Skip to main content
PhytoKeys logoLink to PhytoKeys
. 2023 May 9;226:1–16. doi: 10.3897/phytokeys.226.96351

Primulinajiulianshanensis, a new species of Gesneriaceae from Jiangxi Province, China

Guo-Liang Xu 1, Li-Fen Liang 2, Di-Ya Chen 3,4, Zhi-Fang Jing 1, Xiao-Hai Zuo 1, Zheng-Yu Zuo 5,, Fang Wen 3,6,
PMCID: PMC10189641  PMID: 37207080

Abstract

Primulinajiulianshanensis F.Wen & G.L.Xu, a new species of Gesneriaceae from Jiulianshan National Nature Reserve of Jiangxi Province, China, is described and illustrated here. Molecular evidence showed it was sister to P.wenii Jian Li & L.J.Yan, while the morphological observation found clear differences between them, petiole, both sides of leaf blades, adaxial surface of the calyx lobes, corolla inside toward the bottom, bract margins covered glandular-pubescent hairs in P.jiulianshanensis (vs. no glandular-pubescent hairs in P.wenii); lateral bracts 4–9 × ca. 2 mm, the central one 2–5 × 1–1.5 mm, adaxially glabrous but sparsely pubescent at apex (vs. lateral bracts 14–16 × 2.5–3.0 mm, the central one 10–12 × 1.3–1.6 mm, all adaxially pubescent); calyx lobes 8–11 × ca. 2 mm, each side with several brown serrate teeth at apex (vs. 14–15 × ca. 2.5 mm, margin entire); filaments and staminodes sparsely yellow glandular-puberulent (vs. white, glabrous).

Keywords: Flora of Jiangxi, Jiulianshan National Nature Reserve, new taxon, Primulinawenii , taxonomy

Introduction

The genus Primulina Hance (Hance 1883) in Gesneriaceae is mainly distributed in the mountainous areas of southern and southwestern China to northern Vietnam, especially in Karst landforms (Wei 2018; Xu et al. 2020b). Since it was redefined (Wang et al. 2011; Weber et al. 2011), many new species have been discovered and published. For example, ten new taxa of Primulina from China were reported in 2020 (Du et al. 2021). As of December 2022, about 240 species (including infraspecies, the same below) have been confirmed throughout the world, of which 224 species are distributed in China. So far, this genus is the largest genus of Gesneriaceae in China (POWO 2022).

Jiangxi Province is located in the mid-subtropical region of East China; the species number of Primulina is not very rich. After consulting references, checking herbarium specimens, and excluding the species that have been mistakenly identified, only 13 species of Primulina have been confirmed in Jiangxi Province (Peng et al. 2021). Three of them were discovered and published after 2011, which are P.lepingensis Z.L.Ning & M.Kang (Ning et al. 2014), P.suichuanensis X.L.Yu & J.J.Zhou (Zhou et al. 2016) and P.inflata Li H.Yang & M.Z.Xu (Xu et al. 2020a).

In April 2021, an interesting population of Primulina was found on a cliff of Danxia landform under the evergreen broad-leaved forest in Jiulianshan National Nature Reserve, Longnan City, Jiangxi Province. Morphologically, this species is similar to P.wenii Jian Li & L.J.Yan (Li et al. 2017) in some characteristics. For example, leaf blades are oblong or broadly rounded, corolla purple, and so on.

We collected the plants at the flowering and fruiting stage in the type locality to make specimens, and at the same time carried out botanical fine anatomical photography to observe carefully. We saw that the indumentum characters of petiole, leaf, bract, calyx, corolla tube, filaments, staminodes of this unknown species were obviously different from P.wenii, and the differences of two species’ calyx lobes and bracts characters can help us easily distinguish them. In order to understand the phylogenetic placements of this unknown species in Primulina, ITS and trnL-F sequences of this species were amplified and included for phylogenetic analysis to examine the relationships of the putative new species.

Materials and methods

Morphological observation

All available specimens of Primulina were used and compared (i. e. those stored in the following herbaria ANU, HITBC, IBK, IBSC, KUN, PE), as was the material of Primulina from recent fieldwork by the authors’ team in South and Southwest China. All the morphological characters, such as leaves, inflorescences, flowers and capsules, were observed and measured in the field. The description, measurements, shape, color and other details given in this description are based on living plants and specimens. We examined distinguished morphological characters of the presumed new species and the compared one, P.wenii, under a dissecting microscope. We described this presumed new species using the terminology of Wang et al. (1990, 1998).

Sampling and DNA sequencing

We randomly selected one plant from the population to collect its leaves for a DNA experiment. Fresh leaf materials were preserved in silica gel for quick drying. Total genomic DNA was extracted from dried leaves using modified cetyltrimethylammonium bromide (CTAB) protocol (Doyle and Doyle 1987). ITS and trnL-F were amplified and sequenced following the methods of Möller et al. (2009) and Smissen et al. (2004), respectively. Besides, we downloaded the ITS and trnL-F sequences from GenBank for 188 Primulina species and two Petrocodon species. Species and GenBank accession numbers employed in this study are listed in Table 1.

Table 1.

Species names and GenBank accession numbers of ITS and trnL-F DNA sequences used in this study.

