Skip to main content
Journal of Animal Science logoLink to Journal of Animal Science
. 2023 Jan 28;101:skad035. doi: 10.1093/jas/skad035

Efficacy of zinc glycinate reducing zinc oxide on intestinal health and growth of nursery pigs challenged with F18+ Escherichia coli

Ki Beom Jang 1, Vitor Hugo C Moita 2, Nicolas Martinez 3, Adebayo Sokale 4, Sung Woo Kim 5,✉
PMCID: PMC10195191  PMID: 36715157

Abstract

The objective of this study was to investigate effects of zinc glycinate (ZnGly) supplementation reducing zinc oxide (ZnO) in feeds on intestinal health and growth of nursery pigs challenged with F18+Escherichia coli (E. coli). In total, 72 nursery pigs (BW 6.5 ± 0.5 kg) were allotted in a randomized complete block design to nine treatments: (1) NC: no challenge/no supplement; (2) PC: E. coli challenge/no-supplement; (3) E. coli challenge/ZnO at 2,500 mg/kg; (4, 5, and 6) E. coli challenge/ZnGly at 400, 800, and 1,200 mg/kg; and (7, 8, and 9) E. coli challenge/ZnGly at 400 mg/kg and ZnO at 700, 1,400, and 2,357 mg/kg. Pigs were fed for 28 d based on two phases (phase 1: 14 d and phase 2: 14 d). On day 7, challenged groups were orally inoculated with F18+E. coli at 6 × 109 CFU/mL whereas NC received saline solution. The PC showed reduced ADG (P = 0.076) and G:F (P = 0.055) during phase 1 and increased fecal score (P < 0.05) during the first week of postchallenge when compared with NC, whereas supplementation of ZnGly from 0 to 1,200 mg/kg linearly increased (P = 0.092) G:F and decreased (P < 0.05) the fecal score of the pigs challenged with F18+E. coli. Supplementation of ZnGly from 0 to 1,200 mg/kg had quadratic effects on TNF-α (P = 0.065; minimum 1.13 pg/mg at 850 mg/kg ZnGly), IL-8 (P = 0.093; minimum 0.53 ng/mg at 494 mg/kg), and protein carbonyl (P = 0.054; minimum 2.30 pg/mg at 675 mg/kg) and linearly increased mRNA expressions of ZIP4 (P = 0.057) and ZnT5 (P = 0.075) in the jejunum of the pigs. Supplementation of ZnGly from 0 to 1,200 mg/kg linearly increased (P < 0.05) the relative abundance of Actinobacteria and had quadratic effects on Cyanobacteria (minimum 0.67% at 625 mg/kg ZnO) and Proteobacteria (maximum 45.6 g/d at 735 mg/kg) at the phylum level, with linearly decreased (P < 0.05) Enterobacteriaceae at the family level in the jejunal mucosa-associated microbiota of the pigs. There was no difference in growth performance during the overall period, although pigs fed with ZnO at 2,500 mg/kg had greater (P < 0.05) ADG than pigs fed with ZnGly at 400 mg/kg during the first week of the post challenge period. In conclusion, ZnGly could be an alternative to the pharmaceutical use of ZnO without negatively affecting the growth of nursery pigs by enhancing intestinal Zn absorption, reducing intestinal inflammation and oxidative stress, and providing positive changes in jejunal mucosa-associated microbiota.

Keywords: Escherichia coli, intestinal health, nursery pigs, zinc glycinate, zinc oxide


Zinc glycinate could be an alternative Zn source to replace the pharmaceutical use of ZnO in nursery feeds by reducing the negative impacts of F18+E. coli+ on growth and intestinal health of nursery pigs.

Introduction

Zinc (Zn) is one of the essential microminerals and serves as a cofactor for metalloenzymes responsible for various physiological processes involved in cell repair and division, as well as nutrient metabolism (McCall et al., 2000). Previous studies have also shown that Zn can protect enterocytes from stressors under challenging conditions negatively affecting physiological and immune status (Roselli et al., 2003; Cousins, 2010; Brugger and Windisch, 2019). In swine production, inorganic Zn sources have been broadly used in commercial diets to efficiently provide Zn for the growth and health of pigs. Swine producers have used levels exceeding the requirement of zinc oxide (ZnO) ranging from 2,000 to 3,000 mg/kg in feeds for therapeutic use as growth promoter with diarrhea prevention, even though the requirement is only about 100 mg/kg for nursery pigs (NRC, 2012). Previous studies have shown that ZnO can produce reactive oxygen species to induce oxidative stress in bacteria (Sawai et al., 1998; Dwivedi et al., 2014) possibly due to the fact that microbial respiratory enzymes, such as nicotinamide adenine dinucleotide (NADH) dehydrogenase, would be inhibited by interaction with Zn ions (Messner and Imlay, 1999; Yoshinobu et al., 2003). In regards to the use of ZnO in swine feeds, there are growing concerns that pharmaceutical use of ZnO would cause antimicrobial resistance, and environmental issues related to Zn excretion (Lynegaard et al., 2021; Szuba-Trznadel et al., 2021). According to legislation released in the European Union, a maximum of 150 mg/kg of Zn in the feeds is a legal limit for the use in animal nutrition (European Parliament and the Council of the European Union, 2003) and veterinary therapeutic products containing the pharmaceutical levels of ZnO were phased out in 2022.

The growth and health of nursery pigs are susceptible to the reduced use of antimicrobial compounds in the feeds because the pigs would have impaired intestinal barrier functions during the post weaning period (Jang and Kim, 2019; Zheng et al., 2021). The pigs do not have fully developed intestinal function for nutrient utilization or a defensive system protecting from pathogenic bacteria such as enterotoxigenic E. coli commonly associated with post weaning diarrhea (Rhouma et al., 2017; Duarte et al., 2020; Xu et al., 2022). In particular, enterotoxigenic E. coli is characterized as causing intestinal inflammation and oxidative stress by releasing enterotoxins and increasing adhesion to enterocytes (Nagy and Fekete, 2005; Sun and Kim, 2017; Duarte et al., 2020). Therefore, enterotoxigenic E. coli is currently one of the prominent harmful bacteria causing impaired growth and intestinal health with post weaning diarrhea of the pigs, leading to significant economic losses throughout production.

There have been increased efforts to investigate and find alternative Zn sources to reduce the pharmaceutical use of ZnO without negatively affecting the performance of pigs (Castillo et al., 2008; Wang et al., 2010; Shen et al., 2014; Satessa et al., 2020). In particular, various forms of organic Zn chelated with amino acids, polysaccharides, proteins, or organic acids, have shown positive impacts on growth and biological responses of pigs due to the high bioavailability of Zn rather than inorganic Zn sources (Mazzoni et al., 2010; Zhang et al., 2018; Skiba et al., 2022). Previous studies suggest that organic Zn sources could be partially or equally replaced to the high levels of ZnO supplementation on growth performance of nursery pigs through providing a higher bioavailability than inorganic sources (Case and Carlson, 2002). Among organic Zn sources, zinc glycinate (ZnGly) could also provide potential benefits to improve Zn bioavailability, growth, and intestinal function, and reduce Zn excretion of nursery pigs (Wang et al., 2010; Nitrayova et al., 2012). Chelation with glycine could slightly increase stability and electrical neutrality for Zn as opposed to other amino acid chelation (Zhang et al., 2017). Because glycine has the lowest molecular weight of all of the amino acids, its size favors the stability of the chelate compounds to protect from undesirable chemical reactions in the gastrointestinal tract that limit mineral utilization, resulting in high bioavailability of Zn (Kulkarni et al., 2011; Ashmead, 2001). Considering the biological functions of Zn as well as the biological efficacy of organic mineral, ZnGly could effectively enhance the intestinal health of nursery pigs by positively regulating immune and oxidative stress responses during the post weaning period, leading to a decrease in the use of ZnO in the feeds.

