Skip to main content
NCBI home page
Virus Research logoLink to Virus Research
. 2023 Mar 28;329:199090. doi: 10.1016/j.virusres.2023.199090

A novel lytic bacteriophage against colistin-resistant Escherichia coli isolated from different animals

Tianshi Xiao a, Xiaolin Zhu a, Wenhui Wang a,b, Xuchen Jia a,b, Changmei Guo a,b, Xue Wang a, Zhihui Hao a,⁎
PMCID: PMC10194099  PMID: 36944413

Highlights

  • •

    Phage FJ63A is a new member of genus krischvirus which belongs to a newly created family straboviridae.

  • •

    It has a broad host range and can rapidly lyse many different serotypes of colistin-resistant E. coli.

  • •

    It demonstrated bactericidal activity against a wide variety of colistin-resistant strains of E. coli with maximum killing achieved within 2 h.

  • •

    Phage FJ63A recognizes different hosts to other krischvirus phages via a unique tail fiber and baseplate.

Keywords: Bacteriophage, E. coli, Colistin resistance, Krischvirus

Abstract

Escherichia coli is a common pathogen in human and veterinary clinical infection. With antibiotic resistance including colistin resistance increasing globally, few antibiotic treatments are available for use against multidrug-resistant strains of E. coli. Given such circumstances, bacteriophage (phage) therapy is once again being considered as a potential alternative or adjunct to antibiotic therapy. Here, we isolated 52 phages from 816 samples from pig, chicken and duck farms in 4 provinces in China and identified a novel Escherichia phage, vB_EcoStr-FJ63A, from pig feces. Morphological observation showed that phage vB_EcoStr-FJ63A had an icosahedral capsid and an inflexible tail. Whole-genome sequencing revealed a double-stranded DNA genome of 168,157 bp (including 271 coding sequences) with a GC content of 40.29%. Bioinformatic analysis classified phage vB_EcoStr-FJ63A as a Krischvirus, belonging to Straboviridae. The phage was relatively stable at pH 4–10 and below 60℃. It was lytic against a wide variety of colistin-resistant strains of E. coli from various animals, with one-step growth curves showing a latent period of 30 min and burst size of ∼11 PFU per infected cell. Maximum bactericidal activity was achieved within 2 h. No antibiotic resistance or virulence genes were detected in the phage genome. Further studies are warranted to develop phage vB_EcoStr-FJ63A as a potential biocontrol agent against colistin-resistant E. coli.

1. Introduction

E. coli is a conditionally pathogenic Gram-negative bacterium that widely exists in nature. Several strains of E. coli such as Shiga toxin-producing E. coli (STEC) and enteropathogenic E. coli (EPEC) are harmful to humans and livestock (Farfan-Garcia et al., 2016; Gyles, 2007; Scallan et al., 2011). While antibiotics are generally the first choice for treatment of E. coli infection, the wide use of antibiotics has led to multidrug-resistant (MDR) strains of E. coli that are increasingly observed in humans and animals (Poirel et al., 2018). In recent years, the polymyxin antibiotic colistin has been regarded as a last resort treatment option against MDR gram-negative bacteria (Gregoire et al., 2017). However, since the first discovery of the mobile colistin resistance gene mcr-1, this and other mcr genes (mcr-2 to mcr-10) have been reported in more than 50 countries globally (Hussein et al., 2021; Liu et al., 2016; Sun et al., 2018; Wang et al., 2017). Such increasing prevalence of polymyxin resistance has become a significant challenge worldwide. There is therefore an urgent need for alternatives to colistin in agriculture to further reduce the emergence of colistin resistance.

Bacteriophages (phages) are bacterial viruses that specifically infect and lyse bacteria. During the 1920s and 1930s, Felix d'Hérelle successfully developed phage therapy to treat bacterial infections caused by E. coli and other bacteria which could otherwise not be treated at that time (Casey et al., 2018). Phage therapy has limitations including that phage only infect specific hosts. Therefore, interest in phage therapy waned with the deployment of antibiotics. However, in the era of serious antibiotic resistance, phages have received renewed attention as antibacterial agents with several recent studies have shown promising therapeutic effects with phage therapy (Evran et al., 2021; Salazar et al., 2021; Zalewska-Piatek and Piatek, 2020). In addition, as the most abundant and diverse biological entities in the world, phage exist widely in various ecosystems (Dion et al., 2020). Compared with the high-cost and lengthy development of novel antibiotics, it is relatively economical and fast to isolate new phages. These favorable factors will further promote the research of phages as antibacterial agents. At present, E. coli phages were mainly used in the treatment of inflammatory bowel disease (IBD) and urinary tract infection (UTI) in humans (Chegini et al., 2021; Palmela et al., 2018). In veterinary clinic, E. coli phages have been successfully used to treat diarrhea, mastitis and endometritis (Jamal et al., 2019). Currently, the reported E. coli phages in GeneBank mainly belong to the class Caudoviricetes with a tail structure, and most of these E. coli phages have a double-stranded DNA genome. However, the genome sizes of E. coli phages are variable from only a few thousand bp to several hundred thousand bp (Inokuchi et al., 1986; Kim et al., 2013). The G + C contents of different phages are also different, ranging from 30.5% to 54.4% (Barros et al., 2019; Chang and Kim, 2011). Overall, E. coli phages have shown significant genetic diversity.

In this study, we discovered a novel phage from pig feces in a farm in Fujian, China, capable of infecting and lysing colistin-resistant E. coli of various animal origins. We characterized Escherichia phage vB_EcoStr-FJ63A and evaluated its bactericidal activity.