Species name Voucher number ITS trnL-F
Petrocodonainsliifolius CWH88 KF202291 KF202298
Petrocodonhancei CIPeng22903 KY796057 KY796059
Primulinaalutacea YD07 KY394847 KY393441
Primulinaargentea YMBC KY394848 KY393442
Primulinabaishouensis GXLG05 KY394849 KY393443
Primulinabalansae BALAN MK747141 MK746274
Primulinabeiliuensis GXBLBC KY394850 KY393444
Primulinabeiliuensisvar.fimbribracteata SGQJ04 KY394851 KY393445
Primulinabicolor SLHLCB KY394852 KY393446
Primulinabipinnatifida GXLG04 KY394853 KY393447
Primulinabobaiensis BBGL01 KY394854 KY393448
Primulinabogneriana WF7 MK747166 MK746225
Primulinabrachytricha DWDMCZ KF498048 KY393450
Primulinabrachytrichavar.magnibracteata KFC4193 MK369979 MK369994
Primulinabrunnea BRUN MK747142 MK746275
Primulinabullata GXJX06 KF498071 KY393451
Primulinacangwuensis GXLG04 KY394853 KY393447
Primulinacardaminifolia GXLB MK747131 MK746255
Primulinacarinata NTBC KY394858 KY393452
Primulinacataractarum N1 MW900263 MW960358
Primulinachizhouensis JXFY01 KY394860 KY393454
Primulinacolaniae WF8 MK747167 MK746224
Primulinaconfertiflora GDYS05 MK747101 MK746253
Primulinacordata HYH010 KC190200 KC190207
Primulinacordifolia GXRA02 KY394863 KY393457
Primulinacordistigma GDYCXZ MK747118 MK746251
Primulinacrassirhizoma CJGL01 KY394864 KY393458
Primulinacrassituba HNSP MK747147 MK746230
Primulinacurvituba GXHJ01 MK747137 MK746242
Primulinadanxiaensis P22865 JX506886 JX506778
Primulinadebaoensis DBGL01 KY394868 KY393462
Primulinadepressa DXS02 KY394869 KY393463
Primulinadiffusa PJGL01 KY394871 KY393465
Primulinadongguanica DGBC KY394872 KY393466
Primulinadrakei YNCP01 KY394873 KY393467
Primulinadryas HKDMS KY394875 KY393469
Primulinaduanensis DABC KY394877 KY393471
Primulinaeburnea P22908 JX506891 JX506783
Primulinaeffusa KFC4167 MK369976 MK369991
Primulinafengkaiensis KFC4130 MK369975 MK369990
Primulinafengshanensis KFC4195 MK369970 MK369985
Primulinafimbrisepala P22863 JX506894 JX506786
Primulinafimbrisepalavar.mollis GXIB JX506895 JX506787
Primulinaflavimaculata KFC3988 MK369974 MK369989
Primulinafloribunda DHGL01 KY394886 KY393480
Primulinafordii LJM1207202 MG727881 MG727878
Primulinafordiivar.dolichotricha DHS01 MK747125 MK746247
Primulinagemella GEME MK747146 MK746254
Primulinaglabrescens GZLBSM MK747132 MK746278
Primulinaglandaceistriata GXLCHW MK747114 MK746256
Primulinaglandulosa GXPLCG KY394887 KY393481
Primulinagongchengensis GCGL01 KY394889 KY393483
Primulinagrandibracteata YNHK MK747121 MK746266
Primulinaguigangensis GXGGBC KY394892 KY393486
Primulinaguihaiensis GXLG036 KY394893 KY393487
Primulinaguizhongensis GXGZBC KY394894 KY393488
Primulinahalongensis HLW01 KY394895 KY393489
Primulinahedyotidea XWB JX506905 JX506797
Primulinaheterochroa GXMES01 KY394898 KY393492
Primulinaheterotricha HNBT01 KY394899 KY393493
Primulinahezhouensis HZXH MK747143 MK746258
Primulinahiepii WF2 MK747144 MK746223
Primulinahochiensis GXIB JX506903 JX506795
Primulinahuaijiensis GDHJ02 KF498127 KY393495
Primulinahuangii WF12 MK747138 MK746231
Primulinahunanensis Xu11697 KU220602 KU220608
Primulinajiangyongensis HNJY01 KY394902 KY393496
Primulinajingxiensis LZXHGL01 KY394903 KY393497
Primulinajiuwanshanica JWS MK747116 MK746260
Primulinajuliae LJM1210011 MG727889 MG727873
Primulinalangshanica LSCZ KY394907 KY393501
Primulinalatinervis XIN1 KY394908 KY393502
Primulinalaxiflora P22927 JX506910 JX506802
Primulinalechangensis GDLC12 KY394910 KY393504
Primulinaleeii LSGL01 KY394911 KY393505
Primulinaleiophylla GXJX07 KY394912 KY393506
Primulinalepingensis JXLP01 KY394913 KY394913
Primulinaleprosa GXMS055 KY394914 KY393508
Primulinalianpingensis CHLT016 MH343910 MH344542
Primulinaliboensis GXJX08 KY394917 KY393511
Primulinaliguliformis GXIB JX506912 JX506804
Primulinalijiangensis GLS01 KY394919 KY393513
Primulinalinearicalyx KFC4141 MH032854 MH032841
Primulinalinearifolia GXNN01 KY394921 KY393515
Primulinalingchuanensis LCXHGL01 KY394922 KY393516
Primulinalinglingensis LLBC KY394923 KY393517
Primulinalinglingensisvar.fragrans XHLLBC2 MK746285 MK746285
Primulinaliujiangensis LJGL01 KY394924 KY393518
Primulinalobulata GDQX04 KF498054 KY393519
