Short-term exposure to fumonisins and deoxynivalenol, on broiler growth performance and cecal Salmonella load during experimental Salmonella Enteritidis infection

Abstract

Fumonisins (FUM) and deoxynivalenol (DON) are two common mycotoxins in poultry feed. Salmonella enterica ser. Enteritidis (S. Enteritidis) is a primary foodborne bacterium in broilers. This trial was conducted to evaluate the effects of naturally occurring FUM and DON and their combination at subclinical doses on broiler performance during a S. Enteritidis challenge. The experiment consisted of five treatments: NCC, no-challenge no-mycotoxin treatment; CC, Salmonella challenge + no-mycotoxin treatment; DON, DON 0.6 mg/kg + Salmonella challenge; FUM, FUM 14 mg/kg + Salmonella challenge; DON + FUM + T-2 + neosolaniol, DON 0.6 mg/kg + FUM 14 mg/kg + T-2 toxin 0.6 mg/kg + 0.8 mg/kg neosolaniol + Salmonella challenge. On d 4, birds were challenged with either 0 or 1 × 10⁹ CFU/mL S. Enteritidis orally. There were no significant effects on growth performance among treatments at 0, 3, 7, and 14 d of post-inoculation (dpi). On 14 dpi, the combined DON + FUM + T-2 + neosolaniol significantly increased the Salmonella load by 1.5 logs compared to the control groups (P < 0.05). FUM significantly increased the cecal tonsil IL-10 gene expression by 1.2-fold at 7 dpi (P < 0.05) and downregulated TNF-α by 1.8-fold on 14 dpi compared to the control, nonchallenge groups (P < 0.05). On 7 dpi, the combined DON + FUM + T-2 + neosolaniol reduced occludin by 4.4-fold (P < 0.05) when compared to the control groups. Similarly, combined DON + FUM+ T-2 + neosolaniol decreased zona-occluden transcription by 2.3 and 7.6-fold on 3 and 14 dpi, respectively (P < 0.05). Furthermore, combined DON + FUM + T-2 + neosolaniol decreased Claudin-1 by 2.2-fold and Claudin-4 by 5.1-fold on 14 dpi when compared to the control groups (P < 0.05). In conclusion, short-term exposure to a subclinical dose of combined DON + FUM + T-2 + neosolaniol had an impact on broiler intestinal tight junction proteins and cecal Salmonella abundance under experimental Salmonella challenge.

INTRODUCTION

Mycotoxins are secondary metabolites that are often found in the majority of the ingredients in chicken feed (Gruber-Dorninger et al., 2019). Consuming mycotoxin-contaminated feed eventually causes direct and/or indirect economic loss because mycotoxins reduce production performance and impair disease resistance in chickens (Murugesan et al., 2015). A 2021 mycotoxin survey found that, 92% of the corn samples contained more than 1 mycotoxin, including fumonisins (FUM) and deoxynivalenol (DON) (Biomin, 2021). FUM and DON are predominantly produced by the fungi Fusarium verticillioides and Fusarium graminearum. Even though corn is a major ingredient in North American poultry feed (Goswami and Kistler, 2004; Audenaert et al., 2013), the effect of subclinical levels of FUM and DON on poultry intestinal health is generally neglected because their clinical symptoms are not visible (Grenier and Applegate, 2013).

Salmonella spp. are gram-negative, facultative anaerobic bacteria belonging to the family Enterobacteriaceae (Li et al., 2013). Salmonella is considered a major threat to the poultry industry, particularly serovars belonging to Salmonella enterica (serovars Enteritidis or Typhimurium), which usually present asymptomatically in chickens, and result in food-borne illnesses in humans (Foley et al., 2013). We reported earlier that chickens are persistent carriers for Salmonella, because this pathogen can escape the host immune response by inducing T regulatory cells (CD4⁺CD25⁺) and suppressing the host immune response by secreting IL-10 (Shanmugasundaram et al., 2015; Shanmugasundaram et al., 2019a). Thus, S. Enteritidis can be ubiquitously present in the poultry house environment, which can contaminate the carcasses in the poultry processing plant (Antunes et al., 2016).

New challenges emerged as the poultry industry moved toward ABF production, raising concerns about food safety (VT Nair et al., 2018). Chickens' susceptibility to Salmonella colonization can be influenced by a variety of factors, including mycotoxins, stress, age, and genetics (Girish and Smith, 2008). Several animal studies have already described the direct effects of the intake of either FUM or DON alone or in combination in the finished diet and a possible link between FUM and DON ingestion on production performance, subclinical necrotic enteritis, and the coccidiosis severity (Antonissen et al., 2014; Grenier et al., 2016; Shanmugasundaram et al., 2022). However, these studies did not determine the lowest dose that would cause intestinal inflammation and damage the gut epithelial cells or if FUM and DON increase the Salmonella loads in the intestinal contents of broilers. In addition, studies have shown that feed contamination with subclinical doses of FUM and DON below FDA guidelines can alter villus development, intestinal permeability, and immune responses (Awad et al., 2004; Bouhet et al., 2004; Awad et al., 2011; Liu et al., 2020). Therefore, the disrupted intestinal barrier can create a favorable environment in the intestinal lumen for the pathogenic bacteria by providing nutrients. This damaged intestinal epithelium might also increase the potential translocation of Salmonella into the other internal organs, leading to Salmonella contamination in the processing plant (Darwin and Miller, 1999).

