Abstract
Background and Objectives:
Staphylococcus aureus is responsible for the majority of food poisoning all around the world. Nasal carriers of S. aureus and foodstuffs need for handling are important sources and vehicles to transmit this pathogen to ready-to-eat foods. According to hygienic standards, confectioners should not be contaminated with S. aureus. This study aimed to detect nasal carriers and creamy pastries contaminated with enterotoxigenic S. aureus in confectioneries of Shiraz, Iran.
Materials and Methods:
From the confectioneries of Shiraz city, 27 places in the north, south, center, west, and east areas were selected randomly then 100 creamy pastries samples and 117 nasal swabs were collected. Bacteriological and biochemical tests were performed to isolate S. aureus. The polymerase chain reaction (PCR) test was used to identify the virulence and enterotoxins genes of the S. aureus isolates. Agar disk diffusion was performed to find out the antibiotic resistance of the isolates.
Results:
Results revealed that 16.24 and 33 percent of workers and creamy pastries were contaminated with S. aureus respectively. Also, 100%, 37%, 58%, and 6% of nasal samples harbored femA, mecA, sea, and sec genes respectively. According to the results 97%, 70%, 54.5%, and 6% of creamy pastries isolates harbored femA, mecA, sea, and sec genes respectively. No isolate carried seb and sed genes. The results also showed that 41.5% of nasals and 5.5% of creamy pastry isolates harbored both sea and sec genes. The sea was the most common enterotoxin gene observed in nasal and creamy pastries. The results of the antimicrobial resistance test showed that 68.42% of nasal and 48.48% of creamy pastry isolates were resistant to cefocxitn (FOX) respectively. Both nasal (89%) and creamy pastry (82%) isolates presented the highest resistance to penicillin (P) and the most sensitivity to trimethoprim-sulphamethoxazole (SXT) (94%). Most of the isolates were sensitive to erythromycin (E), aztreonam (AZM), tetracycline (TE), trimethoprim (TMP), and ciprofloxacin (CP). Isolates of S. aureus harboring multi-enterotoxin genes were resistant to more antibiotics than others.
Conclusion:
The presence of enterotoxigenic S. aureus in the workers’ nasal samples and creamy pastries of Shiraz confectioneries was high which is a potential public health hazard.
Keywords: Staphylococcus aureus, Creamy pastry, Enterotoxin genes, Antibiotic resistance
INTRODUCTION
Consuming foodstuffs contaminated with pathogens and their toxins is responsible for hospitalizing and economic losses (1). Food preparation and distribution can be involved in the occurrences of foodborne illnesses contaminated with various pathogens such as Staphylococcus aureus (2, 3).
S. aureus is non-motile, facultatively anaerobic, Gram-positive cocci, mannitol utilization, thermostable nuclease “D-Nase, catalase, and coagulase positive. The organisms can grow in a wide range of temperatures and pH also sodium chloride concentrations (up to 15%). S. aureus survives in a wide variety of foods; especially those that require considerable handling during preparation. Humans and animals are primary reservoirs of Staphylococcus and this organism is present in the nasal, throat, hair, and skin of probably 20–30 percent of healthy individuals. S. aureus is one of the most common pathogens that produce staphylococcal enterotoxins (SEs) in food and consequently result in foodborne poisoning (4, 5). Studies showed that the handling of cream-filled pastries in the procedure of production makes food incriminated in staphylococcal intoxication, potentially (6).
According to the antigenicity (sequence homology), 24 different SEs and based on serological groups 6 groups (staphylococcal enterotoxin types A, B, C, D, E, and H) have been discovered. The most occurrence of enterotoxins production by S. aureus is related to SEA and SEB (7).
One of the most important and greatest worldwide challenges in medicine is antibiotic resistance which is a silent global crisis. Strains of multi-drug resistance such as S. aureus are found in developed and underdeveloped countries (8, 9).