Therefore, it is hypothesized that supplementation of ZnGly can reduce the use of ZnO by positively affecting intestinal health and growth performance of nursery pigs challenged with F18+E. coli. The objective of this study was to investigate the effect of ZnGly supplementation reducing ZnO in feeds on growth performance and intestinal health of nursery pigs challenged with F18+E. coli.

Materials and Methods

The procedure of this study was reviewed and approved by North Carolina State University Animal Care and Use Committee (Raleigh, NC). The experiment was conducted at the North Carolina State University Metabolism Educational Unit (Raleigh, NC).

Experimental design, animals, and diets

A total of 72 newly weaned pigs (PIC Camborough × DNA 600; 36 barrows and 36 gilts) at 3 weeks of age with the initial body weight (BW) at 6.5 ± 0.5 kg, were selected from sows which were not vaccinated for or infected with enterotoxigenic E. coli as suggested by previous studies (Luise et al., 2019a; Duarte et al., 2020; Kim et al., 2021; Xu et al., 2022). The nursery pigs were randomly allotted to nine treatment groups based on randomized complete block design with BW (heavy and light) and sex (barrows and gilts) as blocks. Each treatment group had 8 replicates with one pig per pen. The treatment groups (1 to 9) were as follows 1) NC: pigs not-challenged with E. coli; 2) PC: pigs challenged with F18+E. coli; 3) pigs challenged with F18+E. coli and fed ZnO (Zinc Nacional, Monterrey, Mexico) at 2,500 mg/kg in the diet providing 1,813 mg/kg of Zn as Zn content in the ZnO; 4–6) pigs challenged with F18+E. coli and fed ZnGly (BASF Corp., Florham Park, NJ) at 400, 800, and 1,200 mg/kg in the diets providing 104, 208, and 312 mg/kg of Zn as Zn content in the ZnGly, respectively; 7–9) pigs challenged with F18+E. coli and fed ZnGly at 400 mg/kg and ZnO at 700, 1,400, and 2,357 mg/kg in the diets providing 612, 1,119, and 1,813 mg/kg of Zn, respectively. The pigs were provided with feeds and water ad libitum throughout the experiment. Room temperature was maintained at 30 °C in the first week and it was reduced by 2 °C per week. The experimental period was 28 d and was divided into two dietary phases; phase 1 (weaning to day 14) and phase 2 (days 14–28). Experimental diets for phase 1 (Table 1) and phase 2 (Table 2) were mixed at the North Carolina State University Feed Education Unit (Raleigh, NC). All diets were in mash form. Feed disappearance and BW were measured weekly to calculate average daily gain (ADG), average feed intake (ADFI), and feed efficiency (G:F).

Table 1.

Composition of experimental diets for phase 1

Item NC PC ZnGly 400 mg/kg ZnGly
800 mg/kg
ZnGly
1,200 mg/kg
ZnO
2,500 mg/kg
ZnO
0 mg/kg
ZnO
700 mg/kg
ZnO
1,400 mg/kg
ZnO
2,357 mg/kg
Feedstuff, %
  Corn, yellow 36.95 36.95 37.19 37.12 37.05 36.95 37.15 37.11 36.98
 Soybean meal, 48% CP 18.00 18.00 18.00 18.00 18.00 18.00 18.00 18.00 18.00
 Whey permeate 24.00 24.00 24.00 24.00 24.00 24.00 24.00 24.00 24.00
 Poultry meal 10.00 10.00 10.00 10.00 10.00 10.00 10.00 10.00 10.00
 Blood plasma 3.50 3.50 3.50 3.50 3.50 3.50 3.50 3.50 3.50
 Fish meal 3.50 3.50 3.50 3.50 3.50 3.50 3.50 3.50 3.50
 Poultry fat 1.50 1.50 1.50 1.50 1.50 1.50 1.50 1.50 1.50
 Limestone 0.43 0.43 0.43 0.43 0.43 0.43 0.43 0.43 0.43
 L-Lys HCl 0.51 0.51 0.51 0.51 0.51 0.51 0.51 0.51 0.51
 DL-Met 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25
 L-Thr 0.17 0.17 0.17 0.17 0.17 0.17 0.17 0.17 0.17
 L-Trp 0.02 0.02 0.02 0.02 0.02 0.02 0.02 0.02 0.02
 Formic acid 0.50 0.50 0.50 0.50 0.50 0.50 0.50 0.50 0.50
 Salt 0.22 0.22 0.22 0.22 0.22 0.22 0.22 0.22 0.22
 Vitamin premix1 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03
 Trace mineral premix2 0.14 0.14 0.14 0.14 0.14 0.14 0.14 0.14 0.14
 Zinc oxide -- -- -- 0.07 0.14 0.24 -- -- 0.25
 Zinc glycinate -- -- 0.04 0.04 0.04 0.04 0.08 0.12 --
 Total 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00
Calculated composition
 DM, % 91.1 91.1 91.0 91.0 90.9 90.8 91.0 90.9 90.8
 ME, kcal/kg 3,411 3,411 3,409 3,407 3,405 3,401 3,408 3,407 3,402
 CP, % 24.5 24.5 24.5 24.5 24.5 24.5 24.5 24.5 24.5
 SID3 Lys, % 1.50 1.50 1.50 1.50 1.50 1.50 1.50 1.50 1.50
 Ca, % 0.85 0.85 0.85 0.85 0.85 0.85 0.85 0.85 0.85
 STTD4 P, % 0.48 0.48 0.48 0.48 0.48 0.48 0.48 0.48 0.48
 Zn, % 0.02 0.02 0.03 0.07 0.12 0.19 0.04 0.05 0.19
Analyzed composition
 DM, % 90.93 90.98 90.78 90.53 91.08 91.21 90.67 90.72 91.10
 CP, % 23.10 23.49 23.78 23.40 23.91 23.92 23.87 23.37 23.76
 Zn5, % 0.01 0.01 0.02 0.07 0.12 0.16 0.03 0.04 0.18
 Formate5, % 0.29 0.32 0.32 0.31 0.32 0.34 0.31 0.30 0.28
 pH 5.55 5.57 5.50 5.53 5.53 5.50 5.52 5.49 5.60

1The vitamin premix provided per kilogram of complete diet: 6,614 IU of vitamin A as vitamin A acetate, 992 IU of vitamin D3, 19.8 IU of vitamin E, 2.6 mg of vitamin K as menadione sodium bisulfate, 0.03 mg of vitamin B12, 4.6 mg of riboflavin, 18.5 mg of D-pantothenic acid as calcium panthonate, 26.5 mg of niacin, and 0.07 mg of biotin.

2The trace mineral premix provided per kilogram of complete diet: 30 mg of Mn as manganous oxide, 100 mg of Fe as ferrous sulfate, 100 mg of Zn as zinc sulfate, 15 mg of Cu as copper sulfate, 0.3 mg of I as ethylene diamine dihydroiodide, and 0.3 mg of Se as sodium selenite.

3SID = standardized ileal digestible.

4STTD = standardized total tract digestible.

5Zinc and formate contents were analyzed by inductive coupled plasma (ICP) spectroscopy and enzymatic assay, respectively (Eurofins Scientific Inc., Des Moines, IA).

Table 2.