2. Materials and methods

2.1. Strains, culture conditions and antibiotic susceptibility testing

All E. coli strains used in this study were isolated from feces and intestinal samples collected from farms and pet hospitals in several provinces. The quality control strain ATCC 25,922 was provided by the China center of industrial culture collection (CICC). After bacterial isolation through MacConkey agar and eosin-methylene blue agar medium (Qingdao Hope Bio-Technology Co., Ltd., HB6238 and HB0107), isolates were identified by PCR. The genomes of isolates were extracted using an EasyPure® Genomic DNA Kit (TransGen) as per the manufacturer's instructions. The primers F (5′ AGAGTTTGATCATGGCTCAG 3′) and R (5′ TACGGTTACCTTGTTACGACTT 3′) were used for identification of the 16S rDNA gene. PCR was performed with an initial denaturation at 95 ℃ for 30 min, followed by 30 cycles of 95 ℃ for 30 s, 56 ℃ for 30 s and 72 ℃ for 90 s. All E. coli strains were cultured in Luria-Bertani (LB) broth at 37 ℃ and stored at −80 ℃ with 30% glycerol. Minimum inhibitory concentrations (MICs) of colistin were determined by broth microdilution according to the guidelines of the Clinical and Laboratory Standards Institute (CLSI, 2021). Resistance to colistin was defined as an MIC ≥4 μg/mL (CLSI, 2021). The screened resistant bacteria (MIC ≥ 4 μg/mL) were used to isolate bacteriophage and determine the host range.

2.2. Phage isolation, purification

Samples including sewage, feces, anal swabs and soil were collected from pig farms in Fujian Province, China. The leachate and sewage were centrifuged for 10 min at 12,000 g and 4 ℃, then the supernatant filtered through a 0.22 μm filter. To enrich possible phages, 100 μL of E. coli overnight culture (Table S1) and 1 ml of filtrate were mixed in 900 μL LB broth and incubated overnight at 37 ℃ with shaking (180 rpm). The obtained phage lysate was centrifuged (12,000 g for 10 min at 4 ℃) and the supernatant containing phages was collected and filtered through a 0.22 µm filter. The filtrate was analysed for the presence of phage through the change of OD600nm values during the growth of E. coli. Briefly, 2 μL overnight cultures were mixed with 20 μL filtrate in 180 μL LB broth, then incubated at 37 ℃ and OD values were determined at 0, 4, 6, 24 h respectively. The purification was performed by double-layer agar method 3–5 times. In brief, 100 µL of phage suspension was mixed with 100 µL of host strain in 5 mL soft agar. The mixture was immediately poured into petri dishes (90 mm) containing LB agar and incubated at 37 ℃ overnight. Single plaque was picked from the plate with a sterile pipette tip and resuspended in SM buffer for amplification. The phage vB_EcoStr-FJ63A was cultured with host strain E. coli 63 in LB-agar plates and extracted with SM buffer. The purified phage vB_EcoStr-FJ63A was stored in SM buffer at 4 ℃.

2.3. Transmission electron microscopy (TEM) of phage vB_EcoStr-FJ63A

For phage morphological observation, the purified phage vB_EcoStr-FJ63A was precipitated using polyethylene glycol (10% [w/v] PEG8000 in 1 mol/L NaCl) at 4 ℃ for 2 h and centrifuged at 11,000 g for 10 min at 4 °C. High purity phage was collected after the resuspension in SM buffer. Then, a drop of 10 μL of phage concentrate (109 PFU/mL) was deposited on a copper mesh grid surface for 15 min and stained with 1% (w/v) uranyl acetate for 2 min. The morphology of the phage was observed by transmission electron microscopy (JEM-1400, Tokyo, Japan) at 80 kV.

2.4. Host range determination of phage vB_EcoStr-FJ63A

First, an OD-based turbidimetric method (OD600nm) was used to determine whether phage vB_EcoStr-FJ63A was bacteriostatic against 95 colistin-resistant E. coli strains collected from different sources. Briefly, E. coli strains were grown overnight at 37 °C in LB broth using a 96-well plate with a lid. Overnight cultures were added to a new plate with 180 μL LB broth by disposable inoculator assembly for 96-well plates. The control groups, which contained only bacteria, and the experimental groups, in which 20 µL of purified phage (107 PFU/mL). The plate was incubated for 24 h and OD600nm readings taken at 0, 2, 4, 6, 8, 10, 12 and 24 h to assess the growth of bacterial control culture and bacterial culture treated with phage. Then, the strains whose growth were inhibited were selected for the spot inoculation test. In brief, 100 μL of bacterial culture in the logarithmic growth phase was added to molten LB agar medium. After agar solidification, 5 μL of phage (107 PFU/mL) was spotted on each surface. Plates were left to dry and then incubated overnight at 37 ℃. The appearance of lytic zones was analyzed for the host range.

2.5. One-step growth curve of phage vB_EcoStr-FJ63A

One-step growth experiments were performed as previously described with minor modifications (Kropinski, 2018). Briefly, host strain E. coli 63 was grown at 37 °C to early exponential phase (OD600nm = 0.45–0.55) and diluted to 108 CFU/mL with LB broth. Phage vB_EcoStr-FJ63A was diluted to 106 PFU/mL with LB broth. Then, 150 μL of diluted phage and 150 μL of diluted bacterial culture were mixed in 1.2 mL LB broth at multiplicity of infection (MOI) = 1 and incubated at 37 ℃ for 5 min. The mixture was centrifuged for 1 min at 14,000 g and 4 ℃ after which the supernatant was removed and the pellet resuspended with the same amount of LB broth to remove unabsorbed phage. The suspension was diluted 1:10 with fresh LB broth and incubated at 37 ℃ with shaking (180 rpm). Then, 100 μL of samples were taken at different times to determine the phage titer by using the double layer agar plate method as described previously. The experiment was repeated three times.

2.6. Time–kill kinetics

The bactericidal activity of phage vB_EcoStr-FJ63A was examined by time-kill experiments. First, host strain E. coli 63 was grown at 37 ℃ to early exponential phase (OD600nm = 0.45–0.55) and diluted to 107 CFU/ml with LB broth. Phage vB_EcoStr-FJ63A was diluted to different concentrations (105–109 PFU/mL) with LB broth Then, similar to one-step growth experiments (Section 2.5), phage vB_EcoStr-FJ63A and diluted bacterial culture were mixed in LB broth with different MOIs (MOI=100, 10, 1, 0.1, 0.01). The control group contained only bacteria. The mixtures were incubated at 37 ℃ with shaking (180 rpm) and 100 μL of samples taken at 0, 1, 2, 4, 6, 8 and 24 h. Samples were serially diluted 10-fold with LB broth and manually plated onto LB agar to quantify viable bacteria. Time-kill experiment were performed in triplicate and repeated twice.