Creamy pastries are ready-to-eat and produced in the confectioneries that are popular in Iran. Nasal and hand carriers of S. aureus can contaminate the products and result in intoxication in consumers. This study aimed to detect antibiotic resistance and some gene encoding enterotoxins (SEA-D) of S. aureus from creamy pastries and workers’ nasal in Shiraz, Iran.
MATERIALS AND METHODS
Sampling
A hundred creamy pastries and 117 nasal swabs of the workers from 27 confectioneries in different parts of Shiraz city were collected randomly. All samples were stored in the cold box and transferred to the laboratory rapidly.
Detection of S. aureus
For the detection of S. aureus in the creamy pastries, 25 grams of the samples were added to 225 mL of ringer at a sterile condition and thoroughly mixed gently. One milliliter of suspension was added to the TSB tube and incubated at 37°C for 24 hours. Then 0.1 mL of microbial suspension was stroked on Baird Parker agar and incubated for 24 to 48 hours.
Nasal samples were cultured on a blood agar medium enriched with defibrinated ox blood and incubated at 37°C for 24 hours to determine the hemolytic activity of the isolates. Each colony with a hemolytic zone was incubated in a TSB tube and then cultured on Baird Parker agar.
Suspected colonies on Baird Parker agar (shiny and black with lecithin lysis) were selected for confirmation tests. Conventional biochemical tests (catalase activity, hemolysis, mannitol fermentation, coagulase, thermostable nuclease “DNase activity) and Gram staining were performed to the identification of S. aureus (10).
DNA extraction
A single pure colony of S. aureus was cultured overnight in a TSB tube at 37°C. The genomic DNA of the isolates was extracted using a Genomic DNA Purification Kit (Sinaclon, Iran) according to the manufacturer’s protocol. Extracted DNA was quantified at 260/280 nm by spectrophotometer (Nanodrop, Germany).
PCR amplification
Reference primers (Table 1) were used to amplify mecA, femA, and sea-d genes.
Table 1.
Primers planned to determine genes encoding enterotoxins in S. aureus
| Target Genes | Oligonucleotide sequence (5′-3′) | Size (bp) | Annealing Temperature (°C) |
|---|---|---|---|
| femA | F 5′-CATGATGGCGAGATTACAGGAT-3′ | 372 | 55 |
| R 5′-CGCTAAAGGTACTAACACACGG-3′ | |||
| mecA | F 5′ GTGAAGATATACCAAGTGATT3′ | 147 | 50 |
| R 5′ATGCGCTATAGATTGAAAGGAT3′ | |||
| sea | F 5′-CCTTTGGAAACGGTTAAAACG-3′ | 127 | 55 |
| R 5′-TCTGAACCTTCCCATCAAAAAC-3′ | |||
| seb | F 5′ TCG CAT CAA ACT GAC AAA CG 3′ | 477 | 56 |
| R 5′AGG TAC TCT ATA AGT GCC TGC CT 3′ | |||
| sec | F 5′ CTC AAG AAC TAG ACA TAA AAG CTA GG 3′ | 271 | 51 |
| R 5′ TTA TAT CAA AAT CGG ATT AAC ATT ATC 3′ | |||
| sed | F 5′ CTA GTT TGG TAA TAT CTC CTT TAA ACG 3′ | 319 | 53 |
| R 5′TTA ATG CTA TAT CTT ATA GGG TAA ACA TC 3′ |
The PCR reaction volume was prepared for 25 μl consisting of 12.5 μl 2× PCR master mix, 1 μl forward primer, 1 μl reverse primer, 8.5 μl nuclease-free water, and 2 μl of DNA templet.
The PCR reaction conditions were as follows: initial denaturation at 94°C, 1 cycle for 4 min; denaturation at 94°C for 1 min; annealing temperature (variable for each primer in Table 1) for 40 s; extension at 72°C for 2 min for 35 cycles; and a final extension at 72°C for 10 min. The amplicons were visualized using 1% agarose gel.