Primulinalonggangensis P22948 JX506916 JX506808
Primulinalongicalyx GXGL01 KY394927 KY393521
Primulinalongii XWB JX506917 JX506809
Primulinalongzhouensis P22963 JX506918 JX506810
Primulinalunglinensis GZXY04 KY394930 KY393524
Primulinalunglinensisvar.amblyosepala LCDE MK747105 MK746281
Primulinalungzhouensis GXJX10 KY394931 KY393525
Primulinaluochengensis LCWCGL01 KY394932 KY393526
Primulinalutea 1844 JX506921 JX506813
Primulinalutescens PBLS01 MK747135 MK746263
Primulinalutvittata KFC4149 MK369978 MK369993
Primulinaluzhaiensis HYH019 KC190197 KC190204
Primulinamabaensis SZY02 KY394937 KY393531
Primulinamacrodonta GXIB JX506923 JX506815
Primulinamaculata Xu11916 KU220604 KU220609
Primulinamaguanensis YNMG MK747127 MK746267
Primulinamalipoensis YNMLP01 MK747123 MK746240
Primulinamedica GXPLCM KY394940 KY393534
Primulinamelanofilamenta GXXA MK747158 MK746277
Primulinaminor WXXH1 MK747160 MK746290
Primulinaminutimaculata GXLZ10 KY394941 KY393535
Primulinamoi SGWY03 KF498115 KY393536
Primulinamollifolia GXESWC KY394943 KY393537
Primulinamultifida DLXHGL01 KY394946 KY393540
Primulinanandanensis GXJX02 KY393541 KY393541
Primulinanapoensis GXIB JX506930 JX506821
Primulinaningmingensis NMGL01 KY394949 KY393543
Primulinaobtusidentata GZJK01 KF498096 KY393544
Primulinaophiopogoides GXFS01 KF498062 KY393545
Primulinaorthandra ZRBC2 MK747128 MK746286
Primulinaparvifolia GGSL01 KY394952 KY393546
Primulinapengii W0397 KU220603 KU220610
Primulinapetrocosmeoides SHDBC KY394953 KY393547
Primulinapinnatifida MS02 KY394954 KY393548
Primulinapolycephala GDLZ06 KY394955 KY393549
Primulinaporphyrea DNGL01 KU173793 KU173799
Primulinapseudoeburnea KY394958 KY394958 KY393552
Primulinapseudoglandulosa GXYS06 KF498138 KY393482
Primulinapseudoheterotricha XWB JX506933 JX506824
Primulinapseudolinearifolia JXY MK747140 MK746280
Primulinapseudomollifolia JMMXH1 MK747134 MK746244
Primulinapseudoroseoalba JFHGL01 KY394959 KY393553
Primulinapteropoda HNCJ01 KY394960 KY393554
Primulinapungentisepala JEGL01 KY394962 KY393556
Primulinapurpurea ZHGL01 KY394964 KY393558
Primulinaqingyuanensis GDQX01 KY394965 KY394965
Primulinarenifolia GXDA02 KY394966 KY393560
Primulinarepanda GXBM03 KY394968 KY393562
Primulinaronganensis GXRA01 KF498135 KY393564
Primulinarongshuiensis GXRS01 KF498088 KY393565
Primulinaroseoalba LDGL01 KY394972 KY393566
Primulinarosulata GXPL05 KU528874 KU528884
Primulinarotundifolia OO3 KY394975 KY393569
Primulinarubribracteata JH01R KU173791 KU173797
Primulinasclerophylla GXDA01 KY394979 KY393573
Primulinasecundiflora GZQZ MK747119 MK746279
Primulinashouchengensis GXYF02 KY394980 KY393574
Primulinasichuanensis SCBC MK747162 MK746264
Primulinadryas HKDMS KY394875 KY393469
Primulinasinovietnamica Peng21956 MK369973 MK369988
Primulinaspinulosa GXFS02 KF498063 KY393576
Primulinasubrhomboidea GXYS02 KY395018 KY393577
Primulinasubulata GDYA01 KY395020 KY393579
Primulinasubulatavar.guilinensis GXHYXH KY394967 KY393561
Primulinasubulatisepala CQAYH01 MK747122 MK746246
Primulinasuichuanensis GDLC07 KY395021 KY393580
Primulinaswinglei GXRX01 KY395022 KY393581
Primulinatabacum LZ01 KY395023 KY393582
Primulinatenuifolia GXBM01 KY395024 KY393583
Primulinatenuituba GZGY01 KY395025 KY393584
Primulinatiandengensis GXTD03 KY395027 KY393586
Primulinatribracteata GXFS04 KY395028 KY393587
Primulinatribracteatavar.zhuana 1877 JX506952 JX506843
Primulinatsoongii ZSGL01 KY395029 KY393588
Primulinavaricolor GXNP01 KF498086 KY393589
Primulinaverecunda LBJX01 KY395031 KY393590
Primulinaversicolor GDYD01 MK747155 MK746252
Primulinavestita QZXT MK747156 MK746282
Primulinavillosissima QXY01 KY395032 KY393591
Primulinawenii WENI MK747148 MK746284
Primulinawentsaii GXLZ047 KY395033 KY393592
Primulinawuae WSBC MK747159 MK746265
Primulinaxinningensis GGGL01 KY394891 KY393485
Primulinaxiziae ZJHZ01 KY395038 KY393597
Primulinayangchunensis GDYC01 KY395039 KY393598
Primulinayangshanensis GDNX01 KY395040 KY393599
Primulinayangshuoensis GXYS07 KY395042 KY393601
Primulinayingdeensis YD03 KU528876 KU528886
Primulinayungfuensis GXIB JX506957 JX506848
Primulinazhoui WF18 MK747104 MK746222
Primulinajiulianshanensis WF217 OP243287 OP243283

