animals Co., Ltd (Chengdu, China). The mice were sacrificed by cervical vertebra dislocating method, and tissue samples including heart, liver, spleen, lung, kidney, gastrocnemius muscle, and inguinal subcutaneous fat were collected and stored at –80°C for RNA extraction. All the experiments were performed under the approval of the Animal Care and Use Committee of Southwest Minzu University (Chengdu, China).

Cell culture

The C2C12 myoblast cell line (ATCC, USA) was regularly cultured in growth medium consisting of Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen, Carlsbad, USA), 10% fetal bovine serum (FBS; Gibco, Carlsbad, USA), and 1% penicillin-streptomycin (PS; Biosharp, Hefei, China). When the cell density reached 80%-90%, the cells were cultured in differentiation medium (DM) containing 2% horse serum (Solarbio, Beijing, China), 1% PS, and DMEM, which was used to induce differentiation. The cells were cultured in a cell incubator at a constant temperature and humidity (37°C, 5% CO ₂), and the medium was changed every two days.

Cell transfection

miR-424(322)-5p mimics, mimics negative control (NC), miR-424(322)-5p inhibitor, inhibitor NC, NC and si-EZH1 were synthesized by Genepharma (Shanghai, China) ( Table 1). The above RNAs, Ezh1-wild (ligated to the 3′-UTR of Ezh1), and pmir-GLO plasmids were transfected using Lipofectamine ^TM 3000 Reagent (Thermo Fisher, Waltham, USA) according to the manufacturer’s instructions. The cells were seeded in 24-well plates, and transfection was performed at a confluence of 40% for the proliferation assay and 60% for the myogenic differentiation assay. The cells were collected for detection of proliferation-related indicators at 48 h after transfection. For differentiation-related indicator detection, cells were subject to myogenic induction at 24 h after transfection and then collected for further myogenic analysis at 48 h after induction.

Table 1 Sequences of RNA oligonucleotides used in this study

miRNA name	Sequence (5′→3′)
miR-424(322)-5p mimics	CAGCAGCAAUUCAUGUUUUGAACAAAACAUGAAUUGCUGCUGUU
mimics NC	UUCUCCGAACGUGUCACGUTTACGUGACACGUUCGGAGAATT
miR-424(322)-5p inhibitor	UUCAAAACAUGAAUUGCUGCUG
inhibitor NC	CAGUACUUUUGUGUAGUACAA
si-EZH1	GGCACCUAUUUCAACAACUTTCAGGGAAGUAAUCCGUUCUTT

RT-qPCR analysis

TRiZOL (Vazyme, Nanjing, China) reagent was used to extract total RNA from C2C12 cells, and the quality and concentration of RNA were detected with Nanodrop ND-1000 (Thermo Fisher). RNA with an OD260/OD280 of 1.8‒2.0 was used to synthesize cDNA using Prime-Script RT Master Mix (Takara, Dalian, China) according to the manufacturer’s instructions. Quantitative qRT-PCR was performed on the Bio-Rad CFX96 system using miRNA Universal SYBR qPCR Master Mix (Vazyme) and SYBR real-time PCR mixture (BioTeke, Beijing, China) to measure the levels of miRNA and mRNA. The reaction conditions of qRT-PCR were as follows: predegeneration, 95°C/ 5 min; cycle reaction, 95°C/ 10 s, 60°C/ 30 s, 40 cycles. All primer sequences are given in Table 2. The levels of miRNA and mRNA were calculated using the 2 ^–∆∆Ct method. U6 and RPL7 were used as the internal reference genes respectively.