Antimicrobial susceptibility test
Isolated S. aureus was subcultured into TSB and incubated at 37°C for 4–6 hours. Microbial suspensions were prepared in 0.5 McFarland’s concentration. Also, S. aureus ATCC 25923 was prepared in the same concentration as the positive control. The tests were performed using the disc diffusion method on Muller Hinton agar using cefoxitin (FOX-30 μg), ciprofloxacin (CP-5 μg), azithromycin (AZM-15 μg), erythromycin (E-15 μg), tetracycline (TE-30 μg), penicillin (P-10 U), trimethoprim (TMP-5 μg), cefoxitin (FOX 30 μg) and trimethoprim-sulfamethoxazole (SXT-1.25/23.7 μg) recommended by the Clinical Laboratory Standards Institute (CLSI) guidelines (11). The inhibition zone of the isolates was classified as CLSI charts into 3 groups sensitive, intermediate, and resistant.
Data analysis
Data were statistically analyzed using SPSS Software version 26. Chi-square and Fisher's exact tests were performed and P < 0.05 was determined as significant.
Ethics statement
The experimental procedures and protocols used in this study were approved by the Animal and Human Ethics and Welfare Committee of Shahrekord University (approval number IR.SKU.AC.REC1400.010).
RESULTS
Microbiological and Biochemical tests identified that 18.8 and 44 percent of workers’ nasal and creamy pastries samples were contaminated with coagulase-positive staphylococci, respectively. PCR tests revealed that 95 percent of coagulase-positive staphylococci of nasal and 75 percent of creamy pastries isolates harbored mecA and femA genes that were determined as S. aureus (Table 2).
Table 2.
Frequency of biochemical tests performed on workers' nasal and creamy pastries isolates.
| Samples | Gram + | Catalase + | Mannitol fermentation + | DNase + | Coagulase + | Coagulase + (Harboring mecA and femA genes) |
|---|---|---|---|---|---|---|
| Nasal (n=117) | 114 (97.44%) | 112 (95.73%) | 24 (20.51%) | 25 (21.37%) | 22 (18.8%) | 19 (16.24%) |
| Creamy pastry (n=100) | 50 (50%) | 50 (50%) | 40 (40%) | 35 (35%) | 44 (44%) | 33 (33%) |
Table 3 presents the prevalence of enterotoxin genes (sea-d) among coagulase-positive staphylococcus strains (S. aureus and none S. aureus) isolated from workers’ nasal swabs and creamy pastries. All S. aureus strains isolated from nasal and 97 percent of creamy pastries harbored the femA gene. But the prevalence of the mecA gene among the nasal and creamy pastries was 37 and 70 percent, respectively. Results also showed that all staphylococci strains have not contained seb and sed genes. From 3 nasal non-aureus isolates, just one isolate harbored SEA and SEC genes and the others had no gene. sea gene was the most common enterotoxin gene observed in the nasal and creamy pastries products (Fig. 1). The results showed that 5 nasals and 2 creamy pastry isolate harbored both esa and esc genes.
Table 3.
Prevalence of some virulence genes among coagulase-positive Staphylococcus isolates in workers’ nasal and creamy pastries samples of Shiraz confectioneries.
| Samples | Staphylococcus aureus | Enterotoxin genes % | |||||
|---|---|---|---|---|---|---|---|
|
| |||||||
| femA | mecA | sea | seb | sec | sed | ||
| Nasal | 19 | 100 | 37 | 58 | 0 | 6 | 0 |
| Creamy pastry | 33 | 97 | 70 | 54.5 | 0 | 6 | 0 |
Fig. 1.
Entrotoxine genes of S. aureus strains isolated from nasal and creamy pastries of Shiraz confectioneries.