Phylogenetic analysis

We assembled and aligned the newly obtained sequences and those from GenBank using MAFFT v.7.017 (Katoh et al. 2002) and subsequently corrected and combined the ITS and trnL-F sequences in Geneious 9.1.4 (Kearse et al. 2012). We used the Maximum likelihood (ML) and Bayesian inference (BI) analyses to do the phylogenetic analysis of the ITS and trnL-F matrixes, and the combined ITS + trnL-F sequences data-set. The two best supported tree topologies from maximum likelihood (ML) analyses of ITS and trnL-F were visually compared for topological incongruence. A conflict in tree topologies of each tree was considered significant when incongruent topologies both received bootstrap values ≥ 80% (Fu et al. 2022). The ML analyses were conducted using IQ-TREE 1.6.12 (Nguyen et al. 2015) with the GTR+R6 model and 1000 ultrafast bootstrap replicates. For BI analysis, we employed MrBayes v.3.2.6 (Ronquist et al. 2012) to obtain a maximum clade credibility (MCC) tree. Bayesian inference was performed using one million generations, four runs, four chains, a temperature of 0.001, 25% trees discarded as burn-in, and trees sampled every 1,000 generations (1,000 trees sampled in total) with GTR+I+G model.

Results

Phylogenetic analysis

The ITS matrix had a length of 782 characters, with 449 (57.4%) variable characters and 355 (45.4%) parsimony-informative. In comparison, the trnL-F matrix had a length of 836 characters, with 198 (23.6%) variable characters and 93 (11.1%) were parsimony-informative. The comparison of trees for ITS and trnL-F revealed no significant incongruence topology and both indicated that Primulinajiuyishanensis is closely related to P.wenii (Suppl. materials 1, 2). Because the combined dataset resulted in a better-resolved tree with higher support values, we use the combined dataset to do the further molecular studies. The combined data-set was 1628 characters, with 653 (40.1%) variable characters and 452 (27.8%) parsimony-informative, including the indels in all matrixes. The undescribed species and P.wenii were sister groups [Bayesian posterior probabilities (BIPP) = 1.00, ML ultrafast bootstrap support values (UFBoot) = 100%], and we found 10 and 1 different sites in the ITS (totally 615 bp) and the trnL-F (totally 750 bp) sequences between them, respectively (Table 2). belonging to a strongly supported clade (BIPP = 0.99, UFBoot = 98%) included Primulinacrassituba (W.T.Wang) Mich.Möller & A.Weber, P.effusa F.Wen & B.Pan and P.lobulata (W.T.Wang) Mich.Möller & A.Weber (Wang 1982, 1989; Weber et al. 2011; Pan et al. 2017) (Fig. 1).

Table 2.

Sequence differences of ITS and trnL-F regions between Primulinajiulianshanensis and P.wenii.

Species & marker Sequences
P.jiulianshanensis ITS 1~CCCGAGAACATGTTTAAAACACGCTTGCGT~30
P.wenii ITS 1~CCCGAGAACATGTTTAAGACACGCTTGCGT~30
P.jiulianshanensis ITS 141~CGAGCGCCTCTCCGTCCTGGCTAAGTTCGC~170
P.wenii ITS 141~CGAGCGCCTCTCCGTACCGGTGAAGTTCGC~170
P.jiulianshanensis ITS 396~CGTTTTTTCCACGCTCAAAAGGTGTC–GGGGACGA~430
P.wenii ITS 396~CGTCTTTTCCACGCTCCAAAGGTGTCGGGGGAAGA~430
P.jiulianshanensis trnL-F 501~GTTCAAAAGTCCTTTATCTT~520
P.wenii trnL-F 501~GTTCAAAATTCCTTTATCTT~520

Figure 1.

Figure 1.

Phylogenetic tree of Primulina generated from maximum likelihood (ML) of combined trnL-F and ITS data-set. Numbers of each branch are support values in the order of UFBoot/BIPP. Stars indicate UFBoot = 100% or BIPP = 1.0. The dash (–) indicates a node with UFBoot or < 50% or BIPP < 0.5.

Taxonomic treatment

. Primulina jiulianshanensis

F.Wen & G.L.Xu sp.nov.

F64C620E-DC3C-5C46-87B4-F1EC4700AAA7

urn:lsid:ipni.org:names:77318694-1

Figs 2 , 3

Figure 2.

Figure 2.

Primulinajiulianshanensis sp. nov. A habitat B population C plant in blooming D habit E adaxial surface of mature leaf blades and petiole F abaxial surface of mature leaf blade and petiole.