However, the findings on the individual effect of FUM or DON on growth performance in the literature are contradictory, and poultry production performance is typically either mildly influenced or not at all influenced at a level below 50 mg/kg FUM or 5 mg/kg DON in the feed (Grenier et al., 2016; Awad et al., 2019). During pathogenic challenge, however, the combined FUM (20 mg/kg) and DON (1.5 mg/kg) impaired the chicken immune response and made the chickens more susceptible to infections (Grenier et al., 2016). Though no information is available on subclinical doses of combined FUM and DON less than 20 mg/kg, 1 mg/kg below the FDA recommendation caused intestinal damage and increased Salmonella loads in the cecal content, which increased Salmonella risks in poultry production. There have been some studies that report that ingesting high quantities of certain mycotoxins increases susceptibility to intestinal infections (Dombrink-Kurtzman et al., 1993; Tessari et al., 2006). However, there are no data available describing an interaction between low concentrations of FUM and DON on broiler production performance and Salmonella pathogenesis in chickens. Hence, the objective of this study was to identify whether 14 mg/kg FUM and 0.6 mg/kg DON (alone or in combination) affected growth performance, intestinal permeability, tight junction proteins, and cecal Salmonella load during wild-type Salmonella enterica sp. Enteritidis (S. Enteritidis) infection in broiler chickens.

MATERIALS AND METHODS

The animal trial was conducted at the University of Georgia Poultry Research Center. The protocol used in this trial was approved by the University of Georgia Institutional Animal Care and Use Committee.

Mycotoxin Preparation

An unmedicated corn-soybean meal-based broiler starter diet was used as a basal diet (Table 1). Two strains F. verticillioides M-3125 and F. graminearum DSM-4528 were separately grown on rice to produce FUM (Desjardins et al., 1992) and DON (Altpeter and Posselt, 1994) by Romer labs (Tulln, Austria). The homogenized rice culture containing mycotoxins were mixed with a small portion of the basal diet and remixed with appropriate amount of basal feed to create the experimental diets. Mycotoxins concentrations in the finished diet were quantified by LC-MS/MS methods (Romer Labs, Union, MO). The analyzed mycotoxin concentrations in the final treatment diets are shown in Table 2. The FUM concentration was 13 mg/kg diet, and the DON concentration was 0.7 mg/kg diet in the FUM alone and DON alone groups. However, the F. verticillioides M-3125 strain produces other toxins such as T-2 toxins and neosolaniol, and hence the FUM groups contained 0.6 mg/kg T-2 toxins and 0.8 mg/kg neosolaniol in addition to 14 mg/kg FUM.

Table 1.

Ingredient and nutrient composition of diets (as-fed basis).

Ingredient	% of diet
Corn	55.30
Soybean meal, 48% CP	37.54
Soybean oil	2.67
Limestone	1.52
Dicalcium phosphate	1.52
Sodium choride	0.49
DL-methionine	0.36
L-Lysine·HCl	0.21
L-Threonine	0.06
Vitamin premix1	0.08
Mineral premix2	0.25
Calculated composition
Metabolizable energy, kcal/kg	3027
Crude protein, %	22.50
Crude fat, %	4.84
Calcium, %	0.95
Available phosphorus, %	0.48
Lysine, %	1.43
Threonine, %	0.97
Methionine, %	0.72
Total sulfur amino acids, %	1.08

¹Supplied per kilogram of diet: vitamin A, 5,511 IU; vitamin D3, 1,102 ICU; vitamin E, 11.02 IU; vitamin B12, 0.01 mg; biotin, 0.11 mg; menadione, 1.1 mg; thiamine, 2.21 mg; riboflavin, 4.41 mg; d-pantothenic acid, 11.02 mg; vitamin B6, 2.21 mg; niacin, 44.09 mg; folic acid, 0.55 mg; choline, 191.36 mg.

²Supplied per kilogram of diet: Mn, 107.2 mg; Zn, 85.6 mg; Mg, 21.44 mg; Fe, 21.04; Cu, 3.2 mg; I, 0.8 mg; Se, 0.32 mg.

Table 2.

Mycotoxin concentration in the final finished diet.

1Groups	DON, mg/kg	2FUM, mg/kg	T-2, mg/kg	Neosolaniol, mg/kg
NCC	<0.1	2.2	0.0	0.0
CC	<0.1	2.2	0.0	0.0
DON	0.7	2.0	0.0	0.0
FUM	<0.1	12.8	0.6	0.8
DON+FUM+T-2+neosolaniol	0.6	14.4	0.6	0.8

¹NCC, no-challenge no-mycotoxin treatment; CC, no-mycotoxin treatment + Salmonella challenge; DON, DON 0.6 mg/kg + Salmonella challenge; FUM, FUM 14 mg/kg + Salmonella challenge; DON + FUM + T-2 + neosolaniol, DON 0.6 mg/kg + FUM 14 mg/kg treatment + T-2 toxin 0.6 mg/kg + neosolaniol 0.8 mg/kg + Salmonella challenge.

²Total fumonisins (B1 + B2 + B3).

Experimental Design, Diet, and Animal Husbandry

A total of 320 one-day-old Cobb male broiler chicks were used in this study (Cobb-Vantress hatchery, Cleveland, GA). Birds were randomly distributed into either 1 of the 5 following treatment groups: The treatment groups are no-challenge no-mycotoxin control (NCC), no-mycotoxin treatment + Salmonella challenge (CC), DON 0.6 mg/kg + Salmonella challenge (DON), FUM 14 mg/kg + Salmonella challenge (FUM), DON 0.6 mg/kg + FUM 14 mg/kg treatment + Salmonella challenge (DON + FUM). The fungal strain used to produce FUM also secretes other fungal toxins such as T-2 toxins and neosolaniol. Hence, FUM alone or in combination with DON treatments had 0.6 mg/kg T-2 toxins and 0.8 mg/kg neosolaniol in addition to 14 mg/kg FUM. Each treatment was replicated in eight battery cages with eight birds per cage. Birds had ad libitum access to feed and water.