Cnt−: negative control, Cnt+: positive control (S. aureus ATCC 25923), Ladder: 100 bp
Table 4 shows that some S. aureus strains isolated from workers' nasal and cream pastries of Shiraz confectioneries harbor more than two genes (multiple genes). Data showed that 7 (36.84%) and 12 (36.36%) of S. aureus strains isolated from nasal and creamy pastries were carrying multi-virulence genes respectively (Table 4).
Table 4.
Frequency of harboring multiple genes by S. aureus isolated from workers' nasal and cream pastries of Shiraz confectioneries.
| Genes | Isolates | |
|---|---|---|
| Nasal samples (n=7) | femA, sea sec femA, | 4 |
| mecA, sea sec femA, | 1 | |
| mecA sea femA, | 1 | |
| mecA sec femA, | 1 | |
| Creamy pastries samples (n=12) | mecA, sea sec femA, | 2 |
| mecA, sea femA, | 9 | |
| mecA, sea | 1 |
The results of the antimicrobial resistance tests on S. aureus isolates have shown in Table 5. The highest resistance of the isolates was related to penicillin. All isolates presented the highest sensitivity to trimethoprim-sulfamethoxazole.
Table 5.
Antibiotic resistance pattern of S. aureus isolated from nasal and creamy pastries samples of Shiraz confectioneries.
| Isolates | Type of antibiotic | S (%) | I (%) | R (%) |
|---|---|---|---|---|
| Nasal (n=19) | Cefoxitin (FOX) | 31.58 | 21.05 | 47.37 |
| Erythromycin (E) | 52.63 | 42.11 | 5.26 | |
| Aztreonam (AZM) | 89.47 | 5.26 | 5.26 | |
| Tetracycline (TE) | 78.95 | 0 | 21.05 | |
| Penicillin (P) | 10.53 | 0 | 89.47 | |
| Trimethoprim (TMP) | 91.74 | 0 | 8.26 | |
| Ciprofloxacin (CP) | 82.21 | 15.79 | 0 | |
| Trimethoprim Sulphamethoxazole (SXT) | 94.74 | 5.26 | 0 | |
| Creamy pastry (n=33) | Cefoxitin (FOX) | 51.51 | 15.15 | 33.33 |
| Erythromycin (E) | 69.7 | 27.3 | 3 | |
| Aztreonam (AZM) | 84.8 | 6.1 | 9.1 | |
| Tetracycline (TE) | 84.8 | 0 | 15.2 | |
| Penicillin (P) | 18.2 | 3 | 78.8 | |
| Trimethoprim (TMP) | 90.9 | 3 | 6.1 | |
| Ciprofloxacin (CP) | 81.8 | 18.2 | 0 | |
| Trimethoprim Sulphamethoxazole (SXT) | 93.9 | 0 | 6.1 |
S: sensitive, I: intermediate, R: resistance
Multiple antibiotic resistance patterns were observed among S. aureus isolates (Table 6). According to the results, 71.43% of nasal isolates and 58.33% of creamy pastry isolates that harbored multi-virulence genes, were resistant to two or more antibiotics. The statistical test showed that there is a significant relationship between the number of enterotoxin genes and antibiotic resistance in the isolates (P<0.05).
Table 6.
Multiple antibiotic resistance patterns among S. aureus strains harboring multi-virulence genes isolated from nasals and creamy pastries of Shiraz confectioneries.