Figure 3.

Figure 3.

Primulinajiulianshanensis sp. nov. A cyme B adaxial surfaces of bracts C abaxial surfaces of bracts D adaxial surfaces of calyx lobes E abaxial surfaces of calyx lobes F opened corolla G stamens and anthers H one of lateral staminodes I pistil J immature capsules K transverse section of capsule.

Diagnosis.

This new species differs from P.wenii by the combination of the following characteristics: petiole, both sides of leaf blades, adaxial surface of the calyx lobes, corolla inside toward the bottom, bract margins glandular-pubescent (vs. what above-mentioned eglandular-pubescent in P.wenii); lateral bracts 4–9 × ca. 2 mm, the central one 2–5 × 1–1.5 mm, adaxially glabrous but sparsely pubescent at apex (vs. lateral bracts 14–16 × 2.5–3.0 mm, the central one 10–12 × 1.3–1.6 mm, all adaxially pubescent); calyx lobes 8–11 × ca. 2 mm, each side with several brown serrate teeth at apex (vs. 14–15 × ca. 2.5 mm and entire); filaments and staminodes sparsely glandular-puberulent (vs. glabrous). Detailed morphological comparisons with P.wenii are provided in Table 3.

Table 3.

Comparisons between the characters of Primulinajiulianshanensis and P.wenii.

Characters Primulinajiulianshanensis P.wenii
Petiole indumentum densely villous and very sparsely glandular pubescent densely villous
Leaf blades indumentum adaxially densely white to light red villous and very sparsely glandular pubescent, abaxially densely white villous and pubescent, and very sparsely glandular -pubescent adaxially densely pubescent and villous, abaxially densely appressed pubescent
Bract lateral ones 4–9 × ca. 2 mm, the middle one 2–5 × 1–1.5 mm, all abaxially white or reddish pubescent, adaxially glabrous but sparsely pubescent at apex, margin ciliate and very sparsely glandular-puberulent lateral ones 14–16 × 2.5–3.0 mm, the central one 10–12 × 1.3–1.6 mm; outside white pubescent and villous, adaxially white pubescent, margin entire and ciliate
Calyx lobes adaxially sparsely white puberulent and glandular puberulent, margin entire but each side of calyx lobes with 1–3 brown crenate teeth at apex; lobes 8–11 × ca. 2 mm adaxially sparsely shortly pubescent to nearly glabrous, margin entire, lobes 14–15 × ca. 2.5 mm
Filament yellow from middle to base but white upper half, glandular-puberulent white, glabrous
Staminodes yellowish, lateral ones very sparsely glandular-puberulent white, glabrous
Holotype.

China, Jiangxi Province: Ganzhou City, Longnan County, Jiulianshan National Nature Reserve, growing in shady and moist cliffs in the forest, 24°34'8.9"N, 114°25'49.7"E, altitude ca. 440 m, April 20, 2021, Guo-Liang Xu, JLSXGL-20210420 (Holotype IBK!; Isotype: KUN!)

Description.

Herbs perennial, acaulescent, rhizome terete, 1–4 cm long, 0.8–1.5 cm in diam., leaves all basal, 4–8, petiole 10–40 × 4–13 mm, densely villous and very sparsely glandular-pubescent. Leaf blade oblong-elliptic or broadly elliptic, 4–13 × 4–8 cm, thickly chartaceous, more and less fleshly, adaxially pale green to dark green, densely white to light red villous and very sparsely glandular-pubescent, abaxially pale green, densely white villous and pubescent, and very sparsely glandular-pubescent, base apparently asymmetric but cuneate, margin irregularly obtuse-serrate, apex slightly obtuse, lateral veins 4–6 on each side, adaxially inconspicuously sunken, abaxially prominently raised. Inflorescence dichotomous cymes 2–4, axillary, 1–3-branched, 3–9-flowered or more; peduncle and pedicle green, erectly white or light red pubescent; peduncle 5–10 cm long, 2–3 mm in diam.; pedicle 5–15 mm long, 1–2 mm in diam. Bracts 3, lanceolate or spatulate, a pair on either side in same size, opposite, 4–9 mm long, ca. 2 mm wide, the middle one smaller, 2–5 mm long, 1–1.5 mm wide, all three abaxially white or reddish pubescent, adaxially glabrous but sparsely pubescent at apex, margin entire, ciliate and very sparsely glandular-puberulent, apex acute; bracteoles 3, shape and indumentum same as bracts, 2–5 mm long, 1–1.5 mm wide. Calyx 5-parted, lobes lanceolate, 8–11 mm long, ca. 2 mm wide, nearly equal, abaxially densely white or light red villous, adaxially sparsely white puberulent and glandular-puberulent, margin entire but each side of calyx lobes with 1–3 purplish brown crenate at the apex. Corolla pinkish purple to bluish purple, 3.6–4.0 cm long; corolla tube funnelform, 2.6–3 cm long, mouth 1.3–1.6 cm in diam., base ca. 5 mm in diam., outside densely glandular-pubescent, inside from the middle to the base sparsely glandular-puberulent, and the upper part of the corolla tube glabrous; corolla tube abdomen with two obviously longitudinal ridges, the upper part (close to the mouth) of the longitudinal ridge dark bluish purple, and the lower part (close to the bottom) changing into yellowish brown; a dark reddish-brown lump on the upper throat of the corolla tube inside and between upper lip lobes, ovate to spatulate, extending to the middle of the corolla tube, the lump densely glandular-puberulent; a narrow triangular thickened dark reddish-brown stripe extending to the middle of the corolla tube inside at each side of corolla tube and at the junction of the abaxial and adaxial lip; limb distinctly 2-lipped, adaxial lip 2-parted to the middle, lobes broadly ovate to semicircular, apex round, 6–8 mm long, 6–9 mm wide at the bottom; abaxial lip 3-parted to near the base, lobes elliptical to oblong, 8–12 mm long, 7–9 mm wide at the bottom. Stamens 2, adnate to 1.8 cm above the base of corolla tube; filaments linear, yellow from middle to base but white upper half, 8–11 mm long, geniculate near the base, glandular-puberulent; anthers reniform, slightly constricted at the middle, densely villous and fewer glandular-puberulent; staminodes 3, yellowish, lateral ones ca. 6 mm long, adnate to 14 mm above the base of corolla tube, straight, linear, very sparsely glandular-puberulent, apex capitate, the central one ca. 1 mm long, adnate to 5–6 mm above the base of corolla tube, glabrous. Disc annular, ca. 1 mm high, margin undulate, glabrous, white. Pistil pale green, 2.8–3.2 cm long; style linear, 1.9–2.3 cm long, ca. 1 mm in diam., upper part densely glandular-puberulent, lower part densely glandular-puberulent and eglandular-puberulent, ovary oblong, ca. 10 mm long, ca. 2 mm in diam., densely villous and glandular-pubescent, parietal placenta. Stigma acute triangle to narrowly obtrapeziform, 2-lobed, ca. 3 mm long. Capsule linear, 2–4 cm long, parietal placenta, densely villous and glandular-pubescent.