2.7. Thermal and pH stability of phage vB_EcoStr-FJ63A

For the thermal stability, phage vB_EcoStr-FJ63A was diluted into multiple 1 mL of aliquots with SM buffer (106 PFU/mL). Aliquots were respectively placed in water bath and incubated at different temperatures (4, 25, 40, 50, 60, 70, 80 and 90 ℃) for 60 min. In order to reduce the change of pH during pH stability testing, 0.1 ml of phage vB_EcoStr-FJ63A (107 PFU/mL) were added to 9.9 ml of different pH SM buffers (pH 2–12) for 60 min at 25 ℃. The phage titers of two stability tests were measured by the double-layer agar method at 30 min and 60 min, respectively.

2.8. Genome sequencing and bioinformatic analysis

For phage genome extraction, DNase I and RNase A were added to phage concentrate to a final concentration of 10 μg/mL and 50 μg/mL, and incubated at 37 ℃ for 30 min to remove genomic contaminants. Phage suspensions were then treated with 20% sodium dodecyl sulfate (SDS) and proteinase K and further incubated for 30 min at 37 ℃. Sample was extracted with phenol: chloroform: isoamyl alcohol (25:24:1), and the separated aqueous phase was further extracted with chloroform: isoamyl alcohol (24:1). 3 M sodium acetate (pH 5.2) and isopropanol were added to the separated aqueous phase to precipitate DNA. The solution was centrifuged for 20 min at 14,000 g and 4 ℃ and the DNA pellet washed twice with 70% ethanol prior to drying. Finally, DNA was resuspended with TE buffer and stored at −80 ℃.

The phage DNA was sequenced on an Illumina NovaSeq 6000 system and assembled by MEGAHIT (Sinobiocore Biotechnology Co., Ltd, Beijing, China). The complete genome sequence of phage was annotated using RAST (Aziz et al., 2008; Brettin et al., 2015; Overbeek et al., 2014) and Prokka (version 1.14.6) (Seemann, 2014). Putative tRNA genes were predicted using tRNA scan-SE (version 2.0) (Chan et al., 2021). Non-coding RNA genes were predicted by Rfam (version 14.8) (Kalvari et al., 2018). The presence of virulence genes and antibiotic resistance genes in the complete genome was screened in Virulence Factor Database (VFDB) (Zheng et al., 2020) and Comprehensive Antibiotic Resistance Database (CARD) (Alcock et al., 2020). Similar genomes were searched in the NCBI nucleotide collection (nr/nt) by BLASTn (Altschul et al., 1990), and the average nucleotide identity (ANI) of all genomes calculated using fastANI (Goris et al., 2007). A whole-genome phylogenetic tree was constructed via VICTOR (Meier-Kolthoff and Goker, 2017) and visualized via iTOL (Letunic and Bork, 2021). The pan-genome of the genus to which the phage belongs was analyzed by Roary (version 3.13.0) (Page et al., 2015) and visualized by Phandango (version 1.3.0) (Hadfield et al., 2018).

As previously mentioned, the genomes of host strains were extracted using an EasyPure® Genomic DNA Kit (TransGen). Bacterial DNA was sequenced on an Illumina NovaSeq 6000 system (Annoroad Gene Technology Co., Ltd, Beijing, China). The de novo genome assembly of bacteria was performed by SPAdes (version 3.13.0) (Prjibelski et al., 2020). Staramr was used to identify antibiotic resistance genes and multi locus sequence typing (MLST) (Bharat et al., 2022). Serotype was identified by ECTyper (Bessonov et al., 2021).

3. Results and discussion

3.1. Isolation and morphology of phage vB_EcoStr-FJ63A

Escherichia phage vB_EcoStr-FJ63A was isolated from a fecal sample of a pig farm in Longyan of Fujian Province. It was able to lyse the host strain (E. coli isolate 63) and form plaques of approximately 1 mm in diameter (Fig. 1A). TEM results showed that phage vB_EcoStr-FJ63A had an icosahedral capsid with a length of 111.1 ± 3.4 nm and an inflexible tail of 120.4 ± 2.2 nm. A ring-like structure of 31.2 ± 3.0 nm in length was located in the neck, and a baseplate with a similar length at the end of tail (Fig. 1B). These structural characteristics are similar to phage T4 (Krylov et al., 2021; Leiman et al., 2010).

Fig. 1.

Fig 1

Open in a new tab

Escherichia phage vB_EcoStr-FJ63A. (A) Plaques formed on the lawn of E. coli isolate 63; (B) transmission electron micrograph of phage vB_EcoStr-FJ63A.