| Samples | Type of Antibiotics | Isolates (%) |
|---|---|---|
| Nasal (n=7) | Penicillin, erythromycin, tetracycline, and cefoxitin | 1 (14.28) |
| Penicillin, aztreonam, erythromycin, ciprofloxacin, and cefoxitin | 1 (14.28) | |
| Penicillin, tetracycline, and cefoxitin | 1 (14.28) | |
| Penicillin, aztreonam, erythromycin, and cefoxitin | 1 (14.28) | |
| Erythromycin and cefoxitin | 1 (14.28) | |
| Creamy pastry (n=12) | Penicillin and tetracycline | 1 (8.33) |
| Penicillin, aztreonam, and erythromycin | 1 (8.33) | |
| Penicillin and cefoxitin | 5 (41.66) |
DISCUSSION
According to the national standard of Iran, creamy pastries should not be contaminated with S. aureus (10). Our results identified that 16.24 and 33 percent of workers' nasal and creamy pastries were contaminated with S. aureus, respectively. Other studies in Iran have been revealed that approximately 20 to 30 percent of creamy pastries contaminated with this pathogen (12, 13). Sami et al. (2013) showed that 20 percent of the cream-filled sweets offered in the confectioneries of Kerman were contaminated with S. aureus (14). Another study in Iran showed that 31 percent of the creamy pastries were infected with S. aureus (15). Aycicek et al. (2004) studied the prevalence of S. aureus in ready-to-eat meals of military canteens in Ankara, Turkey. Out of 512 samples, 48 samples (9.4%) were contaminated with coagulase-positive staphylococci (16).
S. aureus may contaminate confectionery products via nasal carriers and cross-contamination by food handlers, food contact surfaces, and initial ingredients of sweets. Therefore, the prevalence and occurrence of the bacterium in creamy pastries are different in various regions.
The results of the present study showed that all S. aureus isolates from nasal samples and 97 percent of creamy pastries harbored the femA gene. Also, 37 and 70 percent of S. aureus from nasal samples and creamy pastries presented methicillin resistance genes (mecA), respectively. The prevalence of sea and sec genes were 58 and 6 percent in nasal isolates and 54.5 and 6 percent in creamy pastries, respectively. There were no identified other enterotoxin genes in S. aureus isolates.
Rezaei (2018), determined only the sea gene in 26 percent of creamy sweets S. aureus isolates (17). Asgarpour et al. (2018) isolated S. aureus from 46 nasal swabs of workers at the butcher, dairy stores, and restaurants in Ardabil city. The presence of genes encoding sea, seb, and sec in isolates was 23.9, 13, and 10.8 percent, respectively (18). There are some reports of contamination of hands and nasal mucosa of people who deal with food with Staphylococcus aureus containing enterotoxin genes, and this issue has become an important health problem. (19).
Unlike other studies, Machado et al. (2020) showed that a high percentage of S. aureus isolated from food, staff, and surfaces, harboring seg and see genes (20).
Regarding the results of the present study, a high percentage of S. aureus isolates were resistant to cefoxitin and penicillin. But, according to the study by Soltan Dallal et al. (2020), 5.2, 5.2, and 23.1 percent of the isolated S. aureus from creamy pastries were resistant to erythromycin, ciprofloxacin, and tetracycline, respectively (21).
Our study also showed that S. aureus isolates carrying the enterotoxin gene were more resistant to a variety of antibiotics. Multi-enterotoxin genes and -multi-antibiotic resistance isolates were observed among both nasal and creamy pastries samples collected from Shiraz confectioneries. Analysis of the relation of antibiogram tests and PCR results certified that isolates of S. aureus harboring multi-enterotoxin genes were resistant to more antibiotics than others.
Mirzababaei et al. (2021) identified that 17.6 % of samples from food outbreaks cases were contaminated with S. aureus and indicated that most of the isolates were resistant to penicillin (22). In another study, Hashemi et al. (2020), showed that all enterotoxigenic S. aureus isolated from creamy pastries were resistant to penicillin and 95 percent of isolates harboring the sea gene were resistant to erythromycin and ciprofloxacin (23). Jassim et al. (2021) also reported that 75 percent of multi-resistant S. aureus isolated from cakes harbored enterotoxin genes (24).
High-level resistance to methicillin is caused by the mecA gene, which encodes an alternative penicillin-binding protein, PBP 2a, also, the femA gene, a cytoplasmic protein necessary for the expression of methicillin resistance in S. aureus and also involved in the biosynthesis of staphylococcal cell walls. The results of the present study indicate 37 percent of nasal and 70 percent of creamy pastries also, 100% of nasal and 97% of creamy pastries isolates harbored mecA and femA genes, respectively. In other studies, the resistance of S. aureus isolated from food to methicillin has been reported (25, 26). Methicillin-resistant S. aureus isolated from ready-to-eat food samples in developing countries was reported by Aminul Islam et al. (27).