Composition of experimental diets for phase 2

Item NC PC ZnGly 400 mg/kg ZnGly
800 mg/kg
ZnGly
1,200 mg/kg
ZnO
2,500 mg/kg
ZnO
0 mg/kg
ZnO
700 mg/kg
ZnO
1,400 mg/kg
ZnO
2,357 mg/kg
Feedstuff, %
 Corn, yellow 51.44 51.44 51.68 51.61 51.54 51.44 51.64 51.60 51.47
 Soybean meal, 48% CP 22.00 22.00 22.00 22.00 22.00 22.00 22.00 22.00 22.00
 Whey permeate 13.00 13.00 13.00 13.00 13.00 13.00 13.00 13.00 13.00
 Poultry meal 5.00 5.00 5.00 5.00 5.00 5.00 5.00 5.00 5.00
 Blood plasma 1.75 1.75 1.75 1.75 1.75 1.75 1.75 1.75 1.75
 Fish meal 1.75 1.75 1.75 1.75 1.75 1.75 1.75 1.75 1.75
 Poultry fat 2.00 2.00 2.00 2.00 2.00 2.00 2.00 2.00 2.00
 Dicalcium phosphate 0.50 0.50 0.50 0.50 0.50 0.50 0.50 0.50 0.50
 Limestone 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75
 L-Lys HCl 0.50 0.50 0.50 0.50 0.50 0.50 0.50 0.50 0.50
 DL-Met 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.20
 L-Thr 0.16 0.16 0.16 0.16 0.16 0.16 0.16 0.16 0.16
 L-Trp 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01
 L-Val 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03
 Formic acid 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25
 Salt 0.22 0.22 0.22 0.22 0.22 0.22 0.22 0.22 0.22
 Vitamin premix1 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03
 Trace mineral premix2 0.14 0.14 0.14 0.14 0.14 0.14 0.14 0.14 0.14
 Zinc oxide -- -- -- 0.07 0.14 0.24 -- -- 0.25
 Zinc glycinate -- -- 0.04 0.04 0.04 0.04 0.08 0.12 --
 Total 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00
Calculated composition
 DM, % 90.3 90.3 90.2 90.1 90.1 90.0 90.2 90.2 90.1
 ME, kcal/kg 3,409 3,409 3,408 3,406 3,403 3,400 3,407 3,405 3,401
 CP, % 21.6 21.6 21.6 21.6 21.5 21.5 21.6 21.6 21.5
 SID3 Lys, % 1.35 1.35 1.35 1.35 1.35 1.35 1.35 1.35 1.35
  Ca, % 0.80 0.80 0.80 0.80 0.80 0.80 0.80 0.80 0.80
 STTD4 P, % 0.40 0.40 0.40 0.40 0.40 0.40 0.40 0.40 0.40
 Zn, % 0.02 0.02 0.03 0.07 0.12 0.19 0.04 0.05 0.19
Analyzed composition
 DM, % 90.26 90.17 90.19 90.22 90.53 90.22 89.77 90.33 90.33
 CP, % 20.26 20.44 20.83 20.23 21.10 20.02 21.44 21.00 21.42
 Zn5, % 0.01 0.01 0.02 0.07 0.11 0.18 0.04 0.05 0.18
 Formate5, % 0.13 0.13 0.15 0.14 0.14 0.14 0.14 0.14 0.14
 pH 5.88 5.89 5.75 5.80 5.81 5.78 5.70 5.68 5.85

1The vitamin premix provided per kilogram of complete diet: 6,614 IU of vitamin A as vitamin A acetate, 992 IU of vitamin D3, 19.8 IU of vitamin E, 2.6 mg of vitamin K as menadione sodium bisulfate, 0.03 mg of vitamin B12, 4.6 mg of riboflavin, 18.5 mg of D-pantothenic acid as calcium panthonate, 26.5 mg of niacin, and 0.07 mg of biotin.

2The trace mineral premix provided per kilogram of complete diet: 30 mg of Mn as manganous oxide, 100 mg of Fe as ferrous sulfate, 100 mg of Zn as zinc sulfate, 15 mg of Cu as copper sulfate, 0.3 mg of I as ethylene diamine dihydroiodide, and 0.3 mg of Se as sodium selenite.

3SID = standardized ileal digestible.

4STTD = standardized total tract digestible.

5Zinc and formate contents were analyzed by inductive coupled plasma (ICP) spectroscopy and enzymatic assay, respectively (Eurofins Scientific Inc., Des Moines, IA).

Experimental procedures and sample collection

All pigs were fed the experimental diets for 7 d (pre challenge period) until 64 pigs were orally inoculated with F18+E. coli on day 7 of the study. The inoculum of F18+E. coli was prepared to be nalidixic acid resistant and produce heat-stable toxins A (STa) and heat-stable toxins B (STb), using a strain originally resistant to nalidixic acid following the standard protocol as previously described by Cutler et al. (2007). The final concentration of F18+E. coli was 6 × 109 CFU/mL, and was orally administered in two doses. The unchallenged group (eight pigs) received an oral dose of sterile physiological saline. The fecal score was also recorded during the study to analyze the effects of F18+E. coli challenge as described in previous studies (Duarte et al., 2020; Xu et al., 2022). The fecal score was recorded using a 1 to 5 scale: 1) very firm stool, 2) normal firm stool, 3) moderately loose stool, 4) loose, watery stool, and 5) very watery stool as described in previous studies (Deng et al., 2022; Xu et al., 2022).

At the end of feeding in the experiment, all pigs were euthanized by exsanguination after the penetration of a captive bolt. After euthanasia, jejunal mucosa and tissues were gently washed with saline to remove the digesta and then collected. Jejunal tissues (15 cm) were obtained and flushed with saline solution to remove digesta. The first 5 cm was stored in 10% formalin buffer for histology and measurement of crypt cell proliferation of jejunal tissue, and the remaining 10 cm was used to collect jejunal mucosa by scraping of the mucosal layer of the jejunum using glass microscope slides. The mucosa samples were frozen in liquid N immediately after sampling and then stored in freezer at −80 °C until further analysis.

Histology and immunohistochemistry

Two parts of mid-jejunum fixed in 10% buffered formalin for 48 h after tissue sampling, and then transferred to a 70% ethanol solution and sent to the North Carolina State University Histology Laboratory (College of Veterinary Medicine, Raleigh, NC) for dehydration, embedment, and staining according to their internal standard protocol. Villus height and crypt depth were measured using a camera (Infinity 2-2 digital CCD) attached to a microscope (Olympus CX31, Lumenera Corporation, Ottawa, Canada) as described in previous studies (Duarte et al., 2021; Deng et al., 2022). Lengths of 15 well-oriented intact villi and their associated crypts were measured in each slide. The villi length was measured from the top of the villi to the villi–crypt junction, and the crypt depth was measured from the villi–crypt junction to the bottom of the crypt. Then, the villus height to crypt depth (VH:CD) ratio was calculated. Images of 15 intact crypts from each slide were cropped and the Image JS software was used for calculating the ratio of Ki-67 positive cells to total cells in the crypt (%). Morphological evaluation and crypt cell proliferation were executed by the same person.

Immune status and oxidative stress

Jejunal mucosa was ground using a homogenizer (Tissuemiser, Thermo Fisher Scientific Inc., Rockford, IL, USA) on ice in 2 mL phosphate-buffered saline (PBS) for 30 s. Homogenized samples were centrifuged at 14,000 × g for 15 min and then the supernatant was collected. Sample preparation for analysis was followed as described in previous studies (Jang et al., 2020). Protein contents in supernatants were measured using Pierce BCA Protein Assay Kit (23225#, Thermo Fisher Scientific Inc.). Concentrations of tumor necrosis factor-α (TNF-α) and interleukin-8 (IL-8) in the jejunal mucosa samples were determined using ELISA kits (R&D Systems, Minneapolis, MN) following the manufacturer’s protocols. The concentrations of malondialdehyde (MDA) and protein carbonyl were measured by commercial assay kits (Cell Biolabs, Inc., San Diego, CA) following the manufacturers’ protocols. Total concentrations of immunoglobulins (IgG and IgA) in the jejunal mucosa of pigs were measured using an ELISA Kit for swine IgG and IgA (Bethyl Laboratories Inc., Montgomery, TX), respectively, following the manufacturer’s protocols.