Table 2 Sequences of primers used for qRT-PCR

Primer name	Sequence (5′→3′)
miR-424-5P-F	GCGCAGCAGCAATTCATGT
miR-424-5P-R	AGTGCAGGGTCCGAGGTATT
miR-424-5P-SL	GTCGTATCCAGTGCAGGGTCCGAGGTA TTCGCACTGGATACGACTTCAAA
U6-F	CTCGCTTCGGCAGCACA
U6-R	AACGCTTCACGAATTTGCGT
P53-F	CAACAAATGCTGGCTACTAAGGA
P53-R	CACGAGTTTTCCGTTGCTCA
CCND1-F	TAGGCCCTCAGCCTCACTC
CCND1-R	CCACCCCTGGGATAAAGCAC
CCND2-F	GAGTGGGAACTGGTAGTGTTG
CCND2-R	CGCACAGAGCGATGAAGGT
CCNB1-F	CTTGCAGTGAGTGACGTAGAC
CCNB1-R	CCAGTTGTCGGAGATAAGCATAG
CDK2-F	CAAAGCCAAGCACGTAGAGAC
CDK2-R	TGCACCACATATTGACTGTCC
CDK4-F	CTGAACCGCTTTGGCAAGAC
CDK4-R	GCCCTCTCTTATCGCCAGAT
MYOD1-F	CCACTCCGGGACATAGACTTG
MYOD1-R	AAAAGCGCAGGTCTGGTGAG
MYF6-F	AGAGGGCTCTCCTTTGTATCC
MYF6-R	CTGCTTTCCGACGATCTGTGG
MYOG-F	GAGACATCCCCCTATTTCTACCA
MYOG-R	GCTCAGTCCGCTCATAGCC
MYHC-F	GCGAATCGAGGCTCAGAACAA
MYHC-R	GTAGTTCCGCCTTCGGTCTTG
MYF5-F	AAGGCTCCTGTATCCCCTCAC
MYF5-R	TGACCTTCTTCAGGCGTCTAC
RPL7-F	ACGGTGGAGCCTTATGTGAC
RPL7-R	TCCGTCAGAGGGACTGTCTT

miR-424-5P-SL, miR-424-5P Stem-loop primer.

Western blot analysis

Western blot analysis was performed according to a previously established procedure [24] Seventy-two hours after transfection, cells were washed twice with PBS and lysed in RIPA protein lysis buffer with 1% protease inhibitors to obtain protein sample. Protein concentration determination was performed using a BCA protein concentration assay kit (Biosharp, Hefei, China). Protein samples were separated by 10% SDS-PAGE, and then transferred to a PVDF membrane (BioRad). The membrane was blocked and immunoblotted with anti-EZHI antibody (bs-6528R; Bioss, Beijing, China) and anti-β-actin antibody (Bioss). The gray values of protein bands were analysed using ImageJ software, and the target protein bands were normalized to β -actin which was used as the loading control. Each experiment was performed with three biological replicates.

Cell counting kit 8 (CCK-8) assay

C2C12 myoblasts were seeded in 96-well plates with 100 μL growth medium, and every plate had 5×10 ³ cells. Negative control, mimics, and inhibitor were transfected into cells, and a Cell Counting Kit 8 (AbMole, Shanghai, China) was used to detect the cell proliferative activity. Ten microliters of CCK-8 reagent was added to each well, and a full band microplate reader (Perkin Elmer) was used to measure the absorbance at 450 nm at 12 h, 24 h, 48 h, and 72 h post transfection. Six biological replicates were included for each group.

Immunofluorescence staining

The treated cell samples were washed with PBS twice, and 4% paraformaldehyde (Biosharp, Hefei, China) solution was added to fix the cells for 10‒15 min at room temperature. Then, PBS was used to wash the samples three times. Subsequently, 100 nM glycine was added and incubated for 10 min, and then PBS was added to wash the samples 3 times. Blocking buffer (5% goat serum, 2% BSA, 0.2% Triton X-100, and 0.1% sodium azide) was used to incubate cells for 30 min at room temperature, and then cells were incubated with primary antibodies of MyhC (DSHB Hybridoma Product MF 20) and MyoD1 (Wanlei, Shenyang, China) overnight at 4°C. After that, Alexa FluorTM 568 goat anti-rabbit IgG (Invitrogen) and goat anti-mouse IgG/FITC (Bioss) secondary antibodies diluted in PBS were added and incubated for 1 h at room temperature. A confocal microscope (LSM800; Zeiss, Germany) was used to capture pictures. Fluorescence intensity was calculated using ImageJ software, and all data were collected from randomly selected areas of three biological replicates.

EdU staining

For this measurement, 10 μM 5-acetylene-2′-deoxyuridine (Beyotime, Shanghai, China) was added to growth medium and incubated for 2 h. Then, fixation, osmosis, and EdU staining were conducted according to the manufacturer’s instructions. DAPI was used to stain the nuclei for 10 min. Finally, images of cells were captured with a confocal laser microscope (Zeiss LSM800), and the positive rate was representative of EdU-positive cells/DAPI cells.