CONCLUSION
The presence of S. aureus in creamy pastries is a crisis and a potential hazard to food safety. The prevalence of S. aureus isolated from workers’ nasal samples and creamy pastries was generally high. The isolates harbor some virulence genes incriminated in food poisoning and antibiotic resistance. Training food safety to workers and further supervision by the local health authorities are required to reduce the contamination levels.
ACKNOWLEDGEMENTS
The authors thank the Vice Chancellor for Research of Shahrekord University for supporting this study.
REFERENCES
- 1.Marzano M, Balzaretti C. Cook-serve method in mass catering establishments: Is it still appropriate to ensure a high level of microbiological quality and safety? Food Control 2011; 22: 1844–1850. [Google Scholar]
- 2.Lahou E, Jacxsens L, Daelman J, Van Landeghem F, Uyttendaele M. Microbiological performance of a food safety management system in a food service operation. J Food Prot 2012; 75: 706–716. [DOI] [PubMed] [Google Scholar]
- 3.Lipcsei LE, Brown LG, Coleman EW, Kramer A, Masters M, Wittry BC, et al. Foodborne illness outbreaks at retail establishments—National Environmental Assessment Reporting System, 16 state and local health departments, 2014–2016. MMWR Surveill Summ 2019; 68: 1–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Jay JM, Loessner MJ, Golden DA. Modern Food Microbiology. Springer; 2005. [Google Scholar]
- 5.Argaw S, Addis M. A review on staphylococcal food poisoning. Food Sci Qual Manag 2015; 40: 59–71. [Google Scholar]
- 6.Argudín MÁ, Mendoza MC, Rodicio MR. Food poisoning and Staphylococcus aureus enterotoxins. Toxins (Basel) 2010; 2: 1751–1773. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Grispoldi L, Karama M, Armani A, Hadjicharalambous C, Cenci-Goga BT. Staphylococcus aureus enterotoxin in food of animal origin and staphylococcal food poisoning risk assessment from farm to table. Ital J Anim Sci 2021; 20: 677–690. [Google Scholar]
- 8.Church NA, McKillip JK. Antibiotic resistance crisis: challenges and imperatives. Biologia 2021; 76: 1535–1550. [Google Scholar]
- 9.Parthasarathy AK, Chougale RA. Antibiotic resistant Staphylococcus aureus. Insights into drug resistance in Staphylococcus aureus. Intech Open 2021. pp. 114–139. [Google Scholar]
- 10.Sharifzadeh A, Hajsharifi-Shahreza M, Ghasemi-Dehkordi P. Evaluation of microbialcontamination and chemical qualities of cream-filled pastries in confectioneries of Chaharmahal Va Bakhtiari province (Southwestern Iran). Osong Public Health Res Perspect 2016; 7: 346–350. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Clinical and Laboratory Standards Institute (CLSI) . Performance standards for antimicrobial susceptibility testing. 28th ed. CLSI supplement M100. Wayne, PA: USA, 2018. [Google Scholar]
- 12.Mahfoozi A, Shirzad-Aski H, Kaboosi H, Ghaemi E. Identification of the classical enterotoxin genes of Staphylococcus aureus in various foods by multiplex PCR assay. Iran J Vet Res 2019; 20: 209–212. [PMC free article] [PubMed] [Google Scholar]
- 13.Arabestani MR, Kamarehei F, Dini M, Aziz Jalilian F, Moradi A, Shokoohizadeh L. Characterization of Staphylococcus aureus isolates from pastry samples by rep-PCR and phage typing. Iran J Microbiol 2022; 14: 76–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Sami M, Nasri A, Bagheri M, Sharifi H. Microbiological and chemical qualities of cream-filled pastries sold in Kerman city confectioneries, southeast of Iran. Eurasian J Vet Sci 2013; 29: 138–142. [Google Scholar]