Relative mRNA expression of Zn and amino acid transporters

Frozen jejunal mucosa (50 to 100 mg) was homogenized in 1 mL of trizol reagent, (15-596-026, Invitrogen, Waltham, MA) using a Bead Mill 24 homogenizer (Thermo Fisher), twice at 4.5 m/s for 30 s and rested intermittently for 20 s on ice. Homogenized samples were centrifuged for 10 min at 12,000 × g in 4 °C and then the supernatant was transferred to a 1.5 mL centrifuge tube and mixed with 200 μL of chloroform (Thermo Fisher) by gently shaking for 1 min. The tube was then incubated at room temperature for 10 min, and centrifuged 15 min at 12,000 × g at 4 °C. The aqueous phase was carefully removed, placed into a new tube, and mixed with 200 μL of isopropanol by gently shaking the tubes for 1 min. Samples were rested for 10 min at room temperature and subsequently centrifuged at 12,000 × g for 15 min at 4 °C. All the supernatant was removed and mixed with 75% ethanol. This mix was filtered in columns from the RNeasy Mini kit (Qiagen, Valenica, CA, USA). Columns were washed once with 700 μL of RW1 buffer (catalog no. 1053394, Qiagen) and three times with 500 μL of RPE buffer (catalog no. 1018013, Qiagen). The RNA was eluted with RNase-free water (Invitrogen). The quantity and quality of total RNA were determined using spectrometry. The extracted RNA was reverse transcribed into cDNA using commercial kit (RevertAid First Strand cDNA Synthesis, Thermo Fisher) according to the manufacturer’s instructions. Quantitative real-time polymerase chain reaction (RT–qPCR) was performed using the CFX Connect Real-Time PCR Detection System (BioRad, Hercules, CA, USA) and Maxima SYBR Green/ROX qPCR Master Mix (Thermo Fisher) with oligonucleotide primers synthesized by Millipore Sigma (Burlington, MA). The primers used for target gene are described in Table 3 and β-actin was used as the house-keeping gene. Delta–delta Ct values were calculated to acquire relative mRNA levels per sample. Relative expression was normalized and expressed as a ratio to the expression of targeting genes in the no challenge group.

Table 3.

Sequence of primers for nutrient transporters in the jejunum of nursery pigs

Item1 Forward primers Reverse primers Accession number2
ZIP 4 CTTCTTCGCCGATGCCAAGG GTCGCTGAGGTAAAGGGCAG XM_021090449.1
ZnT1 TCCAACGGGCTGAAATTGGA ACATCTCCCCCTCAGGACAA NM_001139470.1
ZnT5 TGCTCGCTATGGATCCGTTC TAGCGCTCACTACCACTCCT NM_001001266.2
GLYT1 AGTTCAGAGAGGGGAGGGACTT AGCACCATTCAGCATCCCTTT XM_021096812.1
b0,+AT TCTTGCGACACTGGGCTG ACAGACAGTTTTGTGCCCTCA EU155139
y+LAT1 TTCCCAAGGTTGCAGCTCAT TTTGGGGGAGACGAAGATGC NM_001110421.1
β-Actin CTCCAGAGCGCAAGTACTCC GAATGCAACTAACAGTCCGCC XM_003124280.5

1ZIP4, zinc/iron-regulated transporter-like protein 4 (SLC39A4); ZnT1, zinc transporter 1 (SLC30A1); ZnT5, zinc transporter 5 (SLC30A5); GLYT1, glycine transporter 1 (SLC6A9); b0,+AT, neutral amino acid transport system b0,+ (SLC7A9); y+LAT1, y+L cation and neutral amino acid transporter 1 (SLC7A7).

2Primers were designed according to their published sequences at the Genbank database (National Center for Biotechnology Information, Bethesda, MD).

Microbiome sequencing

The deoxyribonucleic acid (DNA) was extracted from 250 mg of jejunal mucosa samples using a commercial DNA extraction kit (DNA Stool MiniKit, QIAGEN, Germany). Extracted DNA samples were sent to Diversigen, Inc. (Houston, TX) and prepared for shotgun sequencing to estimate the diversity and relative abundance at phylum and family levels of jejunal mucosa-associated microbiota of the pigs. Operational taxonomic units (OTUs) data were transformed to relative abundance (%) for further statistical analysis, and the OTU data with less than 0.05% relative abundance within each level were combined as “other”.

Statistical analysis

Data were analyzed by the UNIVARIATE procedures (SAS Inst. Inc., Cary, NC) to test for homogeneity, normality, and outliers. The experimental unit was the pen and data were then analyzed by Mixed procedure of SAS 9.4 (SAS Inst. Inc., Cary, NC) as a randomized complete block design. Effects of ZnGly or ZnO levels were analyzed using the polynomial contrast statements to determine linear and quadratic effects with coefficients for equally or unequallyspaced treatments, respectively, by Proc IML procedure of SAS 9.4. Treatment comparisons were made using the following orthogonal contrasts: 1) effect of F18+ E. coli challenge (NC vs. PC), 2) effect of pharmaceutical level of ZnO (PC vs. ZnO at 2,500 mg/kg), and 3) effect of zinc source (ZnGly at 400 mg/kg vs. ZnO at 2,500 mg/kg), and effect of zinc supplements [PC vs.(ZnGly at 400 mg/kg + ZnO at 2,500 mg/kg)]. Statistical significance and tendency were considered at P < 0.05 and 0.05 ≤ P < 0.10, respectively.

Results

F18+E. coli challenge

Initial BW of pigs at the beginning of experiment was 6.5 kg and there was no difference among treatments (Table 4). There was no mortality during overall period in the study. However, three pigs were removed from the study due to severe BW loss (confirmed as outliers): 1) one pig in NC group, 2) one pig in the group fed ZnO at 2,500 mg/kg, and 3) one pig in the group fed ZnGly at 400 mg/kg and ZnO at 700 mg/kg. Pigs had to be removed following the IACUC guideline. In the post challenge period (days 7 to 28), F18+E. coli challenge tended to decrease (P = 0.065) average daily gain (308 to 244 g/d) during days 7 to 14 and tended to decrease (P = 0.076) average daily gain (200 to 155 g/d) of nursery pigs during phase 1 (weaning to days 14). The F18+E. coli challenge decreased (P < 0.05) G:F (0.84 to 0.76) during days 21 to 28 and tended to decrease (P = 0.055) G:F (0.82 to 0.69) of nursery pigs during phase 1 (weaning to days 14). In the pre challenge period, there was no difference in fecal score of nursery pigs (Table 5). However, the F18+E. coli challenge increased (P < 0.05) fecal score (3.2 to 4.1) of nursery pigs during days 7 to 14, the first week of post challenge period.

Table 4.