Dual-luciferase reporter assay

293T cells were seeded in 24-well plates and cultured in growth medium. The miR-424(322)-5p mimics, mimics NC, and Ezh1 wild-type and mutant plasmids were cotransfected at 70%–80% cell density. The Dual-Luciferase Reporter Assay Kit (Vazyme) was used to detect firefly and Renilla luciferase activity according to the manufacturer’s instructions. Three replicates were included in each group.

Prediction analysis of target genes

Prediction of the miRNA target genes was performed using miRDB ( http://mirdb.org/), TargetScan ( http://www.targetscan.org/mmu_72/), and DIANA ( http://diana.imis.athenainnovation.gr/DianaTools/index.php?r=microT_CDS/index). The Venn diagram was finished by the website ( http://bioinformatics.psb.ugent.be/webtools/Venn/).

Statistical analysis

Data are presented as the mean±standard error. GraphPad Prism 8.0 software was used to analyse the data. Statistically significant differences were calculated by one-way ANOVA and two-way ANOVA. P<0.05 was considered statistically significant.

Results

Expression patterns of miR-424(322)-5p in various tissues and during myogenesis

Previous research has shown that miR-424(322)-5p may be a key miRNA in the growth of skeletal muscle. Sequence alignment analysis showed that miR-424(322)-5p is highly conserved among different species ( Figure 1A). qRT-PCR results showed that the levels of miR-424(322)-5p in the liver, lung, gastrocnemius muscle, and inguinal subcutaneous fat were significantly higher than those in the heart, kidney and spleen. ( Figure 1B). Next, C2C12 cells were used to construct the myogenesis model in vitro. With the extension of differentiation, mononuclear myocytes gradually fused to form multinucleated muscle fibres. The formation of myotubes was observed on the 6 ^th day of differentiation ( Figure 1C). Furthermore, the myogenic differentiation marker genes MYOG and MYF6 gradually increased during myogenic differentiation ( Figure 1D). However, miR-424(322)-5p was highly expressed in the early stage of differentiation and subsequently exhibited a sharp decrease upon myogenic induction ( Figure 1E). These data indicate that miR-424(322)-5p may play a role in the early stage of skeletal muscle differentiation.

Figure 1 .

The expression pattern of miR-424(322)-5p in various tissues and during myogenesis

(A) Sequence alignment analysis of miR-424(322)-5p in different species. mus, Mus musculus; hsa: Homo sapiens; ssc: Sus scrofa; mml: Macaca mulatta; ocu: Oyctolagus cuniculus; chi: Capra hircus; tch: Tupaia chinensis; bta: Bos taurus. (B) Expression of miR-424(322)-5p in different tissues of mice. (C) The myoblast morphology at days 0, 2, 4, and 6 after myogenic differentiation, Scale bar: 50 μm. (D,E) The expression of the myoblast marker genes MyoG and Myf6 (D) and miR-424(322)-5p (E) during the differentiation of C2C12 myoblasts (n=3). ** P<0.01, *** P<0.001. Different capital letters indicate very significant differences.

miR-424(322)-5p inhibits the proliferation of myoblasts

To explore whether miR-424(322)-5p is involved in myoblast proliferation. We first overexpressed miR-424(322)-5p in C2C12 cells, and its expression level was upregulated by ~160-fold ( Figure 2A). Simultaneously, overexpression of miR-424(322)-5p significantly inhibited the expression levels of C CNB1, CCND2, and CDK4, with a decrease of ~40% for all the detected genes compared to those in the control ( Figure 2B). Furthermore, EdU staining analysis showed that Edu ⁺ cells in mimics-treated cells were fewer than those in control cells, and the percentage of positive cells was reduced by ~20% in the miR-424(322)-5p-overexpressing cells ( Figure 2C,D). Consistently, the proliferation activity of myoblasts was assessed by CCK8 assay at 12, 24, 48, and 72 h after transfection. The data showed that miR-424(322)-5p gain-of-function dramatically suppressed cell viability after transfection for 48 h ( Figure 2E). Thus, overexpression of miR-424(322)-5p with inhibition of myoblast proliferation was concluded.

Figure 2 .