- 15.Aghalari Z, Hosseini SR, Jafarian S, Rezazadeh M, Mirzaei M, Esmaeili E, et al. Evaluation of chemical and microbial quality of food in northern Iran. J Health Popul Nutr 2021; 40: 40. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Aycicek H, Cakiroglu S, Stevenson TH. Incidence of Staphylococcus aureus in ready-to-eat meals from military cafeterias in Ankara, Turkey. Food Control 2005; 16: 531–534. [Google Scholar]
- 17.Rezaei A, Pajohi-Alamoti MR, Mohammadzadeh A, Mahmoodi P. Detection of gene encoding enterotoxin a in Staphylococcus aureus isolated from cream pastries. J Food Qual Hazards Control 2018; 5: 24–28. [Google Scholar]
- 18.Asgarpoor D, Bahrami M, Daneshamooz S, Ghasemi M. Identification of Staphylococcus aureus enterotoxin genes of SEA, SEB and SEC among healthy carriers in Ardabil city. Iran J Med Microbiol 2018; 11: 149–157. [Google Scholar]
- 19.Bencardino D, Amagliani G, Brandi G. Carriage of Staphylococcus aureus among food handlers: An ongoing challenge in public health. Food Control 2021; 130: 108362. [Google Scholar]
- 20.Machado V, Pardo L, Cuello D, Giudice G, Luna PC, Varela G, et al. Presence of genes encoding enterotoxins in Staphylococcus aureus isolates recovered from food, food establishment surfaces and cases of foodborne diseases. Rev Inst Med Trop Sao Paulo 2020; 62: e5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Soltan Dallal MM, Abrishamchian Langroudi SM, Pourmoradian M, Asadpour S. Frequency distribution of methicillin-resistant Staphylococcus aureus isolated from foods on sale in the south of Tehran, Iran in 2018–19. J Sch Public Health Inst Public Health Res 2020; 18: 17–28. [Google Scholar]
- 22.Mirzababaei M, Soltan Dallal MM, Fard RMN, Asl HM, Pourmoradian M. Prevalence of SEA and SEB producing Staphylococcus aureus isolated from foodborne-outbreaks in Iran. African J Microbiol Res 2021; 15: 535–542. [Google Scholar]
- 23.Hashemi Z, Bonyadian M, Moshtaghi H. Evaluation of antibiotic resistance pattern of enterotoxin-producing Staphylococcus aureus isolated from creamy pastries in Shahrekord area. J Food Microbiol 2020; 8: 76–87. [Google Scholar]
- 24.Jassim SA, Kandala NJ. Molecular detection of enterotoxin genes of multiresistant Staphylococcus aureus isolates from different sources of food. Iraqi J Sci 2021; 62: 61–74. [Google Scholar]
- 25.da Silva AC, Rodrigues MX, Silva NCC. Methicillin-resistant Staphylococcus aureus in food and the prevalence in Brazil : a review. Braz J Microbiol 2020; 51: 347–356. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Fooladvand S, Sarmadian H, Habibi D, Van Belkum A, Ghaznavi-Rad E. High prevalence of methicillin resistant and enterotoxin gene-positive Staphylococcus aureus among nasally colonized food handlers in central Iran. Eur J Clin Microbiol Infect Dis 2019; 38: 87–92. [DOI] [PubMed] [Google Scholar]
- 27.Islam MA, Parveen S, Rahman M, Huq M, Nabi A, Khan ZUM, et al. Occurrence and characterization of methicillin-resistant Staphylococcus aureus in processed raw foods and ready-to-eat foods in an urban setting of a developing country. Front Microbiol 2019; 10: 503. [DOI] [PMC free article] [PubMed] [Google Scholar]