Growth performance of nursery pigs fed diets with varying levels of zinc glycinate (ZnGly) and zinc oxide (ZnO) under F18+E. coli challenge1

Item NC2 PC ZnGly 400 mg/kg ZnGly
800 mg/kg
ZnGly
1,200 mg/kg
ZnO
2,500 mg/kg
SEM P-value
ZnO
0 mg/kg
ZnO
700 mg/kg
ZnO
1,400 mg/kg
ZnO
2,357 mg/kg
NC vs. PC3 PC vs. ZnO 2,500 mg/kg ZnO
Linear4
ZnO
Quad.4
ZnGly
Linear5
ZnGly Quad.5 Zn
Source6
PC vs. Zn source7
BW, kg
 dayay 0 6.5 6.5 6.5 6.5 6.5 6.5 6.5 6.5 6.6 0.4 0.974 0.922 0.994 0.862 0.975 0.999 0.935 1.000
 day 7 7.2 7.0 7.4 7.2 7.0 7.2 7.2 7.1 7.2 0.4 0.520 0.407 0.421 0.244 0.850 0.216 0.509 0.182
 day 14 9.3 8.7 9.2 8.5 8.8 9.6 9.0 8.9 9.5 0.5 0.110 0.052 0.176 0.014 0.796 0.243 0.466 0.061
 day 21 12.1 12.0 12.6 11.4 11.8 12.7 12.1 11.8 12.6 0.6 0.870 0.360 0.552 0.023 0.585 0.294 0.959 0.267
 day 28 17.0 16.8 17.6 16.2 16.6 17.8 16.9 16.3 17.6 0.7 0.807 0.333 0.587 0.019 0.343 0.170 0.930 0.232
 ADG, g/d
 days 0 to 7 92 66 125 99 69 98 96 96 97 26 0.465 0.390 0.370 0.236 0.819 0.171 0.435 0.151
 days 7 to 14 308 244 256 168 259 338 260 250 343 31 0.065 0.007 0.002 0.004 0.842 0.645 0.017 0.068
 days 14 to 21 394 470 486 415 431 451 441 419 439 35 0.107 0.519 0.607 0.187 0.186 0.571 0.334 0.850
 days 21 to 28 736 689 717 691 677 724 690 642 713 31 0.263 0.555 0.882 0.204 0.196 0.185 0.930 0.454
 days 7 to 28 471 467 486 425 456 504 464 437 498 22 0.913 0.307 0.277 0.015 0.211 0.263 0.698 0.328
 Phase 18 200 155 191 133 164 218 178 167 210 20 0.076 0.038 0.113 0.005 0.765 0.197 0.458 0.043
 Phase 29 557 579 601 553 554 587 566 530 576 26 0.536 0.931 0.798 0.109 0.105 0.253 0.488 0.758
 Overall 375 367 396 343 359 403 372 349 393 19 0.776 0.323 0.538 0.013 0.328 0.154 0.914 0.219
ADFI, g/d
 days 0 to 7 150 123 165 153 126 169 146 130 130 22 0.362 0.826 0.971 0.170 0.985 0.168 0.234 0.347
 days 7 to 14 344 324 331 259 329 414 311 288 375 28 0.587 0.188 0.006 0.010 0.277 0.570 0.257 0.373
 days 14 to 21 579 606 601 523 545 626 558 524 604 43 0.631 0.966 0.497 0.064 0.109 0.727 0.957 0.934
 days 21 to 28 874 902 896 858 853 905 920 808 915 36 0.571 0.793 0.803 0.188 0.090 0.114 0.710 0.928
 days 7 to 28 579 611 609 547 576 648 596 540 631 29 0.421 0.607 0.174 0.022 0.066 0.310 0.584 0.776
 Phase 1 247 224 248 205 228 291 229 209 246 21 0.399 0.446 0.060 0.015 0.473 0.269 0.935 0.935
 Phase 2 707 754 749 691 699 766 739 666 759 35 0.335 0.916 0.591 0.074 0.068 0.309 0.826 0.996
 Overall 470 489 498 448 463 528 484 438 503 25 0.588 0.691 0.241 0.023 0.111 0.238 0.901 0.692
G:F
 days 0 to 7 0.48 0.38 0.60 0.61 0.50 0.57 0.60 0.56 0.66 0.13 0.549 0.114 0.750 0.738 0.348 0.283 0.743 0.102
 days 7 to 14 0.92 0.77 0.80 0.70 0.76 0.82 0.84 0.88 0.92 0.07 0.142 0.168 0.620 0.318 0.265 0.914 0.244 0.344
 days 14 to 21 0.70 0.78 0.81 0.80 0.79 0.73 0.79 0.81 0.73 0.05 0.170 0.362 0.187 0.589 0.790 0.900 0.188 0.767
 days 21 to 28 0.84 0.76 0.81 0.81 0.80 0.80 0.75 0.80 0.78 0.03 0.036 0.540 0.808 0.923 0.665 0.977 0.549 0.283
 days 7 to 28 0.82 0.77 0.80 0.78 0.79 0.78 0.78 0.81 0.79 0.03 0.222 0.556 0.604 0.867 0.375 0.977 0.760 0.382
 Phase 1 0.82 0.69 0.77 0.65 0.69 0.75 0.79 0.81 0.86 0.05 0.055 0.020 0.994 0.095 0.092 0.506 0.208 0.042
 Phase 2 0.79 0.77 0.81 0.80 0.80 0.77 0.77 0.80 0.76 0.03 0.575 0.816 0.274 0.749 0.700 0.920 0.205 0.632
 Overall 0.80 0.75 0.80 0.77 0.78 0.76 0.77 0.80 0.79 0.03 0.177 0.365 0.378 0.685 0.271 0.772 0.715 0.200

1Data represent the least square means of eight replications except for three treatments: 1) one pig in NC group, 2) one pig in the group fed ZnO at 2,500 mg/kg, and 3) one pig in the group fed ZnGly at 400 mg/kg and ZnO at 700 mg/kg. Pigs had to be removed due to severe BW loss following the IACUC guideline after the statistical confirmation as outliers.

2No challenge.

3F18+E. coli challenge on d 7 after weaning.

4Dose response effects of ZnO supplementation (ZnO at 0, 700, 1,400, and 2,357 mg/kg) with ZnGly at 400 mg/kg.

5Dose response effects of ZnGly supplementation [ZnGly at 0 (PC), 400, 800, and 1,200 mg/kg].

6ZnGly at 400 mg/kg vs. ZnO at 2,500 mg/kg.

7PC vs. ZnGly at 400 mg/kg + ZnO at 2,500 mg/kg.

8days 0 to 14.

9days 14 to 28.

Table 5.

Fecal score of nursery pigs fed diets with varying levels of zinc glycinate (ZnGly) and zinc oxide (ZnO) under F18+E. coli challenge1

Item NC2 PC ZnGly 400 mg/kg ZnGly
800 mg/kg
ZnGly
1,200 mg/kg
ZnO
2,500 mg/kg
SEM P-value
ZnO
0 mg/kg
ZnO
700 mg/kg
ZnO
1,400 mg/kg
ZnO
2,357 mg/kg
NC vs. PC3 PC vs. ZnO 2,500 mg/kg ZnO
Linear4
ZnO
Quad.4
ZnGly
Linear5
ZnGly Quad.5 Zn
Source6
PC vs. Zn source7
Fecal score8
Pre challenge 3.7 3.5 3.6 3.6 3.8 3.5 3.6 3.4 3.1 0.2 0.374 0.122 0.670 0.340 0.693 0.472 0.055 0.498
Post challenge 3.3 3.6 3.6 3.8 3.6 3.5 3.6 3.4 3.4 0.1 0.040 0.211 0.193 0.174 0.242 0.534 0.226 0.454
 days 7 to 14 3.2 4.1 4.0 4.4 3.9 3.5 3.8 3.5 3.5 0.2 0.001 0.023 0.024 0.056 0.019 0.673 0.080 0.101
 days 14 to 21 3.4 3.4 3.3 3.4 3.4 3.4 3.5 3.5 3.4 0.1 0.705 0.929 0.657 0.841 0.298 0.967 0.684 0.894
 days 21 to 28 3.3 3.3 3.5 3.5 3.6 3.5 3.3 3.4 3.4 0.1 0.931 0.439 0.886 0.853 0.957 0.274 0.344 0.152

1Data represent the least square means of 8 replications except for three treatments: 1) one pig in NC group, 2) one pig in the group fed ZnO at 2,500 mg/kg, and 3) one pig in the group fed ZnGly at 400 mg/kg and ZnO at 700 mg/kg. Pigs had to be removed due to severe BW loss following the IACUC guideline after the statistical confirmation as outliers.