Phenology.

Flowering from April to May, fruiting from June to September.

Etymology.

The specific epithet ‘jiulianshanensis’ is derived from the type locality, Jiulianshan National Natural Reserve, Jiangxi Province, China.

Vernacular name.

九连山报春苣苔 (Chinese name); Jǐu Lían Shān Bào Chūn Jù Tái (Chinese pronunciation).

Distribution and habitat.

We found three small subpopulations in Jiulianshan National Nature Reserve in Jiangxi Province, which are distributed in the shady and wet place on the cliffs under the evergreen broad-leaved forest in the reserve. And the new species is mainly acccompanied by Begoniapalmata D.Don, Utriculariastriatula J.Smith, Selaginellamoellendorffii Hieron., S.involvens (Sw.) Spring, etc.

Conservation status.

At present, only three small subpopulations with total ca. 300 mature individuals of the new species are known in the type locality, Jiulianshan National Natural Reserve, Jiangxi Province, China. The three subpopulations are stable because they are in the reserve. The known AOO and EOO of the new species are about 0.2 km2 and 25 m2, respectively. Thus, if considering its fewer individuals of three subpopulations, it should be temporarily assessed as Near Threated (NT), following the IUCN Red List Categories and Criteria (IUCN Standards and petitions committee 2022).

Notes.

The mainly morphological differences are showed in diagnosis and Table 3. In addition, the insides of the corolla tube are also somewhat different. For example, at the junction of the abaxial and adaxial lip, there are two narrow triangular thickened dark reddish-brown stripes inside the corolla tube in Primulinajiulianshanensis, but there are only two bluish purple spots at the same places in P.wenii; at corolla tube abdomen of P.jiulianshanensis, the upper parts of the longitudinal ridges are dark bluish purple, and the lower parts are yellowish brown, but the longitudinal ridges inside corolla tube of P.wenii are all dark bluish purple; the lump on the upper throat inside corolla tube of P.jiulianshanensis is dark reddish-brown, but P.wenii is dark bluish brown(Li et al. 2017).

The type locality of Primulinawenii is Rixi Township, Fuzhou, Fujian Province, while the type locality of P.jiulianshanensis is Jiulian Mountain, Jiangxi Province. Their type localities are separated by the Wuyi Mountains, and the two places are more than 500 kilometers apart. P.wenii has a narrow distribution range and is only recorded in Rixi Township, Fuzhou, Fujian Province (Li et al. 2017). This area is coastal and the climate zone of this region belongs to the typical subtropical marine monsoon climate. P.wenii grows in the limestone evergreen broad-leaved forest area with stable morphology. P.jiulianshanensis, grows on the rocks under the evergreen broad-leaved forest in Jiulianshan Nature Reserve, which is a typical Danxia landform. The soil forming rock are mainly sandstone and conglomerate in Jiulianshan Nature Reserve, which has a subtropical monsoon humid climate. The morphology of the P.jiulianshanensis in three subpopulations is also relatively stable. Therefore, considering the differences in molecular, morphological, and habitats between P.jiulianshanensis and P.wenii, they should be classified as two different species.