Overexpression of miR-424(322)-5p inhibits the proliferation of C2C12 myoblasts

(A) After transfection with miR-424(322)-5p mimics for 48 h, the expression of miR-424(322)-5p in C2C12 myoblasts was determined by qRT-PCR. (B) The mRNA expressions of CCNB1, CDK2, CCND1, CCND2, CDK4, and P53 after 48 h of transfection of the miR-424(322)-5p mimics in C2C12 myoblasts. (C) 5-Ethynyl-20-deoxyuridine (EdU) staining of transfected C2C12 myoblasts. (D) Statistics of the EdU-positive cell rate. (E) Cell viability was measured using the cell counting kit-8 (CCK-8). Scale bar: 50 μm. n=3. * P<0.05, **** P<0.0001.

Next, miR-424(322)-5p loss-of-function was carried out to confirm its inhibitory function in myoblast proliferation. qRT-PCR showed that the inhibitor downregulated the miR-424(322)-5p level by ~60% compared to that of the control ( Figure 3A), which was accompanied by increased expressions of proliferation-related genes, including CCNB1 (by ~4-fold), CCNB1 (by ~3-fold), CDK4 (by ~5-fold), and p53 (by 3-fold), compared to those of the control ( Figure 3B). In addition, both EdU staining and CCK-8 assays showed that the miR-424(322)-5P inhibitor elevated the proliferative capacity of myoblasts, as indicated by an increase in the percentage of Edu ⁺ cells ( Figure 3C,D) and an increase in cell viability at 48 h and 72 h after transfection with the inhibitor ( Figure 3E). Altogether, these data demonstrated that miR-424(322)-5p is a negative regulator of myoblast proliferation.

Figure 3 .

Inhibitor miR-424(322)-5p promotes the proliferation of C2C12 myoblasts

(A) After transfection with miR-424(322)-5p inhibitor for 48 h, the expression of miR-424(322)-5p in C2C12 myoblasts was determined by qRT-PCR. (B) The mRNA expressions of CCNB1, CDK2, CCND1, CCND2, CDK4, and P53 after 48 h of transfection of miR-424(322)-5p inhibitor in C2C12 myoblasts. (C) 5-Ethynyl-20-deoxyuridine (EdU) staining of transfected C2C12 myoblasts. (D) Statistics of the EdU-positive cell rate. (E) Cell viability was measured using the cell counting kit-8 (CCK-8). Scale bar: 50 μm. n=3. * P<0.05, ** P<0.01, *** P<0.001.

miR-424(322)-5p inhibits the differentiation of myoblasts

To explore the role of miR-424(322)-5p in myogenic differentiation, miR-424(322)-5p mimics and negative control (NC) were transfected into C2C12 cells. The qRT-PCR results showed that overexpression of miR-424(322)-5p significantly reduced the mRNA expression of myogenic differentiation markers, especially MYOG, MYHC, and MYF5 ( Figure 4A). Meanwhile, the results of immunofluorescence staining indicated that the immunofluorescence intensity of MYOD1 was significantly weakened ( Figure 4B,C), and both the myotube fusion index ( Figure 4D) and differentiation index ( Figure 4E) showed a decreasing tendency. This indicates that overexpression of miR-424(322)-5p inhibits the differentiation of myoblasts.

Figure 4 .

Overexpression of miR-424(322)-5p inhibits the differentiation of C2C12 myoblasts

(A) The mRNA expression levels of MYOD1, MYOG, MYHC, MYF5, and MYF6 after 48 h of overexpression of miR-424(322)-5p in C2C12 myoblasts. (B) Myogenic differentiation 1 (MYOD1) and anti-myosin heavy chain (MYHC) immunofluorescence staining after transfection of miR-424(322)-5p mimics in C2C12 myoblasts. DAPI (blue), cell nuclei, Scale bar: 50 μm. (C) MYOD1 and MYHC immunofluorescence intensity analysis expressed as myotube fluorescence intensity divided by the number of nuclei in the myotube. (D) Myotube fusion index is expressed as the ratio of the number of nuclei in the myotube to the total number. (E) Differentiation index. n=3. * P<0.05, ** P<0.01.

Next, we clarified the role of miR-424(322)-5p in myogenic differentiation by its loss of function. miR-424(322)-5p inhibition significantly promoted the expressions of MYOD1 and MYOG ( Figure 5A). Consistent with the mRNA expression results, immunofluorescence staining results also showed that the protein expression of MYOD1 and MYHC was significantly upregulated by ~25% and ~40%, respectively, after inhibition of miR-424(322)-5p compared with the NC ( Figure 5B,C). The myotube fusion index ( Figure 5D) and differentiation index ( Figure 5E) were significantly increased. Overall, these data suggest that miR-424(322)-5p is a negative regulator of myogenic differentiation.