2No challenge.

3F18+E. coli challenge on d 7 after weaning.

4Dose response effects of ZnO supplementation (ZnO at 0, 700, 1,400, and 2,357 mg/kg) with ZnGly at 400 mg/kg.

5Dose response effects of ZnGly supplementation [ZnGly at 0 (PC), 400, 800, and 1,200 mg/kg].

6ZnGly at 400 mg/kg vs. ZnO at 2,500 mg/kg.

7PC vs. ZnGly at 400 mg/kg + ZnO at 2,500 mg/kg.

8Fecal score is measured from day 2 based on a 1 to 5 scale: 1 (dried feces) to 5 (watery diarrhea).

The F18+E. coli challenge decreased (P < 0.05) villus height to crypt depth ratio (2.00 to 1.70 μm) and increased (P < 0.05) enterocyte proliferation (19.1 to 27.5%) in the jejunum of nursery pigs (Table 6). The F18+E. coli challenge tended to increase TNF-α (P = 0.057; 1.31 to 1.87 pg/mg of protein), IgG (P = 0.089; 1.12 to 1.80 μg/mg), protein carbonyl (P = 0.075; 2.48 to 4.13 nmol/mg), and MDA (P = 0.079; 0.31 to 0.44 μM/mg) in the jejunum of nursery pigs (Table 7).

Table 6.

Jejunal morphology and crypt cell proliferation of nursery pigs fed diets with varying levels of zinc glycinate (ZnGly) and zinc oxide (ZnO) under F18+E. coli challenge1

Item NC2 PC ZnGly 400 mg/kg ZnGly
800 mg/kg
ZnGly
1,200 mg/kg
ZnO
2,500 mg/kg
SEM P-value
ZnO
0 mg/kg
ZnO
700 mg/kg
ZnO
1,400 mg/kg
ZnO
2,357 mg/kg
NC vs. PC3 PC vs. ZnO 2,500 mg/kg ZnO
Linear4
ZnO
Quad.4
ZnGly
Linear5
ZnGly Quad.5 Zn
Source6
PC vs. Zn source7
Jejunum
 Villus height, μm 516 465 438 504 461 515 494 475 485 30 0.148 0.554 0.092 0.849 0.438 0.869 0.179 0.899
 Crypt depth, μm 265 285 245 290 256 285 274 270 265 11 0.123 0.124 0.041 0.475 0.731 0.049 0.114 0.010
 VH:CD 2.00 1.70 1.88 1.78 1.86 1.85 1.84 1.80 1.87 0.11 0.046 0.239 0.990 0.711 0.599 0.284 0.942 0.177
 Crypt cell proliferation, % 19.1 27.5 25.7 25.6 26.0 26.3 26.5 27.2 26.8 2.3 <0.001 0.727 0.541 0.747 0.912 0.603 0.350 0.358

1Data represent the least square means of eight replications except for three treatments: 1) one pig in NC group, 2) one pig in the group fed ZnO at 2,500 mg/kg, and 3) one pig in the group fed ZnGly at 400 mg/kg and ZnO at 700 mg/kg. Pigs had to be removed due to severe BW loss following the IACUC guideline after the statistical confirmation as outliers.

2No challenge.

3F18+E. coli challenge on day 7 after weaning.

4Dose response effects of ZnO supplementation (ZnO at 0, 700, 1,400, and 2,357 mg/kg) with ZnGly at 400 mg/kg.

5Dose response effects of ZnGly supplementation [ZnGly at 0 (PC), 400, 800, and 1,200 mg/kg].

6ZnGly at 400 mg/kg vs. ZnO at 2,500 mg/kg.

7PC vs. ZnGly at 400 mg/kg + ZnO at 2,500 mg/kg.

Table 7.

Jejunal immune and oxidative stress response of nursery pigs fed diets with varying levels of zinc glycinate (ZnGly) and zinc oxide (ZnO) under F18+E. coli challenge1

Item NC2 PC ZnGly at 400 mg/kg ZnGly
800 mg/kg
ZnGly
1,200 mg/kg
ZnO
2,500 mg/kg
SEM P-value
ZnO
0 mg/kg
ZnO
700 mg/kg
ZnO
1,400 mg/kg
ZnO
2,357 mg/kg
NC vs. PC3 PC vs. ZnO 2,500 mg/kg ZnO
Linear4
ZnO
Quad.4
ZnGly
Linear5
ZnGly Quad.5 Zn
Source6
PC vs. Zn source7
Jejunal mucosa/mg of protein
 TNF-α, pg 1.31 1.87 1.33 1.29 1.52 1.32 1.30 1.52 1.01 0.22 0.057 0.004 0.882 0.650 0.236 0.065 0.285 0.006
 IL-8, ng 0.71 0.69 0.58 0.69 0.77 0.94 0.54 0.84 0.71 0.12 0.912 0.925 0.034 0.912 0.455 0.093 0.468 0.742
 IgG, μg 1.12 1.80 1.66 1.74 1.54 1.80 1.80 2.20 1.78 0.33 0.089 0.947 0.827 0.715 0.282 0.318 0.763 0.798
 IgA, μg 6.47 7.67 7.42 8.10 6.13 6.90 6.22 5.87 7.85 1.50 0.549 0.929 0.600 0.880 0.301 0.973 0.828 0.982
 Protein carbonyl, nmol 2.48 4.13 2.26 2.55 1.97 2.67 2.37 2.94 2.96 0.89 0.075 0.200 0.779 0.704 0.216 0.054 0.446 0.057
 MDA, μM 0.31 0.44 0.34 0.31 0.41 0.49 0.48 0.37 0.43 0.06 0.079 0.842 0.014 0.362 0.711 0.855 0.855 0.390

1Data represent the least square means of eight replications except for three treatments: 1) one pig in NC group, 2) one pig in the group fed ZnO at 2,500 mg/kg, and 3) one pig in the group fed ZnGly at 400 mg/kg and ZnO at 700 mg/kg. Pigs had to be removed due to severe BW loss following the IACUC guideline after the statistical confirmation as outliers.

2No challenge.

3F18+E. coli challenge on day 7 after weaning.

4Dose response effects of ZnO supplementation (ZnO at 0, 700, 1,400, and 2,357 mg/kg) with ZnGly at 400 mg/kg.

5Dose response effects of ZnGly supplementation [ZnGly at 0 (PC), 400, 800, and 1,200 mg/kg].

6ZnGly at 400 mg/kg vs. ZnO at 2,500 mg/kg.

7PC vs. ZnGly at 400 mg/kg + ZnO at 2,500 mg/kg.

Expression of Zn transporters including ZIP4 (P = 0.089; 1.04 to 0.69) and ZnT1 (P = 0.082; 1.01 to 0.60) tended to be downregulated in the jejunum of nursery pigs challenged with F18+E. coli compared with no challenge group, whereas ZnT5 expression did not differ in F18+E. coli challenge group (Table 8). The F18+E. coli challenge did not affect (P > 0.10) expression of the amino acid transporters including GLYT1, b0,+AT, and y+LAT1 in the jejunum of nursery pigs. The F18+E. coli challenge did not affect diversity estimates and relative abundance of bacteria at phylum and family levels in jejunal mucosa of nursery pigs (Tables 9–11).

Table 8.