Wild type. S. Enteritidis was propagated on plates containing XLT-4 agar for 48 h at 37.5° C, followed by inoculation into brain heart infusion broth and incubation at 37.5° C without shaking for 48 h. After incubation, bacterial cells were harvested by centrifuging at 3,500 × g at 4°C and resuspended in PBS to 1 × 10⁹ colony forming units (CFU)/mL (OD600 = 1). The challenge dose was confirmed by plating serial dilutions on XLT-4 agar. On d 4, birds in the Salmonella challenge groups were orally gavaged with 1 mL of 1 × 10⁹ CFU of S. Enteritidis. Ileal samples, cecal tonsils, spleen, and liver samples, and cecal digesta were collected on days 7 (3 d of post-infection, dpi), 11 (7 dpi), and 18 (14 dpi) for further lab analysis.

Sampling

Body weight and feed intake were measured on 0, 3, 7, and 14 dpi. Proximal ileum samples and cecal tonsils (1 bird/cage; n = 8) per treatment were collected in cryovials containing RNAlater (Ambion Inc., Austin, TX) for transcription analysis. From the same 8 birds/diet, blood (serum), bile, and cecal content were collected and stored at −80°C for further analyses. Mucosa was gently scraped down from the ileum by a microslide into a freezer vial and stored at - 80° C until further use.

Intestinal Permeability

Intestinal permeability was measured using fluorescein isothiocyanate dextran (FITC-d; molecular weight, 4000 daltons; Sigma-Aldrich, St. Louis, MO). On d 18, 1 bird per cage was orally gavaged with 1 mL of FITC-d (2.2 mg/mL) per bird. Birds were euthanized 2 h after the inoculation, and blood samples were collected by cardiac puncture. The collected blood samples were centrifuged at 450 × g for 10 min to separate the serum. The fluorescence levels in the serum and the standards were measured at an excitation wavelength of 485 nm and an emission wavelength of 528 nm using a microplate reader (Synergy HT, multi-mode microplate reader, BioTek Instruments, Inc., Winooski, VT). A standard curve with 0, 0.2, 0.4, 0.6, 0.8, 1.0, and 2 μg/mL FITC-D was drawn using Gen5 software on the same plate as the samples. The FITC-d concentration per mL of serum was calculated based on the standard curve and reported as ng/mL.

Cecal S. Enteritidis Load

On 3, 7, and 14 dpi, cecal content from 1 bird/cage (n = 8) was collected and stored at -20° C until further use. The DNA from cecal contents was extracted using the QIAamp Fast DNA Stool Mini Kit (Qiagen, Valencia, CA) following the manufacturer's instructions. The final concentration of the isolated DNA was determined using an Epoch spectrophotometer (BioTek). The 100 ng/μL of DNA samples were used to quantify the cecal S. Enteritidis load by real-time qPCR using S. Enteritidis specific primers F-GCAGCGGTTACTATTGCAGC and R-CTGTGACAGGGACATTTAGCG (Shanmugasundaram et al., 2020). The PCR efficiency and the slope and intercept of the standard curve were determined by the CFX software (Bio-Rad, Hercules, CA). The PCR efficiency of the S. Enteritidis was 98% based on the standard curve analysis. The copy numbers were calculated using the formula as described earlier (Shanmugasundaram et al., 2019b).

Ileal Tight Junction Proteins and Cecal Tonsil Cytokine mRNA Expression

Ileal samples were collected from 1 bird per cage on 3, 7, and 14 dpi (n = 8). The gene expression of ileal Muc-2, occluden, zona-occluden, Claudin-1, Claudin-2 and Claudin 4; cecal tonsils TNF-α and IL-10 were analyzed by real-time PCR (Teng et al. 2020). Briefly, total RNA was extracted using QiAzol lysis reagents (Qiagen) following the manufacturer's instructions. The RNA concentration and purity were determined by a spectrophotometer (NanoDrop 2000 spectrophotometer, Thermo Fisher Scientific, MA). The complementary DNA (cDNA) was reverse transcribed by using high-capacity cDNA synthesis kits (Applied Biosystems, Foster City, CA). The ileal cDNA was analyzed for occluden, zona-occluden, Claudin-1, Claudin-2, and Claudin-4; cecal tonsil cDNA was analyzed for TNF-α and IL-10 by real-time PCR (Applied Biosystems) using SYBR Green PCR Master Mix. Primer sequences and annealing temperatures are provided in Table 3. The samples were analyzed in duplicate. Each well contained 10 µL SYBR Green PCR master mix, 7 µL RNAse-free water, 2 µL (∼600 ng/μL) cDNA, 0.5 µL forward primer (5 µM), and 0.5 µL reverse primer (5 µM). To perform real-time PCR, the following settings were used for all genes: an initial denaturation of 95°C for 10 min (1 cycle); followed by 95°C for 15 s; and 60°C for 45 s (40 cycles). The melting profile was determined by heating samples at 65°C for 30 s and then increasing the temperature at a linear rate of 10°C/s to 95°C while continuously monitoring fluorescence. The stability of housekeeping genes β-actin and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was analyzed using Normfinder software (Department of Molecular Medicine, Aarhus University Hospital, Denmark) as described previously (Shanmugasundaram et al., 2019c). The GAPDH had the most stable expression and was selected for data normalization, and the 2-ΔΔCT method was used to determine the expression of targeted genes (the CT was the threshold cycle). The no-challenge no-mycotoxin treatment group was used as a reference group.

Table 3.

Primer sequences for RT-PCR.