3.2. Host range of phage vB_EcoStr-FJ63A

A total of 92 colistin-resistant E. coli strains were collected from different sources and used to evaluate the host range of phage vB_EcoStr-FJ63A (Table S1). Growth as measured by OD600nm readings demonstrated that 23 strains were inhibited by phage vB_EcoStr-FJ63A. Further spot testing showed 21 of these 23 strains could be lysed and form plaques on the surface of agar plates (Table 1). Whole genome sequencing and bioinformatic analysis of the 23 strains showed that they belonged to several different STs and had multiple serotypes (Table 1). These results indicate that phage vB_EcoStr-FJ63A could lyse multiple strains of colistin-resistant E. coli collected from a variety of areas and sources. Interestingly, some of these host strains belonged to the same STs, but their serotypes were different. We speculated that phage could infect bacteria with the same STs. It meant that we may be able to determine the dominant STs of bacteria in a particular area through the epidemiological survey of bacteria and use phages that can lyse the bacteria of dominant STs, thus increasing the success rate of phage therapy in veterinary clinic. Additionally, these bacterial strains contained a wide variety of antibiotic-resistant genes, indicating that lysis of phage vB_EcoStr-FJ63A was not affected by these antibiotic-resistant genes. It proved that phage can be used as a means to fight against MDR bacteria. It is worth noting that for strains DFH23 and DFH24, bacterial growth (as determined by culture OD values) increased across the first 2 h following addition of phage vB_EcoStr-FJ63A. The OD values subsequently remained stable across 4–24 h and were significantly lower than that of the untreated control groups. However, phage vB_EcoStr-FJ63A did not form plaques on these two strains in the spot test. It is possible that phage vB_EcoStr-FJ63A could infect and lyse strains DFH23 and DFH24, but the lysis efficiency was not enough to form plaques. Spot test is a traditional method to evaluate the host range of phage. While DFH23 and DFH24 were not the hosts of phage vB_EcoStr-FJ63A in the traditional sense, the inhibiting effect of phage vB_EcoStr-FJ63A on these strains suggests that the antibacterial spectrum of this phage may be wider than suggested here.

Table 1.

Lytic spectrum of phage vB_EcoStr-FJ63A.

Strain Antibacterial Activity Spot test ST Serotype Antibiotic-resistant genes
63 + + 189 O8:H21 aac(3)-IV, aac(6′)-Ib-cr, aadA1, aadA2, aadA8b, aph(3′)-Ia, aph(4)-Ia, blaCTX-M-65, blaNDM-5, blaOXA-1, mcr-1.1, fosA3, mdf(A), mph(A), catB3, floR, ARR-3, sul1, sul3, tet(B), dfrA12
79 + + 206 O43:H5 aac(3)-IV, aadA2, aph(3′')-Ib, aph(3′)-Iia, aph(4)-Ia, aph(6)-Id, rmtB, blaCTX-M-132, blaTEM-1B, mcr-1.1, fosA3, mdf(A), mph(A), floR, oqxA, oqxB, sul1, sul2, tet(A), dfrA12
89 + + 189 O8:H21 aac(3)-IV, aac(6′)-Ib-cr, aadA1, aadA2, aadA8b, aph(3′)-Ia, aph(4)-Ia, blaCTX-M-65, blaNDM-5, blaOXA-1, mcr-1.1, fosA3, mdf(A), mph(A), catB3, floR, ARR-3, sul1, sul3, tet(B), dfrA12
92 + + 189 O8:H21 aac(3)-IV, aac(6′)-Ib-cr, aadA1, aadA2, aadA8b, aph(3′)-Ia, aph(4)-Ia, blaCTX-M-65, blaNDM-5, blaOXA-1, mcr-1.1, fosA3, mdf(A), mph(A), catB3, floR, ARR-3, sul1, sul3, tet(B), dfrA12
DFH23 + – 6311* -:H5 aac(3)-IId, aadA1, aadA2, aph(3′)-Ia, blaCTX-M-55, bleO, cmlA1, dfrA12, erm(B), fosA3, mcr-1.1, mef(B), mph(A), OqxA, OqxA, OqxB, OqxB, sul3, tet(A), tet(M)
DFH24 + – 2055* -:H5 aac(3)-IId, aadA1, aadA2, aph(3′)-Ia, blaCTX-M-55, bleO, cmlA1, dfrA12, erm(B), fosA3, mcr-1.1, mef(B), mph(A), OqxA, OqxA, OqxB, OqxB, sul3, tet(A), tet(M)
EC15 + + 101 O29:H31 tet(A), aph(3′')-Ib, aph(6)-Id, dfrA14, fosA3, blaTEM-141, blaTEM-206, blaTEM-214, blaTEM-1B, blaTEM-209, blaCTX-M-55, sitABCD, mdf(A), sul2, mcr-1.1
EC19 + + 206 -:H5 aadA2, aph(3′')-Ib, aph(3′)-IIa, aph(6)-Id, blaCTX-M-132, blaTEM-1B, dfrA12, floR, fosA3, mcr-1.1, mph(A), OqxA, OqxA, OqxB, OqxB, qacE, rmtB, sul1, sul2, tet(A)
EC21 + + 101 O29:H31 aph(3′')-Ib, aph(6)-Id, blaCTX-M-55, blaTEM-214, dfrA14, fosA3, mcr-1.1, sitABCD, sul2, tet(A)
EC23 + + 101 O29:H31 aph(3′')-Ib, aph(6)-Id, blaCTX-M-55, blaTEM-214, dfrA14, fosA3, mcr-1.1, sitABCD, sul2, tet(A)
G16 + + 48 O113:H32 aac(3)-IV, aadA2, aadA22, aph(3′')-Ib, aph(3′)-Ia, aph(3′)-IIa, aph(4)-Ia, aph(6)-Id, ARR-3, blaCTX-M-55, blaOXA-10, blaTEM-70, cmlA1, dfrA1, dfrA12, dfrA14, floR, fosA3, lnu(F), mph(A), OqxA, OqxA, OqxB, OqxB, qacE, qnrS1, rmtB, sul1, tet(A)
HN21 + + 9373 O127:H29 aadA1, aadA2, aph(3′')-Ib, aph(3′)-Ia, aph(6)-Id, blaTEM-1C, cmlA1, dfrA12, erm(B), floR, mcr-1.1, mph(A), sul2, sul3, tet(A)
HN25 + + 117 O143:H4 aadA5, aph(3′')-Ib, aph(6)-Id, dfrA17, erm(B), floR, mcr-1.1, mph(A), qacE, sitABCD, sul1, sul2, tet(A)
RN13 + + 75 O112:H8 aadA1, aadA2, aph(3′)-Ia, cmlA1, dfrA12, mcr-1.1, mef(B), sul3, tet(A)
RN18 + + 189 O38:H26 aadA1, aadA2, aph(3′')-Ib, aph(6)-Id, blaCTX-M-55, blaLAP-2, blaTEM-214, cmlA1, dfrA12, dfrA14, mcr-1.1, qnrS1, sitABCD, sul2, sul3, tet(A)
RN19 + + 189 O38:H26 aadA1, aadA2, aph(3′')-Ib, aph(6)-Id, blaCTX-M-55, blaLAP-2, blaTEM-214, cmlA1, dfrA12, dfrA14, mcr-1.1, qnrS1, sitABCD, sul2, sul3, tet(A)
RN20 + + 189 O38:H26 aadA1, aadA2, aph(3′')-Ib, aph(6)-Id, blaCTX-M-55, blaLAP-2, blaTEM-214, cmlA1, dfrA12, dfrA14, mcr-1.1, qnrS1, sitABCD, sul2, sul3, tet(A)
RN21 + + 189 O38:H26 aadA1, aadA2, aph(3′')-Ib, aph(6)-Id, blaCTX-M-55, blaLAP-2, blaTEM-214, cmlA1, dfrA12, dfrA14, mcr-1.1, qnrS1, sitABCD, sul2, sul3, tet(A)
RN23 + + 8318 O1:H19 aac(3)-IId, aadA2, aph(3′')-Ib, aph(3′)-Ia, aph(6)-Id, blaCTX-M-55, blaCTX-M-65, blaTEM-214, dfrA12, floR, mcr-1.1, mph(A), qacE, sul1, sul2, sul3, tet(A), tet(M)
RN24 + + 2847 -:H31 aac(3)-IV, aph(4)-Ia, blaCTX-M-65, blaTEM-1B, fosA3, mcr-1.1
RN27 + + 189 O38:H26 aadA1, aadA2, aph(3′')-Ib, aph(6)-Id, blaCTX-M-55, blaLAP-2, blaTEM-214, cmlA1, dfrA12, dfrA14, qnrS1, sitABCD, sul2, sul3, tet(A)
RN28 + + 189 O38:H26 aadA1, aadA2, aph(3′')-Ib, aph(6)-Id, blaCTX-M-55, blaLAP-2, blaTEM-214, cmlA1, dfrA12, dfrA14, mcr-1.1, qnrS1, sitABCD, sul2, sul3, tet(A)
W159 + + 189 O38:H26 aadA1, aadA2, aph(3′')-Ib, aph(6)-Id, blaCTX-M-55, blaLAP-2, blaTEM-214, cmlA1, dfrA12, dfrA14, qnrS1, sitABCD, sul2, sul3, tet(A)
Open in a new tab