Figure 5 .

Inhibitor miR-424(322)-5p promotes the differentiation of C2C12 myoblasts

(A) The mRNA expression levels of MYOD1, MYOG, MYHC, MYF5, and MYF6 after 48 h of inhibitor miR-424(322)-5p in C2C12 myoblasts. (B) Myogenic differentiation 1 (MYOD1) and anti-myosin heavy chain (MYHC) immunofluorescence staining after the transfection of miR-424(322)-5p inhibitor in C2C12 myoblasts. DAPI (blue), cell nuclei, Scale bar: 50 μm. (C) MYOD1 and MYHC immunofluorescence intensity analysis expressed as myotube fluorescence intensity divided by the number of nuclei in the myotube. (D) Myotube fusion index is expressed as the ratio of the number of nuclei in the myotube to the total number. (E) Differentiation index. n=3. * P<0.05, ** P<0.01, **** P<0.0001.

miR-424(322)-5p directly targets the EZH1 gene

To reveal the bona fide target of miR-424(322)-5p in the proliferation and differentiation of myoblasts, we combined three online software programs (TargetScan 7.2, miRDB, and DIANA) and predicted the target genes of miR-424(322)-5p through Venn diagram analysis. The results showed that there were 48 overlapping target genes, such as CCNC1, AKT3, Rfx3, and Ezh1 ( Figure 6A). Among them, we detected that the expression trend of the Ezh1 gene was opposite to that of miR-424(322)-5p during differentiation ( Figure 6B). Next, we constructed dual-luciferase reporter plasmids, pmirGLO- Ezh1-WT with the 3′-UTR sequence of Ezh1 for miR-424(322)-5p binding and pmirGLO- Ezh1-MT with a mutation in the binding site of the Ezh1 3′-UTR ( Figure 6C,D). Then, they were cotransfected with miR-424(322)-5p mimics or NC into 293T cells. When pmirGLO- Ezh1 was cotransfected with the miR-424(322)-5p mimics, the luciferase activity was significantly reduced. In contrast, when cotransfected with pmirGLO- Ezh1-MT, luciferase activity was not affected by miR-424-5p mimics ( Figure 6E). Furthermore, the mRNA and protein levels of Ezh1 were consistent with these data. Overexpression of miR-424(322)-5p repressed Ezh1 expression level ( Figure 6F); conversely, the mRNA and protein levels of Ezh1 were increased in inhibitor-treated cells ( Figure 6G–I). These results indicate that Ezh1 is the target gene of miR-424(322)-5P.

Figure 6 .

miR-424(322)-5p directly targets the Ezh1 gene

(A) Prediction of target genes of miR-424(322)-5p using DIANA, TargetScan 7.2, and miRDB. (B) Expression of Ezh1 during the differentiation of myoblasts. (C) The complementary pairing of miR-424(322)-5p with the targeted gene Ezh1 3′-UTR or mutated 3′-UTR. (D) Diagram of the construction of dual-luciferase reporter vectors containing the wild-type or mutant Ezh1 3′-UTR sequences. hRluc-neo fusion indicates Renilla luciferase; Luc2 indicates firefly luciferase. (E) 293T cells were cotransfected with Ezh1-3′-UTR wild-type or mutant dual-luciferase vector and the miR-424(322)-5p mimics or mimics NC. The relative luciferase activity was assayed 48 h later. (F,G) After transfection with miR-424(322)-5p mimics, miR-424(322)-5p inhibitor, inhibitor NC, or NC, the expression of Ezh1 was determined by q-PCR. (H,I) After transfection with miR-424(322)-5p mimics, miR-424(322)-5p inhibitor, inhibitor NC, or NC, the expression of Ezh1 was determined by western blot analysis. n=3. * P<0.05, ** P<0.01, *** P<0.001.

miR-424(322)-5p inhibits myoblast proliferation by targeting EZH1

To further explore the role of EZH1 in myoblast proliferation, C2C12 myoblasts were transfected with si- EZH1 or negative control (NC). qRT-PCR results showed that the expression of EZH1 was significantly inhibited. Meanwhile, the mRNA expression levels of the proliferation-related marker genes CCNB1 and CCND1 were also significantly reduced ( Figure 7A). In addition, EdU staining analysis showed that the si- EZH1 group had significantly fewer EdU ⁺ cells than the control group, and the si- EZH1 group had approximately 25% fewer positive cells than the control group ( Figure 7B,C). These results suggest that knockdown of EZH1 inhibits the proliferation of C2C12 myoblasts.