Target	Accession number	Primer sequences (5′-3′)	Annealing temperature (°C)
GAPDH2	NM_204305.1	F: CCTCTCTGGCAAAGTCCAAG	55
		R: GGTCACGCTCCTGGAAGATA
Muc-2	NM_001318434.1	F: TCACCCTGCATGGATACTTGCTCA	55.5
		R: TGTCCATCTGCCTGAATCACAGGT
TNF-α	NM_204267.2	F: ATCCTCACCCCTACCCTGTC	55
		R: GGCGGTCATAGAACAGCACT
IL-10	NM_001004414.4	F: CATGCTGCTGGGCCTGAA	58
		R: CGTCTCCTTGATCTGCTTGATG
Occludin	NM_205128.1	F: CCGTAACCCCGAGTTGGAT	55
		R: ATTGAGGCGGTCGTTGATG
Zona-occluden	XM_413773.4	F: TGTAGCCACAGCAAGAGGTG	55
		R: CTGGAATGGCTCCTTGTGGT
Claudin-1	AY750897.1	F: CATACTCCTGGGTCTGGTTGGT	57.5
		R: GACAGCCATCCGCATCTTCT
Claudin-2	NM_001277622.1	F: CCTGCTCACCCTCATTGGAG	56
		R: GCTGAACTCACTCTTGGGCT
Claudin-4	AY435420.1	F: GAAGCGCTGAACCGATACCA	56
		R: TGCTTCTGTGCCTCAGTTTCC

Bile and Serum Immunoglobulin Quantification by Enzyme-Linked Immunosorbent Assay

Bile and serum samples were collected from 1 bird per pen on 3, 7, and 14 dpi after Salmonella challenge. The Salmonella-specific IgA in the bile and Salmonella-specific IgG in the serum were determined by an enzyme-linked immunosorbent assay as described earlier (Shanmugasundaram et al., 2020). Immunoglobulin A and Immunoglobulin G values were reported as the mean optical density.

Statistical Analyses

A one-way ANOVA was used to identify the effect of subclinical doses of FUM and DON and Salmonella challenge on dependent variables after Salmonella infection using the General Linear Model by the JMP Pro 14 (SAS Institute Inc.; Cary; NC). The cage was used as the experimental unit. When the main effects were significant (P < 0.05) between treatments, differences between means were analyzed by Tukey's least-squares means comparison. Values are reported as least-squares means ± SEM.

RESULTS

Growth Performance

No significant difference was observed in BW gain and mortality-adjusted feed conversion ratio among treatment groups on 3, 7, and 14 dpi (P > 0.05) (Table 4).

Table 4.

Effect of subclinical doses of mycotoxins on production performance.

	Item1	NCC	CC	DON	FUM	DON + FUM + T-2 + Neosolaniol	SEM	P value
Prechallenge (0–4 d)	BWG, g	57.7	55.6	60.3	59.3	57.9	0.76	0.37
	FCR	1.06	1.07	1.03	1.01	1.02	0.01	0.32
0–3 dpi	BWG, g	74.7	77.7	78.2	76.3	74.6	0.81	0.53
	FCR	1.15	1.10	1.12	1.14	1.15	0.01	0.66
4–7 dpi	BWG, g	153.0	148.0	148.4	147.0	146.9	1.38	0.64
	FCR	1.24	1.25	1.25	1.26	1.24	0.01	0.92
8–14 dpi	BWG, g	381.2	379.1	366.8	365.5	354.0	3.9	0.16
	FCR	1.36	1.37	1.40	1.37	1.38	0.01	0.84
Final (0–18 d)	BWG, g	666.5	660.3	653.6	648.1	633.4	4.81	0.24
	FCR	1.27	1.27	1.28	1.27	1.27	0.01	0.93

¹NCC, nonchallenge nonmycotoxin treatment; CC, nonmycotoxin treatment + Salmonella challenge; DON, DON 0.6 mg/kg + Salmonella challenge; FUM, FUM 14 mg/kg + Salmonella challenge; DON + FUM + T-2 + Neosolaniol, DON 0.6 mg/kg + FUM 14 mg/kg treatment + T-2 toxin 0.6 mg/kg + neosolaniol 0.8 mg/kg + Salmonella challenge. All birds in the Salmonella challenge group received 1 × 10⁹ CFU/bird S. Enteritidis on d 4. Body weight gain (BWG, gram), feed intake (FI, gram), and mortality-adjusted feed conversion ratio (FCR) were calculated on 0, 3, 7, and 14 d post-infection (dpi).

FITC-dextran Permeability

Both FUM and DON treatments (alone or in combination) in addition to the Salmonella challenge did not show a significant difference in serum FITC-d concentrations on 14 dpi (P > 0.05) (Table 5).

Table 5.

Effect of subclinical doses of mycotoxins on serum fluorescein isothiocyanate-dextran (FITC-d) concentration of broilers on 14 dpi.

Item1	NCC	CC	DON	FUM	DON + FUM+ T-2 + Neosolaniol	SEM	P value
2FITC-d	53.64	65.74	65.10	72.76	70.57	6.98	0.42

¹NCC, nonchallenge nonmycotoxin treatment; CC, nonmycotoxin treatment + Salmonella challenge; DON, DON 0.6 mg/kg + Salmonella challenge; FUM, FUM 14 mg/kg + Salmonella challenge; DON + FUM + T-2 + Neosolaniol, DON 0.6 mg/kg + FUM 14 mg/kg treatment + T-2 toxin 0.6 mg/kg + neosolaniol 0.8 mg/kg + Salmonella challenge. All birds in the Salmonella challenge group received 1 × 10⁹ CFU/bird S. Enteritidis on d 4. One bird/pen was orally gavaged with 2.2 mg/bird of 4,000 MW fluorescein isothiocyanate dextran (FITC-D), and blood was collected 2 h later. Serum FITC-d fluorescence was determined at a 485/528 nm fluorescent microplate reader. Serum FITC-d concentrations are presented in ng/mL.

²Mean value of 8 birds per treatment (+SEM) without a common superscript differs significantly (P < 0.05).

n = 8 cages of 8 birds/cage.