(+), positive result (inhibition of bacterial growth or plaque producing); (-), negative result (no effect on bacterial growth or no plaques); (*), novel strain, ST may indicate nearest ST.

3.3. Biological characteristics of phage vB_EcoStr-FJ63A

One-step growth experiments were performed for 60 min (Fig. 2A). The one-step growth curve showed that the latent period was about 30 min, and the calculated burst size was about 11 PFU per infected cell. These results were approximate to the characteristics of T4-like phage HY01 which can infect E. coli O157:H7 (Lee et al., 2016).

Fig. 2.

Fig 2

Open in a new tab

Biological characteristics of phage vB_EcoStr-FJ63A. (A) One-step growth curve; (B) thermal stability; (C) pH stability. Results are shown as mean ± SD (n = 3).

As shown in Fig. 2B, phage vB_EcoStr-FJ63A was relatively stable at 50 ℃ and below. At 60 ℃ the titer of phage vB_EcoStr-FJ63A decreased significantly within 30 min. At 70 ℃, no phage was detected at 30 min and 60 min. pH stability testing showed that phage vB_EcoStr-FJ63A was relatively stable at pH 4–10. However, titers of phage vB_EcoStr-FJ63A significantly decreased with pH values either side of this range, with no phage detected at a pH of 2 (Fig. 2C). The results were valuable to consider for the administration through the oral route of phage therapy on animals. The acidic environment of gastrointestinal tract makes phage vB_EcoStr-FJ63A need to be encapsulated in liposomes or alginate to improve the survival rate of oral administration (Malik et al., 2017; Pinto et al., 2021).

3.4. Time-Kill kinetics

The time-kill studies showed that phage vB_EcoStr-FJ63A demonstrated bactericidal activity against host strain E. coli 63 (Fig. 3). While the onset of killing (i.e., at 1 h) occurred most rapidly with the two highest MOIs (10 and 100), maximal killing was achieved at 2 h and was greatest with an MOI of 1, 0.1 and 0.01 for which almost no viable colonies were detected. Regrowth occurred at all MOIs after this time but remained significantly below the control group at 24 h (p < 0.05). These results indicated that phage vB_EcoStr-FJ63A requires MOI > 100 to kill bacteria more quickly and completely, but it might be challenging to achieve a large enough dose of phage around bacteria during the clinical treatment. When 1 < MOI <100, the bacteria could not be completely removed and the surviving bacteria would grow to a higher concentration. In contrast, when MOI ≤ 1, phage vB_EcoStr-FJ63A showed better bactericidal effect via in situ phage replication. Compared with antibiotics, phage therapy is unique and complex. Therefore, more research on phage pharmacology is needed to optimize phage therapy.

Fig. 3.

Fig 3

Open in a new tab

Time-kill kinetics of phage vB_EcoStr-FJ63A against the host strain E. coli 63 at MOI=100, 10, 1, 0.1, 0.01 respectively. Results are shown as mean ± SD (n = 6).

3.5. Phage vB_EcoStr-FJ63A genomic characteristics and taxonomy

The complete genome of phage vB_EcoStr-FJ63A was a double-stranded DNA with 168,157 bp in length, with a GC content of 40.29%. A total of 271 coding sequences (CDS) were identified in the genome, of which 38.4% (104/271) were predicted to be functional proteins. However, more than half of all CDSs were predicted to be hypothetical proteins or phage proteins with unknown functions. A circular gene map with the gene annotations of phage vB_EcoStr-FJ63A was visualized by Proksee (Stothard and Wishart, 2005) (Fig. 4). The results of tRNAscan-SE and Rfam showed that there were no tRNA genes and ncRNA in the genome. Although the host strain E. coli 63 contains antibiotic-resistant genes, no antibiotic-resistant genes and virulence genes were found in the phage genome.