Figure 7 .

Knockdown of EZH1 inhibits the proliferation of C2C12 myoblasts

(A) C2C12 myoblasts were transfected with NC, si- EZH1, miR-424(322)-5p inhibitor, or miR-424(322)-5p inhibitor+si- EZH1, and then the mRNA expression levels of proliferation marker genes were detected by qPCR. (B) EdU staining was used to detect the DNA synthesis ability of C2C12 myoblasts. (C) Statistics of the EdU-positive cell rate. n=3. * P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001.

We also performed rescue experiments to cotransfect si- EZH1 and an inhibitor of miR-424(322)-5p into C2C12 myoblasts. The data showed that the mRNA levels of proliferation-related genes, including CCND1, CDK2, and CDK4, were rescued compared with the NC and miR-424(322)-5p groups ( Figure 7A). In addition, EdU staining analysis showed that after cotransfection with si- EZH1 and miR-424(322)-5p inhibitor, the DNA synthesis capacity of C2C12 myoblasts was restored to normal level, and this observation was confirmed by EdU staining ( Figure 7B,C). This result further confirmed that miR-424(322)-5p inhibits the proliferation of C2C12 myoblasts by targeting EZH1.

miR-424(322)-5p inhibits myoblast differentiation by targeting EZH1

The above data confirmed that si- EZH1 treatment inhibited the proliferation of C2C12 myoblasts, and its regulatory effect on myoblast differentiation needs to be further investigated. Thus, si- EZH1 and NC were transfected into C2C12 myoblasts and then cells were further subjected to differentiation induction. qRT-PCR results showed that si- EZH1 significantly inhibited the mRNA expression levels of myogenic marker genes, including MYOG and MYOD1 ( Figure 8A). In addition, immunofluorescence staining of MYHC ( Figure 8B), a marker of myogenic differentiation, showed that the fluorescence intensity of MYHC and the myotube fusion index of myoblasts were significantly reduced after si- EZH1 treatment ( Figure 8C,D). These results suggest that knockdown of EZH1 inhibited the differentiation of C2C12 myoblasts.

Figure 8 .

Knockdown of EZH1 inhibits the differentiation of C2C12 myoblasts

(A) C2C12 myoblasts were transfected with NC, si- EZH1, miR-424(322)-5p inhibitor, or miR-424(322)-5p inhibitor+si- EZH1, and after 2 days of myoblast differentiation, the mRNA levels of myoblast differentiation marker genes were detected by qPCR. (B) Immunofluorescence staining of MYHC in differentiated C2C12 myoblasts. (C) Immunofluorescence intensity analysis of MYHC in differentiated C2C12 myoblasts. (D) Analysis of the myotube fusion index. n=3. * P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001.

We also cotransfected inhibitors of the EZH1 gene and miR-424(322)-5p into C2C12 myoblasts. qRT-PCR results showed that the mRNA expression levels of the muscle differentiation marker genes MYOG and MYOD1 were significantly rescued compared to the inhibitor group of miR-424(322)-5p and NC groups ( Figure 8A). Immunofluorescence staining showed that the cotransfection group restored the enhanced effect of the inhibitor group on myoblast differentiation ( Figure 8B), as also evidenced by the fluorescence intensity analysis and myotube fusion index ( Figure 8C,D). Altogether, these results suggest that miR-424(322)-5p inhibits C2C12 myogenic cell differentiation by targeting EZH1.

Discussion

Extensive studies have shown that noncoding RNAs, including miRNAs, lncRNAs and circRNAs, play an important role in skeletal muscle development. In this work, we report that the miR-424(322)-5p level shows a sharp decrease upon myogenic differentiation. Overexpression of miR-424(322)-5p suppresses both proliferation and differentiation of C2C12 myoblasts. Conversely, knockdown of miR-424(322)-5p promotes these processes. This work provides direct evidence for miR-424(322)-5p as a negative regulator of myoblast proliferation and differentiation, and its target gene is Ezh1.