Tight Junction Proteins and Muc-2 mRNA Expression

The tight junction proteins’ (occludin, zona-occluden, Claudin-1, and Claudin-4) mRNA levels were significantly decreased compared to the control groups (P < 0.05). On 7 dpi, the combination of DON + FUM + T-2 + neosolaniol reduced occludin by 4.4 fold (P < 0.05) compared to the control groups (Table 6). Similarly, at 3 and 14 dpi, combined DON + FUM + T-2 + neosolaniol decreased zona-occluden transcription by 2.3 and 7.6 fold, respectively (P < 0.05) (Table 6). Furthermore, on 14 dpi, combined DON + FUM + T-2 + neosolaniol significantly decreased Claudin-1 by 2.2 fold and Claudin-4 by 5.1 fold (P < 0.05) when compared to the control group. (Table 6). There were no significant differences in claudin-2 levels across all treatments and time points in the study.

Table 6.

Effect of subclinical doses of mycotoxins on ileal tight junction protein and Muc-2 mRNA expression.

	Item1	NCC	CC	DON	FUM	FUM + DON + T-2 + Neosolaniol	SEM	P-Value
3 dpi	Occludin	1.0	1.3	1.2	0.7	1.0	0.2	0.4
	Z-Occluden	1.0a,b	1.1a	0.7a,b,c	0.6b,c	0.5c	0.1	0.005
	Claudin-1	1.0a,b	1.1a	0.4a,b,c	0.2c	0.4b,c	0.2	0.0481
	Claudin-2	1.0	1.0	0.2	0.2	0.2	0.3	0.1168
	Claudin-4	1.0a,b	1.2a	0.1c	0.2b,c	0.1c	0.3	0.0192
	Muc-2	1.0	1.4	1.1	1.3	1.0	0.1	0.43
7 dpi	Occludin	1.0a	1.1a	0.4b	0.4b	0.2b	0.2	0.003
	Z-Occluden	1.0	1.0	0.6	0.3	0.4	0.3	0.34
	Claudin-1	1.0	1.1	0.4	0.8	0.7	0.2	0.4
	Claudin-2	1.0	1.1	0.5	0.8	0.4	0.3	0.4
	Claudin-4	1.0	1.7	0.05	0.2	0.1	0.6	0.24
	Muc-2	1.0	0.8	1.0	1.1	0.8	0.1	0.42
14 dpi	Occludin	1.0a	1.2a	0.3b	0.3b	0.03c	0.2	0.0001
	Z-Occluden	1.0a,b	1.3a	0.6a,b,c	0.4b,c	0.1c	0.2	0.0006
	Claudin-1	1.0a,b	1.5a	0.7a,b	0.9a,b	0.5b	0.2	0.0304
	Claudin-2	1.0	0.9	0.6	1.0	0.6	0.3	0.7
	Claudin-4	1.0a	1.0a	0.1b	0.1b	0.2b	0.2	0.009
	Muc-2	1.0	0.8	0.9	1.0	0.9	0.1	0.9

¹NCC, nonchallenge nonmycotoxin treatment; CC, nonmycotoxin treatment + Salmonella challenge; DON, DON 0.6 mg/kg + Salmonella challenge; FUM, FUM 14 mg/kg + Salmonella challenge; DON + FUM +T-2 + Neosolaniol, DON 0.6 mg/kg + FUM 14 mg/kg treatment + T-2 toxin 0.6 mg/kg + neosolaniol 0.8 mg/kg + Salmonella challenge. All birds in the Salmonella challenge group received 1 × 10⁹ CFU/bird S. Enteritidis on d 4. The tight junction protein mRNA level was analyzed after correcting for the housekeeping gene GAPDH mRNA level and normalizing to the mRNA content of the control group at 3, 7, and 14 dpi. All the mean values represent fold changes compared to the control groups.

^a,b,cMean ± SEM without common superscript differs significantly (P < 0.05).

n = 8 cages of 8 birds/cage.

Cecal S. Enteritidis Load

On 14 dpi, DON + FUM + T-2 + neosolaniol had a significant effect on cecal S. Enteritidis load (P < 0.05) (Table 7). At 3 dpi, there were no differences among the Salmonella-challenged groups. However, on 14 dpi, the combined DON + FUM + T-2 + neosolaniol significantly increased the Salmonella load by 1.5 logs compared to the Salmonella-challenged groups.

Table 7.

Effect of subclinical doses of mycotoxins on cecal S. Enteritidis load.

1Item	3 dpi	7 dpi	14 dpi
	Log 10 / g
NCC	ND	ND	ND
CC	6.7a	5.5a,b	4.9b
DON	6.2a	6.4a	5.3b
FUM	5.5a,b	5.8a	5.5a,b
DON + FUM + T-2 + neosolaniol	6.3a	6.7a	6.4a
SEM	0.5	0.4	0.4
P Value	0.0022	0.0004	0.0052

¹NCC, nonchallenge nonmycotoxin treatment; CC, nonmycotoxin treatment + Salmonella challenge; DON, DON 0.6 mg/kg + Salmonella challenge; FUM, FUM 14 mg/kg + Salmonella challenge; DON + FUM + T-2 + Neosolaniol, DON 0.6 mg/kg + FUM 14 mg/kg treatment + T-2 toxin 0.6 mg/kg + neosolaniol 0.8 mg/kg + Salmonella challenge. All birds in the Salmonella challenge group received 1 × 10⁹ CFU/bird S. Enteritidis on d 4. At 3, 7, and 14 d post-infection, cecal contents were analyzed for S. Enteritidis by real-time PCR, collected and expressed as log values.

^a,bMean ± SEM with no common superscript differ significantly (P < 0.05).