Fig. 4.

Fig 4

Open in a new tab

Genome map and functional protein identity of phage vB_EcoStr-FJ63A. The arrows indicate the direction of transcription of each gene.

The result of BLASTn showed that phage vB_EcoStr-FJ63A has high identity with 27 phages which belong to Krischvirus (94.30%−97.94%) (Table S2). Phylogenetic analysis of VICTOR showed that OPTSIL clustering yielded one cluster at the genus level and one cluster at the family level (Fig. 5). At the species level, vB_EcoStr-FJ63A belonged to a separate cluster. The ANIs between vB_EcoStr-FJ63A and other phages of Krischvirus also proved that vB_EcoStr-FJ63A was unique. These results revealed that phage vB_EcoStr-FJ63A is a new member of Krischvirus in the family Straboviridae. In 2021, ICTV removed the order Caudovirales and families Myoviridae, Podoviridae and Siphoviridae (Turner et al., 2021). Straboviridae is one of several newly created families which sit directly below the class Caudoviricetes.

Fig. 5.

Fig 5

Open in a new tab

Phylogenetic tree and matrix of average nucleotide identity based on the whole-genome sequences of vB_EcoStr-FJ63A and other Krischvirus phages using VICTOR and fastANI. Minimum fraction, kmer size and fragment length were set as default.

3.6. Comparative genomics of Krischvirus phages

Through Roary analysis, the full spectrum of Krischvirus pan-genome contains 639 protein coding genes which includes 105 core genes (99% < = strains < = 100%), 26 soft core genes (95% < = strains < 99%), 201 shell genes (15% < = strains < 95%), and 307 cloud genes (0% < = strains < 15%), of which 176 cloud genes are unique genes (Fig. 6A). The core and pan-genome structure of Krischvirus showed that with the increase of the number of genomes, the number of core genes continues to decline (Fig. 6B). At the same time, new genes are found at a relatively stable rate, and the total number of genes has not reached the platform stage. These indicate that the pan-genome of Krischvirus is openness.

Fig. 6.

Fig 6

Open in a new tab

(A) Phylogenetic tree of core genes and matrix with the pan genome of Krischvirus, visualized by uploading the output files of Roary to Phandango; (B) variations of the conserved genes and total genes as genomes are added, created by an additional script of Roary.

The function prediction results showed that most lysis related proteins were core genes including holin, spanin Rz, outer membrane lipoprotein Rz1 and phage lysozyme R. Phage lysozyme R is a baseplate central spike complex protein involved with penetrating the outer membrane of bacteria and locally dissolving the periplasmic cell wall (Arisaka et al., 2003). These core genes suggested that members of Krischvirus adopt the same lytic strategy (Young, 2014). At the same time, these core genes also meant that the lysis related proteins they encode could act on a variety of Enterobacterales bacteria (Table S2). The direct use of these phage-encoded lytic proteins as new antibacterial agents may be an effective way to avoid the limitation of phage specificity (Chang et al., 2022). The pan-genome analysis of Kirschvirus showed that holin and spanin were core genes. Putative endolysin was recognized in some Krischvirus phages. These results indicated that Krischvirus phages use a holin-endolysin-spanin lysis model, while endolysin was not conserved. The endolysin was not detected in the genome of vB_EcoStr-FJ63A by RAST and Prokka. Therefore, it is very likely that vB_EcoStr-FJ63A encodes a novel endolysin that has not been discovered.

Thirteen genes in genome of phage vB_EcoStr-FJ63A were identified as unique genes, with the functions of only three genes successfully predicted. They respectively encode the phage tail fiber, phage baseplate tail-tube junction protein gp48, and phage baseplate tail-tube junction protein gp54. BLASTp results showed that the tail fiber was 74.72%−92.95% consistent with only 11 Krischvirus members. The tail fiber is closely related to host specificity (Chen et al., 2017; Hyman and van Raaij, 2018; Yehl et al., 2019). This is one reason why the hosts of phage vB_EcoStr-FJ63A are different from that of other Krischvirus members (Table S2). Two other unique genes with known functions were located in a region full of cloud genes. Interestingly, these genes were both associated with the baseplate, including the baseplate hub and wedge subunits. Previous research of morphogenesis of the T4 tail and tail fibers has demonstrated that the conformational change of the baseplate and contraction of the tail are related to the tail's host cell recognition and membrane penetration function (Leiman et al., 2010). This indicates that in addition to tail fibers, phage vB_EcoStr-FJ63A also recognizes hosts different from other Krischvirus members through a unique baseplate which has adapted to survival in different environments.

4. Conclusions

We isolated and identified a new member of the genus Krischvirus with activity against colistin-resistant E. coli from various animals. Phage vB_EcoStr-FJ63A recognize hosts different from other Krischvirus phages via a unique tail fiber and baseplate. Further studies are warranted to develop phage vB_EcoStr-FJ63A as a potential biocontrol agent against colistin-resistant E. coli.

CRediT authorship contribution statement

Tianshi Xiao: Conceptualization, Methodology, Formal analysis, Data curation, Writing – original draft, Visualization. Xiaolin Zhu: Validation, Investigation. Wenhui Wang: Resources, Investigation. Xuchen Jia: Investigation. Changmei Guo: Resources. Xue Wang: Resources. Zhihui Hao: Supervision, Project administration, Funding acquisition, Writing – review & editing.

Declaration of Competing Interest

The authors declare no conflict of interest.

Acknowledgments

This work was supported by the Key Project at Central Government Level (No. 2060302) and National Natural Science Foundation of China (No.32172897). The authors thank Professor Jian Li, Drs Sue Nang, Yan Zhu and Phillip Bergen at Monash University for scientific discussions and comments on experimental methods, bioinformatics analysis and English.