Skeletal muscle is one of the most abundant tissues in vertebrates. Abnormal skeletal muscle development can lead to metabolic disorders and muscle damage [ 25, 26] . The proliferation and differentiation of muscle cells are two key factors that determine muscle development and growth [27]. miRNAs, as pivotal regulators of skeletal muscle formation, play a regulatory role after transcription, such as miR-543 [28], miR-181 [29], miR-152 and miR-2954. Among them, miR-152 inhibits the proliferation of bovine myogenic cells by targeting KLF6 [30]. In chickens, miR-2954 targets YY1 to inhibit the proliferation of chicken embryonic myoblasts [31]. In addition, studies have shown that miR-424 (322)-5p is highly expressed mainly in the early stage of muscle development in goats and yaks [ 22, 23] , which suggests that miR-424(322)-5p may be involved in the early stage of muscle development. Consistently, we found that miR-424(322)-5p is highly expressed in skeletal muscle, and overexpression of miR-424(322)-5p significantly suppresses the mRNA expression of proliferation-related genes, including CCNB1, CCND2 and CDK4. It has been reported that miR-424(322)-5p regulates the CLDN4/ PI3K/ AKT axis through SRTBN2 to promote the proliferation of endometrial cancer cells [32], which confirms that miR-424(322)-5p expression is detrimental to cell proliferation. This is also consistent with our results, revealing that miR-424(322)-5p is involved in regulating the proliferation of myoblasts.

The formation of skeletal muscle can be divided into three steps: myogenic progenitor cells differentiate into adult myoblasts; adult myoblasts proliferate rapidly; and finally adult myoblasts differentiate to form multinucleated myotubes. In recent years, a large number of studies have shown that miRNAs play an important role in the process of skeletal muscle cell myogenic differentiation. For example, Mai et al. [33] showed that miR-325-3p targets the CFL2 gene and downregulates the expression of myogenic genes, thereby inhibiting the differentiation of myogenic cells. In chickens, overexpression of miR-21-5p promotes the differentiation of skeletal muscle satellite cells [34]. In addition to miRNAs, myogenic transcription factors and many signaling pathways are also involved in the regulation of muscle differentiation [ 35– 37] . Currently, extensive reports on miR-424(322)-5p mainly focus on human-related diseases [38]. For example, increased expression of miR-424(322)-5p reduces ribosomal RNA and protein synthesis in muscle atrophy, which in turn reduces muscle loss [39]. miR-322, the rodent direct lineage of miR-424, has been reported to be involved in the inhibition of muscle cell differentiation by inhibiting the expression of SETD3 [40]. It can also aggravate dexamethasone-induced muscle atrophy by targeting IGF1R and INSR [41]. This suggests that miR-424-5p may play a negative regulatory role in myogenic cell differentiation. Consistently, our results show that the inhibition of miR-424(322)-5p significantly promotes myotube formation, confirming the negative role of miR-424(322)-5p in myogenic differentiation.

A total of 48 genes were obtained through combination analysis of three miRNA target gene prediction software programs. We found that Ezh1 expression was downregulated after overexpression of miR-424(322)-5p, while Ezh1 expression was upregulated after inhibition of miR-424(322)-5p. Previous research has reported that the PRC2- Ezh1 complex is necessary for the transcriptional activation of the differentiation transcription factors MyoD and MyoG at a suitable time point [42]. We confirmed the targeting relationship between miR-424(322)-5p and Ezh1 through bioinformatics analysis and a dual-luciferase gene report experiment. After overexpression of miR-424(322)-5p, the differentiation of C2C12 cells is significantly inhibited. Furthermore, Ezh1 depletion has been reported to reduce global Pol II occupancy within the gene and lead to delayed transcriptional activation during skeletal muscle cell differentiation. Conversely, overexpression of wild-type Ezh1 results in premature gene activation and rescues the Pol II occupancy defect in Ezh1-depleted cells [43]. Consistent with this phenomenon, knockdown of Ezh1 suppresses both proliferation and myogenic differentiation. Interestingly, si- EZH1 and miR-424(322)-5p inhibitor cotreatment rescues the phenotypes induced by miR-424(322)-5p ablation. Therefore, miR-424(322)-5p inhibits myoblast proliferation and differentiation by targeting Ezh1.

COMPETING INTERESTS

The authors declare that they have no conflict of interest.

Funding Statement

This work was supported by the grants from the Natural Science Foundation of Sichuan Province (No. 23NSFSC1804), the National Natural Sciences Foundation of China (No. 31902154), and the Fundamental Research Funds for the Central Universities, Southwest Minzu University (No. 2021057).