Cecal Tonsil Cytokine mRNA Expression

There was a significant difference in cecal tonsil TNF-α cytokine gene expression on 14 dpi (P < 0.05) (Table 8). On 14 dpi, 14 mg/kg FUM significantly downregulated the TNF-α mRNA level by 1.8-fold compared to the control groups. In addition, DON + FUM + T-2 + neosolaniol numerically decreased the TNF-α mRNA level by 1.4-fold compared to the control nonchallenge groups.

Table 8.

Effect of subclinical doses of mycotoxins on cecal tonsil TNF-α mRNA expression.

Item1	NCC	CC	DON	FUM	DON + FUM + T-2 + Neosolaniol	SEM	P value
3 dpi	1.0	1.0	1.0	1.0	1.0	0.06	1.00
7 dpi	1.0	0.9	0.9	1.2	1.1	0.05	0.24
14 dpi	1.0a	0.7a,b	0.9a,b	0.6b	0.7a,b	0.05	0.024

¹NCC, nonchallenge nonmycotoxin treatment; CC, nonmycotoxin treatment + Salmonella challenge; DON, DON 0.6 mg/kg + Salmonella challenge; FUM, FUM 14 mg/kg + Salmonella challenge; DON + FUM + T-2 + Neosolaniol, DON 0.6 mg/kg + FUM 14 mg/kg treatment + T-2 toxin 0.6 mg/kg + neosolaniol 0.8 mg/kg + Salmonella challenge. All birds in the Salmonella challenge group received 1 × 10⁹ CFU/bird S. Enteritidis on d 4. TNF-α mRNA level was analyzed after correcting for the housekeeping gene GAPDH mRNA level and normalizing to the mRNA content of the control group at 3, 7, and 14 dpi. All the mean values represent fold changes compared to the control groups.

^a,bMean ± SEM without common superscript differs significantly (P < 0.05).

n = 8 cages of 8 birds/cage.

There was a significant difference in cecal tonsil IL-10 mRNA level on 3 and 7 dpi compared to the control groups (P < 0.05) (Table 9). The Salmonella challenge downregulated the IL-10 mRNA level by 1.5-fold on 3 dpi. However, the presence of FUM alone or DON alone further downregulated the IL-10 mRNA level to 1.6 and 1.7 fold compared to the control groups, and this trend continued until 14 dpi (Table 9).

Table 9.

Effect of subclinical doses of mycotoxins on cecal tonsil IL-10 mRNA expression.

Item1	NCC	CC	DON	FUM	DON + FUM + T-2 + Neosolaniol	SEM	P value
3 dpi	1.0a	0.7b	0.6b	0.6b	0.8b	0.05	0.05
7 dpi	1.0a,b	0.7b	0.9a,b	1.2a	1.1a,b	0.05	0.014
14 dpi	1.0	1.0	1.1	0.8	0.9	0.05	0.52

¹NCC, nonchallenge nonmycotoxin treatment; CC, nonmycotoxin treatment + Salmonella challenge; DON, DON 0.6 mg/kg + Salmonella challenge; FUM, FUM 14 mg/kg + Salmonella challenge; DON + FUM +T-2 + Neosolaniol, DON 0.6 mg/kg + FUM 14 mg/kg treatment + T-2 toxin 0.6 mg/kg + neosolaniol 0.8 mg/kg + Salmonella challenge. All birds in the Salmonella challenge group received 1 × 10⁹ CFU/bird S. Enteritidis on d 4. IL-10 mRNA level was analyzed after correcting for the housekeeping gene GAPDH mRNA level and normalizing to the mRNA content of the control group at 3, 7, and 14 dpi. All the mean values represent fold changes compared to the control groups.

^a,bMean ± SEM without common superscript differs significantly (P < 0.05).

n = 8 cages of 8 birds/cage.

Bile and Serum Immunoglobulin Quantification

There was no significant difference in serum IgG (Table 10) and bile IgA (Table 11) levels found between treatment groups across all timepoints in this study.

Table 10.

Effect of subclinical doses of mycotoxins on serum anti-Salmonella IgG in broiler birds.

Item1	NCC	CC	DON	FUM	DON + FUM + T-2 + Neosolaniol	SEM	P value
3 dpi	1.11	1.20	1.17	1.20	1.16	0.03	0.92
7 dpi	1.23	1.11	1.12	1.00	1.07	0.04	0.78
14 dpi	0.65	0.55	0.53	0.55	0.53	0.05	0.94

¹NCC, nonchallenge nonmycotoxin treatment; CC, nonmycotoxin treatment + Salmonella challenge; DON, DON 0.6 mg/kg + Salmonella challenge; FUM, FUM 14 mg/kg + Salmonella challenge; DON + FUM + T-2 + Neosolaniol, DON 0.6 mg/kg + FUM 14 mg/kg treatment + T-2 toxin 0.6 mg/kg + neosolaniol 0.8 mg/kg + Salmonella challenge. All birds in the Salmonella challenge group received 1 × 10⁹ CFU/bird S. Enteritidis on d 4. Serum samples were analyzed for anti-Salmonella IgG at 3, 7, and 14 dpi and expressed as optical density absorption values.

n = 8 cages of 8 birds/cage.

Table 11.

Effect of subclinical doses of mycotoxins on bile anti-Salmonella IgA in broiler birds.