Footnotes

Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.virusres.2023.199090.

Appendix. Supplementary materials

mmc1.docx (26.1KB, docx)

Data availability

  • Data will be made available on request.

References

  1. Alcock, et al. CARD 2020: antibiotic resistome surveillance with the comprehensive antibiotic resistance database. Nucleic. Acids. Res. 2020;48(D1):D517–D525. doi: 10.1093/nar/gkz935. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Altschul, et al. Basic local alignment search tool. J. Mol. Biol. 1990;215(3):403–410. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
  3. Arisaka, et al. The tail lysozyme complex of bacteriophage T4. Int. J. Biochem. Cell Biol. 2003;35(1):16–21. doi: 10.1016/s1357-2725(02)00098-5. [DOI] [PubMed] [Google Scholar]
  4. Aziz, et al. The RAST server: rapid annotations using subsystems technology. BMC Genomics. 2008;9:75. doi: 10.1186/1471-2164-9-75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Barros, et al. Lytic bacteriophages against multidrug-resistant Staphylococcus aureus, Enterococcus faecalis and Escherichia coli isolates from orthopaedic implant-associated infections. Int. J. Antimicrob. Agents. 2019;54(3):329–337. doi: 10.1016/j.ijantimicag.2019.06.007. [DOI] [PubMed] [Google Scholar]
  6. Bessonov, et al. ECTyper: in silico Escherichia coli serotype and species prediction from raw and assembled whole-genome sequence data. Microb. Genom. 2021;7(12) doi: 10.1099/mgen.0.000728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bharat, et al. Correlation between phenotypic and in silico detection of antimicrobial resistance in salmonella enterica in canada using staramr. Microorganisms. 2022;10(2) doi: 10.3390/microorganisms10020292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Brettin, et al. RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes. Sci. Rep. 2015;5:8365. doi: 10.1038/srep08365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Casey, et al. In vitro characteristics of phages to guide 'real life' phage therapy suitability. Viruses. 2018;10(4) doi: 10.3390/v10040163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chan, et al. tRNAscan-SE 2.0: improved detection and functional classification of transfer RNA genes. Nucleic. Acids. Res. 2021;49(16):9077–9096. doi: 10.1093/nar/gkab688. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chang Kim. Comparative genomic analysis of bacteriophage EP23 infecting Shigella sonnei and escherichia coli. J. Microbiol. 2011;49(6):927–934. doi: 10.1007/s12275-011-1577-0. [DOI] [PubMed] [Google Scholar]
  12. Chang, et al. Novel antimicrobial agents for combating antibiotic-resistant bacteria. Adv. Drug. Deliv. Rev. 2022;187 doi: 10.1016/j.addr.2022.114378. [DOI] [PubMed] [Google Scholar]
  13. Chegini, et al. Bacteriophage therapy for inhibition of multi drug-resistant uropathogenic bacteria: a narrative review. Ann. Clin. Microbiol. Antimicrob. 2021;20(1):30. doi: 10.1186/s12941-021-00433-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Chen, et al. Inducible prophage mutant of escherichia coli can lyse new host and the key sites of receptor recognition identification. Front. Microbiol. 2017;8:147. doi: 10.3389/fmicb.2017.00147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. CLSI, 2021. Performance standards for antimicrobial susceptibility testing. M100-S31. http://em100.edaptivedocs.net/dashboard.aspx. [DOI] [PMC free article] [PubMed]
  16. Dion, et al. Phage diversity, genomics and phylogeny. Nat. Rev. Microbiol. 2020;18(3):125–138. doi: 10.1038/s41579-019-0311-5. [DOI] [PubMed] [Google Scholar]
  17. Evran, et al. Investigation of phage and molasses interactions for the biocontrol of E. coli O157:H7. Can. J. Microbiol. 2021:1–11. doi: 10.1139/cjm-2021-0211. [DOI] [PubMed] [Google Scholar]
  18. Farfan-Garcia, et al. Virulence mechanisms of enteropathogenic escherichia coli. Rev. Chilena Infectol. 2016;33(4):438–450. doi: 10.4067/S0716-10182016000400009. [DOI] [PubMed] [Google Scholar]
  19. Goris, et al. DNA-DNA hybridization values and their relationship to whole-genome sequence similarities. Int. J. Syst. Evol. Microbiol. 2007;57(Pt 1):81–91. doi: 10.1099/ijs.0.64483-0. [DOI] [PubMed] [Google Scholar]
  20. Gregoire, et al. Clinical pharmacokinetics and pharmacodynamics of colistin. Clin. Pharmacokinet. 2017;56(12):1441–1460. doi: 10.1007/s40262-017-0561-1. [DOI] [PubMed] [Google Scholar]
  21. Gyles Shiga toxin-producing escherichia coli: an overview. J. Anim. Sci. 2007;85(13 Suppl):E45–E62. doi: 10.2527/jas.2006-508. [DOI] [PubMed] [Google Scholar]
  22. Hadfield, et al. Phandango: an interactive viewer for bacterial population genomics. Bioinformatics. 2018;34(2):292–293. doi: 10.1093/bioinformatics/btx610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Hussein, et al. Mobilized colistin resistance (mcr) genes from 1 to 10: a comprehensive review. Mol. Biol. Rep. 2021;48(3):2897–2907. doi: 10.1007/s11033-021-06307-y. [DOI] [PubMed] [Google Scholar]
  24. Hyman van Raaij. Bacteriophage T4 long tail fiber domains. Biophys. Rev. 2018;10(2):463–471. doi: 10.1007/s12551-017-0348-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Inokuchi, et al. The complete nucleotide sequence of the group II RNA coliphage GA. J. Biochem. 1986;99(4):1169–1180. doi: 10.1093/oxfordjournals.jbchem.a135580. [DOI] [PubMed] [Google Scholar]
  26. Jamal, et al. Bacteriophages: an overview of the control strategies against multiple bacterial infections in different fields. J. Basic Microbiol. 2019;59(2):123–133. doi: 10.1002/jobm.201800412. [DOI] [PubMed] [Google Scholar]