Except for a few species, such as Primulinafimbrisepala (Hand.-Mazz.) Yin Z.Wang, P.eburnea (Hance)Yin Z.Wang, P.tenuituba (W.T.Wang) Yin Z.Wang, P.juliae (Hance) Mich.Möller & A.Weber, most of the species of Primulina are narrowly distributed and endemic. Among the known species worldwide, more than 170 species are endemic to Karst areas in southern to southwestern China and to northern Vietnam (Wei 2018; Xu et al. 2020b). However, the diversity of Primulina in the Danxia landform has not been well understood so far (Yu et al. 2019). For example, the new species, P.suichuanensis, was found in the Danxia landform in Jiangxi Province (Zhou et al. 2016). It should be noted that a new provincial record for Primulinawenii from Jiangxi Province was discovered in Jiulianshan Nature Reserve (Liao et al. 2020). However, we carefully examined the voucher specimen (No. PVHJX-05557, stored in GNNU), and we noted that the voucher was collected from the same subpopulation of P.jiulianshanensis from the same site in Jiulianshan Nature Reserve. Further, we found there are many inconsistencies between the morphological description from the article (Liao et al. 2020) and the corresponding voucher specimens. Thus, this species’ new provincial record of P.wenii in Jiangxi province is a mistaken identification. Lastly, none of the close relatives of Primulina are morphologically similar to this new species found in Jiangxi (Fig. 1). Thus, the new taxon is not easily confused with the others in this province.

Supplementary Material

XML Treatment for Primulina jiulianshanensis

Acknowledgements

We want to thank Stephen Maciejewski, the Gesneriad Society, and Michael LoFurno, Associate Professor, Temple University, Philadelphia, USA, for their editorial assistance. This study was financially supported by the Basic Research Fund of Guangxi Academy of Sciences (CQZ-C-1901), the Key Sci. & Tech. Research and Development Project of Guangxi (Guike AD20159091 & ZY21195050), the capacity-building project of SBR of CAS (KFJ-BRP-017-68), Basal Research Fund of GXIB (Guizhifa010) and the Fund of Technology Innovation Alliance of Flower Industry (2020hhlm005).

Citation

Xu G-L, Liang L-F, Chen D-Y, Jing Z-F, Zuo X-H, Zuo Z-Y, Wen F (2023) Primulina jiulianshanensis, a new species of Gesneriaceae from Jiangxi Province, China. PhytoKeys 226: 1–16. https://doi.org/10.3897/phytokeys.226.96351

Contributor Information

Zheng-Yu Zuo, Email: zuozhengyu@mail.kib.ac.cn.

Fang Wen, Email: wenfang760608@139.com.

Supplementary materials

Supplementary material 1

The tree of the trnL-F plastid marker for Primulina species

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Author: Zheng-Yu Zuo

Data type

(phylogenetic, genomic, tree)

Explanation note

The trnL-F plastid marker and the ITS nuclear marker separately and discuss any incongruences between the two markers, particularly with respect to the position of the new species.

Supplementary material 2

The tree of the ITS nuclear marker for Primulina species

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Author: Zheng-Yu Zuo

Data type

(phylogenetic, genomic, tree)

Explanation note

The trnL-F plastid marker and the ITS nuclear marker separately and discuss any incongruences between the two markers, particularly with respect to the position of the new species.