Item1	NCC	CC	DON	FUM	DON + FUM + T-2 + Neosolaniol	SEM	P value
3 dpi	0.55	0.61	0.55	0.57	0.63	0.02	0.73
7 dpi	0.50	0.51	0.50	0.52	0.51	0.02	0.99
14 dpi	0.78	0.70	0.70	0.72	0.74	0.02	0.53

¹NCC, nonchallenge nonmycotoxin treatment; CC, nonmycotoxin treatment + Salmonella challenge; DON, DON 0.6 mg/kg + Salmonella challenge; FUM, FUM 14 mg/kg + Salmonella challenge; DON + FUM + T-2 + Neosolaniol, DON 0.6 mg/kg + FUM 14 mg/kg treatment + T-2 toxin 0.6 mg/kg + neosolaniol 0.8 mg/kg + Salmonella challenge. All birds in the Salmonella challenge group received 1 × 10⁹ CFU/bird S. Enteritidis on d 4. Bile samples were analyzed for anti-Salmonella IgA at 3, 7, and 14 dpi and expressed as optical density absorption values.

n = 8 cages of 8 birds/cage.

DISCUSSION

The aim of the present study was to explore the interaction between subclinical doses of multiple mycotoxins and S. Enteritidis. In this present study, either mycotoxins or mycotoxins + Salmonella challenge did not alter the broiler BWG at 14 dpi compared to the nonchallenge control groups. In our previous study with a 21-d broiler trial, either DON 1.5 mg/kg + FUM 20 mg/kg treatment or DON 5.0 mg/kg + FUM 20 mg/kg treatment did not alter the BW gain or feed conversion ratio (Liu et al., 2020). In this current study, the Salmonella challenge did not decrease the body weight in the DON (0.7 mg/kg) treatment groups compared to the control groups. However, 14 mg/kg FUM and 0.6 mg/kg DON, along with 0.6 mg/kg T-2 toxin and 0.8 mg/kg neosolaniol, numerically decreased the body weight by 5% compared to the control groups on d 18. Similar results were observed with combined doses of DON (1.4 mg/kg) and FUM (21 mg/kg), which decreased BW by 9% on d 14 compared to the control groups (Grenier et al., 2016). Contrarily, the production performance remained unaltered when broilers were fed 10 mg/kg of FUM alone for two weeks (Grenier et al., 2017). Earlier studies with 0.2 and 2.0 ppm of T-2 toxin had no effect on weight gain in chickens (Mirocha et al., 1976). Chickens fed a combination of 5 ppm T-2 toxin and 0.5 ppm neosolaniol for 17 d showed lymphoid tissue atrophy, decreased bone marrow hematopoietic cells, oral and crop mucosa necrosis, and decreased thyroid follicular diameter (Hoerr et al., 1982). The combination of FUM (14 mg/kg) and DON (0.6 mg/kg), along with T-2 toxin (0.6 mg/kg) and neosolaniol (0.8 mg/kg), and other undetected toxins, caused marked reductions in weight gain. Given that mycotoxins may have an impact on the pathogen's prevalence and the host's capacity to regulate the infection, this relationship is crucial for the welfare of both humans and animals. This also indicates that the co-occurrence of multiple mycotoxins may have an additive effect even at a subclinical level and have a negative effect on body weight compared to single toxin contamination.

FITC-d has been widely used as a biomarker to measure paracellular intestinal permeability in broiler chickens (Zhang et al., 2016). In healthy broilers, FITC-d does not cross the intestinal epithelial barrier unless the intestinal barrier is compromised (Gilani et al., 2017). Tight junction protein expressions are correlated with intestinal permeability. Our findings suggested that pathogens or mycotoxins may have disrupted the intestinal barrier, allowing macromolecules such as antigens, bacterial toxins, and pathogens from the intestinal lumen into the circulation (Wang et al., 2016). We earlier reported that 4 mg/kg diet DON along with 3 mg/kg FUM increases the FITC-d concentration (Shanmugasundaram et al., 2022) by targeting intestinal tight junction proteins and increasing intestinal permeability in broilers. In the present study, there was a numerical increase in FITC-d among the treatment groups compared to the control groups. The DON contamination groups had 21% numerical increases in serum FITC-d concentration. Similarly, 14 mg/Kg FUM alone or in combination with DON, T-2, and neosolaniol numerically increased the serum FITC-d concentration to 36% and 32%, respectively. The structure of the FUM is very similar to that of cellular sphingolipids, and this structural similarity disturbs the sphingolipid metabolism by blocking the ceramide synthesis pathway (Voss et al., 2007). As a result, this subclinical dose of FUM + DON inhibits the sphingolipid biosynthetic pathway, numerically decreases the ileal Muc-2 gene expression on 14 dpi (P > 0.05), and also decreases the expression of tight junction proteins: Occluden, zona-occluden, Claudin-1, and Claudin-4.

No Salmonella was detected in cloacal swab samples taken from birds prior to infection at 4 d of age. Noninfected birds stayed Salmonella-negative throughout the experiment. Cecal Salmonella load tended to increase at 7 dpi in birds fed with either DON or FUM or in combination (Table 7). This increase was more pronounced at 14 dpi (P < 0.01). Feeding chicks with high levels of aflatoxin or T-2 toxin has no effect on the incidence or severity of S. Typhimurium colonization (Kubena et al., 2001). The amount of aerobic bacteria in the intestine increased significantly when 5 mg of T-2 toxin per kg of diet was given to pigs (Tenk et al., 1982). In vitro studies with porcine intestinal epithelial cell lines (IPEC-J2) exposed to 1 µg/mL of DON revealed that DON can promote S. Typhimurium invasion and potentiate gut inflammation, which also promoted Salmonella invasion and its translocation across the intestinal epithelium (Vandenbroucke et al., 2011). In vitro treatment with 100 μM DON enhanced the translocation of a pathogenic Escherichia coli strain over the intestinal epithelial cell monolayer (Pinton et al., 2009). Further, 5 mg/kg DON increased the paracellular permeability and promoted the translocation of Campylobacter jejuni and E. coli to the liver and spleen (Ruhnau et al., 2020). Similarly, an increased translocation of E. coli following 5 and 10 mg/kg DON exposure was reported in an in vivo chicken study (Awad et al., 2019). Individual mycotoxins or their combinations significantly increased the cecal Salmonella load by 1.5 log units, suggesting that the lower concentration of combined toxins would readily reflect naturally contaminated feedstuffs. This lowest concentration of combined toxins in the present study increased the cecal Salmonella load, which is a major hazard in terms of food safety.