Relative gene expression of zinc and amino acid transporters in the jejunum of nursery pigs fed diets with varying levels of zinc glycinate (ZnGly) and zinc oxide (ZnO) under F18+E. coli challenge1

Item2 NC3 PC ZnGly at 400 mg/kg ZnGly
800 mg/kg
ZnGly
1,200 mg/kg
ZnO 2,500 mg/kg P-value
ZnO
0 mg/kg
ZnO
700 mg/kg
ZnO
1,400 mg/kg
ZnO
2,357 mg/kg
SEM NC vs. PC4 PC vs. ZnO 2,500 mg/kg ZnO
Linear5
ZnO
Quad.5
ZnGly
Linear6
ZnGly Quad.6 Zn
Source7
PC vs. Zn source8
Jejunum
ZIP4 1.04 0.69 0.89 0.81 0.86 0.77 1.14 1.03 0.63 0.16 0.089 0.772 0.617 0.979 0.057 0.283 0.192 0.697
ZnT1 1.01 0.60 0.69 0.85 0.70 0.75 0.80 0.86 0.65 0.18 0.082 0.826 0.969 0.803 0.235 0.907 0.862 0.723
ZnT5 1.04 0.92 1.13 1.13 0.97 1.10 1.11 1.22 0.89 0.13 0.415 0.824 0.647 0.428 0.075 0.626 0.113 0.506
GLYT1 1.03 0.96 0.79 1.01 0.84 0.88 0.98 1.11 0.87 0.15 0.737 0.661 0.891 0.602 0.343 0.308 0.702 0.469
b0,+AT 1.02 0.98 1.06 0.91 0.63 1.04 0.85 1.18 1.06 0.24 0.898 0.817 0.837 0.228 0.698 0.593 0.997 0.788
y+LAT1 1.00 0.93 0.99 0.99 0.93 1.27 1.12 1.16 0.87 0.18 0.696 0.777 0.180 0.232 0.148 0.939 0.579 0.987

1Data represent the least square means of eight replications except for three treatments: 1) one pig in NC group, 2) one pig in the group fed ZnO at 2,500 mg/kg, and 3) one pig in the group fed ZnGly at 400 mg/kg and ZnO at 700 mg/kg. Pigs had to be removed due to severe BW loss following the IACUC guideline after the statistical confirmation as outliers.

2ZIP4, zinc/iron-regulated transporter-like protein 4 (SLC39A4); ZnT1, zinc transporter 1 (SLC30A1); ZnT5, zinc transporter 5 (SLC30A5); GLYT1, glycine transporter 1 (SLC6A9); b0,+AT, neutral amino acid transport system b0,+ (SLC7A9); y+LAT1, y+L cation and neutral amino acid transporter 1 (SLC7A7).

3No challenge.

4F18+E. coli challenge on day 7 after weaning.

5Dose response effects of ZnO supplementation (ZnO at 0, 700, 1,400, and 2,357 mg/kg) with ZnGly at 400 mg/kg.

6Dose response effects of ZnGly supplementation [ZnGly at 0 (PC), 400, 800, and 1,200 mg/kg].

7ZnGly at 400 mg/kg vs. ZnO at 2,500 mg/kg.

8PC vs. ZnGly at 400 mg/kg + ZnO at 2,500 mg/kg.

Table 9.

Alpha-diversity in jejunal mucosa-associated microbiota of nursery pigs fed diets with varying levels of zinc glycinate (ZnGly) and zinc oxide (ZnO) under F18+E. coli challenge1

Item NC2 PC ZnGly at 400 mg/kg ZnGly
800 mg/kg
ZnGly
1,200 mg/kg
ZnO 2,500 mg/kg P-value
ZnO
0
mg/kg
ZnO
700 mg/kg
ZnO
1,400 mg/kg
ZnO
2,357 mg/kg
SEM NC vs. PC3 PC vs. ZnO 2,500 mg/kg ZnO
Linear4
ZnO
Quad.4
ZnGly
Linear5
ZnGly Quad.5 Zn
Source6
PC vs. Zn source7
Jejunal mucosa
 Chao1 146.7 150.6 148.7 146.4 147.8 142.4 149.4 144.6 145.7 2.4 0.182 0.096 0.048 0.473 0.065 0.472 0.301 0.181
 Shannon 3.96 4.02 3.99 3.99 4.02 4.08 4.06 4.03 4.02 0.04 0.211 0.956 0.039 0.503 0.480 0.966 0.470 0.724
 Simpson 0.947 0.952 0.955 0.951 0.958 0.962 0.961 0.958 0.953 0.003 0.328 0.869 0.070 0.364 0.108 0.374 0.629 0.639

1Data represent the least square means of eight replications except for three treatments: 1) one pig in NC group, 2) one pig in the group fed ZnO at 2,500 mg/kg, and 3) one pig in the group fed ZnGly at 400 mg/kg and ZnO at 700 mg/kg. Pigs had to be removed due to severe BW loss following the IACUC guideline after the statistical confirmation as outliers.

2No challenge.

3F18+E. coli challenge on d 7 after weaning.

4Dose response effects of ZnO supplementation (ZnO at 0, 700, 1,400, and 2,357 mg/kg) with ZnGly at 400 mg/kg.

5Dose response effects of ZnGly supplementation [ZnGly at 0 (PC), 400, 800, and 1,200 mg/kg].

6ZnGly at 400 mg/kg vs. ZnO at 2,500 mg/kg.

7PC vs. ZnGly at 400 mg/kg + ZnO at 2,500 mg/kg.

Table 11.

Relative abundance of jejunal mucosa-associated microbiota at family level of nursery pigs fed diets with varying levels of zinc glycinate (ZnGly) and zinc oxide (ZnO) under F18+E. coli challenge1