  27. Kalvari, et al. Non-coding RNA analysis using the Rfam database. Curr. Protoc. Bioinformatics. 2018;62(1):e51. doi: 10.1002/cpbi.51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kim, et al. Genomic analysis of bacteriophage PBECO4 infecting Escherichia coli O157:H7. Arch. Virol. 2013;158(11):2399–2403. doi: 10.1007/s00705-013-1718-3. [DOI] [PubMed] [Google Scholar]
  29. Kropinski Practical advice on the one-step growth curve. Methods Mol. Biol. 2018;1681:41–47. doi: 10.1007/978-1-4939-7343-9_3. [DOI] [PubMed] [Google Scholar]
  30. Krylov, et al. Phage phiKZ-the first of giants. VirusesViruses. 2021;13(2) doi: 10.3390/v13020149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Lee, et al. Characterization and genomic study of the novel bacteriophage HY01 infecting both escherichia coli O157:H7 and shigella flexneri: potential as a biocontrol agent in food. PLoS ONE. 2016;11(12) doi: 10.1371/journal.pone.0168985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Leiman, et al. Morphogenesis of the T4 tail and tail fibers. Virol J. 2010;7:355. doi: 10.1186/1743-422X-7-355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Letunic Bork. Interactive Tree Of Life (iTOL) v5: an online tool for phylogenetic tree display and annotation. Nucleic. Acids. Res. 2021;49(W1):W293–W296. doi: 10.1093/nar/gkab301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Liu, et al. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study. Lancet Infect. Dis. 2016;16(2):161–168. doi: 10.1016/S1473-3099(15)00424-7. [DOI] [PubMed] [Google Scholar]
  35. Malik, et al. Formulation, stabilisation and encapsulation of bacteriophage for phage therapy. Adv. Colloid Interface Sci. 2017;249:100–133. doi: 10.1016/j.cis.2017.05.014. [DOI] [PubMed] [Google Scholar]
  36. Meier-Kolthoff Goker. VICTOR: genome-based phylogeny and classification of prokaryotic viruses. Bioinformatics. 2017;33(21):3396–3404. doi: 10.1093/bioinformatics/btx440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Overbeek, et al. The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST) Nucleic. Acids. Res. 2014;42:D206–D214. doi: 10.1093/nar/gkt1226. Database issue. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Page, et al. Roary: rapid large-scale prokaryote pan genome analysis. Bioinformatics. 2015;31(22):3691–3693. doi: 10.1093/bioinformatics/btv421. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Palmela, et al. Adherent-invasive Escherichia coli in inflammatory bowel disease. GutGut. 2018;67(3):574–587. doi: 10.1136/gutjnl-2017-314903. [DOI] [PubMed] [Google Scholar]
  40. Pinto, et al. The clinical path to deliver encapsulated phages and lysins. FEMS Microbiol. Rev. 2021;45(5) doi: 10.1093/femsre/fuab019. [DOI] [PubMed] [Google Scholar]
  41. Poirel, et al. Antimicrobial resistance in escherichia coli. Microbiol. Spectr. 2018;6(4) doi: 10.1128/microbiolspec.arba-0026-2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Prjibelski, et al. Using SPAdes De Novo assembler. Curr. Protoc. Bioinformatics. 2020;70(1):e102. doi: 10.1002/cpbi.102. [DOI] [PubMed] [Google Scholar]
  43. Salazar, et al. Antiviral resistance and phage counter adaptation to antibiotic-resistant extraintestinal pathogenic escherichia coli. MBio. 2021;12(2) doi: 10.1128/mBio.00211-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Scallan, et al. Foodborne illness acquired in the United States–major pathogens. Emerg. Infect. Dis. 2011;17(1):7–15. doi: 10.3201/eid1701.P11101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Seemann Prokka: rapid prokaryotic genome annotation. Bioinformatics. 2014;30(14):2068–2069. doi: 10.1093/bioinformatics/btu153. [DOI] [PubMed] [Google Scholar]
  46. Stothard Wishart. Circular genome visualization and exploration using CGView. Bioinformatics. 2005;21(4):537–539. doi: 10.1093/bioinformatics/bti054. [DOI] [PubMed] [Google Scholar]
  47. Sun, et al. Towards understanding MCR-like colistin resistance. Trends Microbiol. 2018;26(9):794–808. doi: 10.1016/j.tim.2018.02.006. [DOI] [PubMed] [Google Scholar]
  48. Turner, et al. A roadmap for genome-based phage taxonomy. VirusesViruses. 2021;13(3) doi: 10.3390/v13030506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Wang, et al. Prevalence, risk factors, outcomes, and molecular epidemiology of mcr-1-positive Enterobacteriaceae in patients and healthy adults from China: an epidemiological and clinical study. Lancet Infect. Dis. 2017;17(4):390–399. doi: 10.1016/S1473-3099(16)30527-8. [DOI] [PubMed] [Google Scholar]
  50. Yehl, et al. Engineering phage host-range and suppressing bacterial resistance through phage tail fiber mutagenesis. CellCell. 2019;179(2) doi: 10.1016/j.cell.2019.09.015. 459-469 e459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Young Phage lysis: three steps, three choices, one outcome. J. Microbiol. 2014;52(3):243–258. doi: 10.1007/s12275-014-4087-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Zalewska-Piatek Piatek. Phage therapy as a novel strategy in the treatment of urinary tract infections caused by E. Coli. Antibiotics. 2020;9(6) doi: 10.3390/antibiotics9060304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Zheng, et al. Learning transferable deep convolutional neural networks for the classification of bacterial virulence factors. Bioinformatics. 2020;36(12):3693–3702. doi: 10.1093/bioinformatics/btaa230. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

mmc1.docx (26.1KB, docx)

Data Availability Statement

  • Data will be made available on request.

Articles from Virus Research are provided here courtesy of Elsevier

RESOURCES