References

  1. Doyle JJ, Doyle JL. (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11–15. [Google Scholar]
  2. Du C, Liu J, Ye W, Liao S, Ge BJ, Liu B, Ma JS. (2021) Annual report of new taxa and new names for Chinese plants in 2020. Shengwu Duoyangxing 29(8): 1011–1020. 10.17520/biods.2021122 [DOI] [Google Scholar]
  3. Fu LF, Wen F, Maurin O, Rodda M, Gardner EM, Xin ZB, Wei YG, Monro AK. (2022) A revised delimitation of the species-rich genus Pilea (Urticaceae) supports the resurrection of Achudemia and a new infrageneric classification. Taxon 71(4): 796–813. 10.1002/tax.12711 [DOI] [Google Scholar]
  4. Hance HF. (1883) New Chinese Cyrtandreae. Journal of Botany. British and Foreign 21: 165–170. [Google Scholar]
  5. IUCN Standards and petitions committee (2022) Guidelines for Using the IUCN Red List Categories and Criteria. Version 15. Prepared by the Standards and petitions committee. https://www.iucnredlist.org/resources/redlistguidelines [Accessed on 4 Mar. 2022]
  6. Katoh K, Misawa K, Kuma K, Miyata T. (2002) MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Research 30(14): 3059–3066. 10.1093/nar/gkf436 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A. (2012) Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28(12): 1647–1649. 10.1093/bioinformatics/bts199 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Li J, Chen X, Li S, Yan LJ. (2017) Primulinawenii (Gesneriaceae), a new species from China. Bangladesh Journal of Plant Taxonomy 24(2): 173–182. 10.3329/bjpt.v24i2.35113 [DOI] [Google Scholar]
  9. Liao HH, Li L, Wei Y, Liang YL. (2020) Primulinawenii (Gesneriaceae), a new record species from Jiangxi Province. South China Forestry Science 48(3): 45–46, 71. 10.16259/j.cnki.36-1342/s.2020.03.009 [DOI]
  10. Möller M, Pfosser M, Jang CG, Mayer V, Clark A, Hollingsworth ML, Barfuss MHJ, Wang YZ, Kiehn M, Weber A. (2009) A preliminary phylogeny of the ‘Didymocarpoid Gesneriaceae’ based on three molecular data sets: Incongruence with available tribal classifications. American Journal of Botany 96(5): 989–1010. 10.3732/ajb.0800291 [DOI] [PubMed] [Google Scholar]
  11. Nguyen LT, Schmidt HA, Haeseler A, Minh BQ. (2015) IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32(1): 268–274. 10.1093/molbev/msu300 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Ning ZL, Wang J, Tao JJ, Kang M. (2014) Primulinalepingensis (Gesneriaceae), a new species from Jiangxi, China. Annales Botanici Fennici 51(5): 322–325. 10.5735/085.051.0508 [DOI] [Google Scholar]
  13. Pan B, Zou LL, Zhang RL, Kang M, Wen F. (2017) Primulinaeffusa F.Wen & B.Pan, a new species of Gesneriaceae from limestone areas of South China. Guangxi Zhi Wu 37(10): 1250–1256. 10.11931/guihaia.gxzw201706006 [DOI] [Google Scholar]
  14. Peng YS, Tang ZB, Xie YF. (2021) Inventory of species diversity of Jiangxi vascular plants. China Forestry Publishing House, Beijing, 434 pp. [Google Scholar]
  15. POWO (2022) Plants of the World Online. Royal Botanic Gardens, Kew. [Accessed 31 October 2022] http://www.plantsoftheworldonline.org/
  16. Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP. (2012) Mrbayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. 10.1093/sysbio/sys029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Smissen RD, Breitwieser I, Ward JM. (2004) Phylogenetic implications of trans-specific chloroplast DNA sequence polymorphism in New Zealand Gnaphalieae (Asteraceae). Plant Systematics and Evolution 249(1–2): 37–53. 10.1007/s00606-004-0209-0 [DOI] [Google Scholar]
  18. Wang WT. (1982) Notulae de Gesneriaceis Sinensibus (IV). Bulletin of Botanical Research 2(4): 37–64. [Google Scholar]
  19. Wang WT. (1989) Tres Species Novae Chiritae (Gesneriaceae) e Hunan. Bulletin of Botanical Research 9(4): 21–28. [Google Scholar]
  20. Wang WT, Pan KY, Li ZY. (1990) Gesneriaceae. In: Wang WT. (Ed.) Flora Republicae Popularis Sinicae, Vol.69. Science Press, Beijing, 331–418.
  21. Wang WT, Pan KY, Li ZY, Weitzman AL, Skog LE. (1998) Gesneriaceae. In: Wu ZY, Raven PH (Eds) Flora of China Vol. 18. Science Press, Beijing, and Missouri Botanical Garden Press, St. Louis.
  22. Wang YZ, Mao RB, Liu Y, Li JM, Dong Y, Li ZY, Smith JF. (2011) Phylogenetic reconstruction of Chirita and allies (Gesneriaceae) with taxonomic treatments. Journal of Systematics and Evolution 49(1): 50–64. 10.1111/j.1759-6831.2010.00113.x [DOI] [Google Scholar]
  23. Weber A, Middleton DJ, Forrest A, Kiew R, Lim CL, Rafidah AR, Sontag S, Triboun P, Wei YG, Yao TL, Möller M. (2011) Molecular systematics and remodeling of Chirita and associated genera (Gesneriaceae). Taxon 60(3): 767–790. 10.1002/tax.603012 [DOI] [Google Scholar]
  24. Wei YG. (2018) The Distribution and Conservation Status of Native Plants in Guangxi, China. China Forestry Publishing House, Beijing, 876 pp. [Google Scholar]
  25. Xu MZ, Kong HH, Kang M, Yang LH. (2020a) A new species of Primulina (Gesneriaceae) from Danxia landform in Jiangxi, China. Taiwania 65(2): 163–166. 10.6165/tai.2020.65.163 [DOI] [Google Scholar]
  26. Xu MZ, Yang LH, Kong HH, Wen F, Kang M. (2020b) Congruent spatial patterns of species richness and phylogenetic diversity in karst flora: Case study of Primulina (Gesneriaceae). Journal of Systematics and Evolution 59(2): 251–261. 10.1111/jse.12558 [DOI] [Google Scholar]
  27. Yu XY, Li JM, Ren MX. (2019) Adaptive differentiation of Gesneriaceae on karst and Danxia landforms in Southern China. Guangxi Sciences 26(1): 132–140. 10.13656/j.cnki.gxkx.20190321.003 [DOI] [Google Scholar]
  28. Zhou DS, Zhou JJ, Li M, Yu XL. (2016) Primulinasuichuanensis sp. nov. (Gesneriaceae) from Danxia landform in Jiangxi, China. Nordic Journal of Botany 34(2): 148–151. 10.1111/njb.00956 [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

XML Treatment for Primulina jiulianshanensis
Supplementary material 1

The tree of the trnL-F plastid marker for Primulina species

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Author: Zheng-Yu Zuo

Data type

(phylogenetic, genomic, tree)

Explanation note

The trnL-F plastid marker and the ITS nuclear marker separately and discuss any incongruences between the two markers, particularly with respect to the position of the new species.

Supplementary material 2

The tree of the ITS nuclear marker for Primulina species

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Author: Zheng-Yu Zuo

Data type

(phylogenetic, genomic, tree)

Explanation note

The trnL-F plastid marker and the ITS nuclear marker separately and discuss any incongruences between the two markers, particularly with respect to the position of the new species.


Articles from PhytoKeys are provided here courtesy of Pensoft Publishers

RESOURCES