The innate immune system acts to prevent the invasion of pathogenic bacteria by activating the production of inflammatory cytokines. Innate and adaptive immune responses induce cellular immune responses, which are responsible for the clearance of Salmonella after infection (Beal et al., 2004; Kaiser, 2010). TNF-α is a Th1-type proinflammatory cytokine that has been linked to mucosal damage by increasing leukocyte adherence. While IL-10 relates to the Th-2 response in that it promotes the development of humoral-mediated immunity and prevents immune-mediated damage (Iyer and Cheng, 2012). Mycotoxins are considered immunosuppressive; however, the outcome will vary depending on the mycotoxin concentration, duration of exposure, and timing of functional assays (Rotter, 1996; Pestka et al., 2004). Even at the lowest dietary concentrations, mycotoxins can be immunosuppressive, but they do not always have an impact on production performance (Rotter, 1996). Unfortunately, very little is known about the immunotoxicity of several mycotoxins at low concentrations in finished chicken diets. Most of the research in the literature targeted a single toxin's effect on different immune parameters. DON, for example, at 10 mg/kg, reduced TNF-α expression. TNF-α is a cytokine that promotes acute-phase reactions and contributes to systemic inflammation. Although TNF-α can be produced by a wide range of cells, including CD4+ lymphocytes, NK cells, and neurons, activated macrophages are the major source of TNF-α. A larger amount of TNF-α is secreted in response to lipopolysaccharide (Liz-Grana and Gómez-Reino Carnota, 2001). DON exposure for extended periods of time increase TNF-α, which decreases immunological function in poultry and increases the susceptibility to infectious diseases. In this present study, contrarily, providing a contaminated diet containing DON (0.6 mg/kg feed) had no impact on the TNF-α mRNA level. The effects of FUM on the cytokine profiles of different species have been described in several publications. FUM exposure increased the expression of TNF-α in mouse liver, kidney and primary hepatocytes (Bhandari and Sharma, 2002). TNF-α-expression was reduced in swine alveolar macrophages treated in vitro with 2 to 10 mg/mL FUM for 24 h. TNF-α mRNA levels in the cecum were maximally expressed at 3 dpi and gradually decreased between 10 and 42 dpi during the Salmonella challenge (Crhanova et al., 2011). In this study, Salmonella challenge reduced TNF-α expression in FUM-contaminated groups, but other combinations of mycotoxins had no effect on TNF-α expression in cecal tonsils at 14 dpi, implying that the presence of other mycotoxins at low levels may have had an additive or synergistic effect on TNF-α mRNA levels.

In the present study, Salmonella challenge down-regulated the cecal tonsils' IL-10 mRNA level either with FUM alone or in combination with other toxins at 14 dpi. Grenier et al. (2017) identified that 11.3 mg/kg FUM significantly upregulated cecal tonsil IL-10 gene expression (Grenier et al., 2017). When it comes to immune cell interaction, activation, maturation, and differentiation, cytokines are crucial players in the network of immunological responses. These immune mediators and other cytokines have been demonstrated to be impaired in pathological circumstances, such as chronic intestinal inflammation (Cano et al., 2013). This dysfunction may be linked to intestinal permeability impairment, which could result in bacterial translocation. However, in this present study, the Salmonella challenge did not alter the serum anti-Salmonella IgG (Table 10) or bile anti-Salmonella IgA antibody level (Table 11) among treatment groups, irrespective of dietary mycotoxin contamination (P > 0.05). Similar results were observed when broilers were fed naturally contaminated Fusarium mycotoxins for 3, 6, and 8 wk (Swamy et al., 2004). We concluded that impaired TNF-α and IL-10 mRNA levels at 14 dpi in the mycotoxin-contaminated group could be influenced by the presence of toxins in the feed. Because dietary FUM can alter the expression of cytokines, it may reduce poultry disease resistance.

Taken together, the result of the current study suggests that ingestion of low concentrations of DON (0.6 mg/kg diet), FUM (14mg/kg diet), T-2 toxin (0.6mg/kg diet), and a neosolaniol (0.8 mg/kg diet)-contaminated diet has had an adverse effect on the tight junction proteins occludin, z-occluden, Claudin-1, and Claudin-4. The findings of this study indicate that combined mycotoxins at concentrations below the FDA standards increased the cecal Salmonella load, and that this increase in Salmonella may have changed the gut microbiome composition. Therefore, it is necessary to reconsider the tolerance levels for FUM and DON contamination when multiple mycotoxins are present because interactions between mycotoxins may negatively affect the intestinal health of broilers.

According to the current study, short-term exposure to subclinical levels of combined FUM and DON, along with T-2 toxin and neosolaniol, had a negative impact on broilers. When these toxins were combined, Salmonella colonization increased. It is possible that a combination of fusarium toxins and an experimental Salmonella exposure modified the expression of cytokines in the cecal tonsil. The concentrations of FUM, DON, T-2-toxin, and neosolaniol in this study were representative of naturally contaminated feed. Short-term exposure to subclinical mycotoxins therefore had an impact on intestinal tight junction proteins and cecal Salmonella abundance under these experimental conditions. Future research with a subclinical dose of continuous exposure until market age would be useful in determining how mycotoxins affect carcass contamination. In turn, this will enhance understanding of the requirement for further investigation into the combined mycotoxin effects on Salmonella. This study will also heighten interest in a thorough understanding of combined FUM, DON, T-2, and neosolaniol-induced changes in Salmonella, as well as Salmonella responses to mycotoxins and the associated pathways.