Item NC2 PC ZnGly at 400 mg/kg ZnGly
800 mg/kg
ZnGly
1,200 mg/kg
ZnO 2,500 mg/kg P-value
ZnO
0 mg/kg
ZnO
700 mg/kg
ZnO
1,400 mg/kg
ZnO
2,357 mg/kg
SEM NC vs. PC3 PC vs. ZnO 2,500 mg/kg ZnO
Linear4
ZnO
Quad.4
ZnGly
Linear5
ZnGly Quad.5 Zn
Source6
PC vs. Zn source7
Jejunal mucosa
 Alcaligenaceae 2.19 1.83 2.07 2.10 1.97 2.49 2.40 2.97 2.04 0.29 0.241 0.475 0.201 0.258 0.001 0.441 0.933 0.383
 Bacillaceae 2.42 2.36 2.12 2.63 2.22 2.05 2.17 2.28 2.57 0.25 0.834 0.506 0.502 0.181 0.841 0.438 0.159 0.958
 Burkholderiaceae 1.56 1.57 1.27 1.41 1.47 1.36 1.45 1.38 1.27 0.17 0.964 0.210 0.702 0.445 0.612 0.497 0.995 0.150
 Clostridiaceae 16.10 16.22 13.84 17.34 13.56 12.69 12.15 13.47 16.48 1.31 0.951 0.888 0.203 0.170 0.097 0.165 0.161 0.514
 Comamonadaceae 2.33 3.14 4.85 3.19 3.60 4.21 3.39 3.76 3.51 0.72 0.382 0.684 0.685 0.090 0.891 0.304 0.150 0.193
 Deinococcaceae 2.06 1.86 1.59 1.91 1.62 1.73 1.72 1.68 1.83 0.19 0.423 0.891 0.855 0.636 0.606 0.503 0.334 0.474
 Enterobacteriaceae 6.45 7.02 5.19 4.85 6.36 5.17 5.19 6.80 6.10 0.64 0.482 0.254 0.648 0.334 0.796 0.004 0.257 0.051
 Flavobacteriaceae 0.97 1.14 1.01 1.14 1.06 1.09 1.61 1.23 1.16 0.16 0.432 0.920 0.823 0.790 0.221 0.417 0.488 0.776
 Lactobacillaceae 0.47 1.33 0.85 0.42 1.13 0.29 0.52 1.14 0.71 0.50 0.228 0.385 0.619 0.626 0.684 0.276 0.845 0.373
 Methylococcaceae 0.67 0.77 1.65 0.94 1.07 1.22 1.33 0.57 1.20 0.37 0.820 0.363 0.476 0.200 0.528 0.016 0.331 0.110
 Micromonosporaceae 1.42 1.36 1.18 1.77 1.80 1.49 2.03 1.99 1.66 0.29 0.841 0.441 0.530 0.126 0.037 0.846 0.251 0.822
 Mycobacteriaceae 2.26 2.02 1.75 2.01 1.88 1.52 1.86 2.05 1.83 0.20 0.417 0.500 0.328 0.161 0.822 0.257 0.795 0.355
 Nocardiaceae 0.86 1.35 1.37 1.20 1.11 1.37 1.38 2.05 1.29 0.24 0.132 0.834 0.991 0.339 0.047 0.158 0.797 0.926
 Pseudoalteromonadaceae 2.87 3.40 2.79 3.20 3.16 2.68 3.00 2.69 3.25 0.23 0.118 0.666 0.609 0.067 0.071 0.535 0.166 0.195
 Pseudomonadaceae 3.45 3.38 3.76 3.53 3.35 4.17 3.43 3.53 3.41 0.28 0.861 0.955 0.292 0.048 0.931 0.590 0.326 0.527
 Rhizobiaceae 3.71 2.51 2.71 4.63 2.84 2.37 2.96 2.44 1.83 0.91 0.334 0.583 0.439 0.239 0.993 0.679 0.478 0.823
 Sphingomonadaceae 5.59 6.77 9.26 5.46 8.54 7.54 8.91 6.80 4.90 0.92 0.362 0.152 0.634 0.198 0.946 0.015 0.001 0.787
 Staphylococcaceae 13.08 12.12 11.51 11.18 11.96 11.24 10.57 11.57 12.29 1.16 0.529 0.911 0.972 0.820 0.594 0.461 0.612 0.870
 Streptomycetaceae 6.25 5.52 6.56 6.00 6.69 9.41 7.18 7.21 5.60 0.66 0.437 0.935 0.002 0.028 0.059 0.447 0.306 0.492
 Xanthomonadaceae 1.79 2.30 1.83 1.79 2.01 2.57 4.38 1.98 2.00 0.64 0.562 0.731 0.359 0.674 0.565 0.124 0.849 0.613

1Data represent the least square means of 8eight replications except for three treatments: (1) one pig in NC group, (2) one pig in the group fed ZnO at 2,500 mg/kg, and (3) one pig in the group fed ZnGly at 400 mg/kg and ZnO at 700 mg/kg. Pigs had to be removed due to severe BW loss following the IACUC guideline after the statistical confirmation as outliers.

2No challenge.

3F18+E. coli challenge on d 7 after weaning.

4Dose–response effects of ZnO supplementation (ZnO at 0, 700, 1,400, and 2,357 mg/kg) with ZnGly at 400 mg/kg.

5Dose–response effects of ZnGly supplementation [ZnGly at 0 (PC), 400, 800, and 1,200 mg/kg].

6ZnGly at 400 mg/kg vs. ZnO at 2,500 mg/kg.

7PC vs. ZnGly at 400 mg/kg + ZnO at 2,500 mg/kg.

The pharmaceutical use of ZnO at 2,500 mg/kg

In the pre challenge period, supplementation of ZnO at 2,500 mg/kg in the diets did not affect growth performance of nursery pigs (Table 4). In the post challenge period, supplementation of ZnO at 2,500 mg/kg in the diets tended to increase (P = 0.052) BW (8.7–9.5 kg) of nursery pigs challenged with F18+E. coli on day 14. Supplementation of ZnO at 2,500 mg/kg increased (P < 0.05) ADG during days 7 to 14 (244 to 343 g/d) and phase 1 (155 to 210 g/d) and G:F (0.69–0.86) of nursery pigs challenged with F18+E. coli during phase 1. Supplementation of ZnO at 2,500 mg/kg decreased (P < 0.05) fecal score (4.1–3.5) of nursery pigs challenged with F18+E. coli during days 7 to 14 (Table 5).

Supplementation of ZnO at 2,500 mg/kg in the diets did not affect the jejunal morphology and enterocyte proliferation of nursery pigs challenged with F18+E. coli (Table 6). However, supplementation of ZnO at 2,500 mg/kg in the diets decreased (P < 0.05) TNF-α (1.87–1.01 pg/mg) in the jejunum of nursery pigs challenged with F18+E. coli (Table 7). Supplementation of ZnO at 2,500 mg/kg in the diets did not affect gene expressions of zinc and amino acid transporters in the jejunum of nursery pigs challenged with F18+E. coli (Table 8). Supplementation of ZnO at 2,500 mg/kg in the diets tended to reduce (P = 0.096) Chao1 index (150.6–145.7) in the jejunum of nursery pigs challenged with F18+E. coli (Table 9). However, supplementation of ZnO at 2,500 mg/kg in the diets did not affect the relative abundance of jejunal mucosa-associated microbiota at phylum and family levels of nursery pigs challenged with F18+E. coli (Tables 10 and 11).

Table 10.

Relative abundance of jejunal mucosa-associated microbiota at phylum level of nursery pigs fed diets with varying levels of zinc glycinate (ZnGly) and zinc oxide (ZnO) under F18+E. coli challenge1

Item NC2 PC ZnGly at 400 mg/kg ZnGly
800 mg/kg
ZnGly
1,200 mg/kg
ZnO 2,500 mg/kg P-value
ZnO
0 mg/kg
ZnO
700 mg/kg
ZnO
1,400 mg/kg
ZnO
2,357 mg/kg
SEM NC vs. PC3 PC vs. ZnO 2,500 mg/kg ZnO
Linear4
ZnO
Quad.4
ZnGly
Linear5
ZnGly Quad.5 Zn
Source6
PC vs. Zn source7
Jejunal mucosa
 Actinobacteria 13.56 13.10 14.63 12.89 14.12 16.52 15.92 16.26 12.56 1.09 0.754 0.717 0.116 0.075 0.026 0.570 0.167 0.700
 Bacteroidetes 3.14 3.19 3.14 3.30 3.21 3.05 3.37 3.21 3.47 0.27 0.901 0.430 0.721 0.532 0.786 0.826 0.352 0.708
 Cyanobacteria 0.90 0.98 0.72 0.90 0.72 1.11 0.70 0.95 0.88 0.10 0.565 0.487 0.022 0.299 0.816 0.016 0.265 0.151
 Firmicutes 35.79 35.48 31.98 35.92 32.66 29.74 29.14 32.03 37.06 1.95 0.913 0.569 0.219 0.120 0.135 0.107 0.071 0.688
 Proteobacteria 40.28 40.42 43.77 41.35 43.49 43.59 45.51 41.81 39.64 1.70 0.953 0.746 0.816 0.525 0.440 0.043 0.091 0.539
 Spirochaetes 1.98 2.33 1.90 1.62 1.88 2.13 1.71 2.14 2.00 0.29 0.395 0.422 0.441 0.418 0.554 0.147 0.816 0.290
 Others 4.36 4.49 3.84 4.00 3.90 3.84 3.63 3.60 4.38 0.26 0.719 0.768 0.924 0.696 0.013 0.225 0.133 0.227
 F:B8 11.50 11.62 10.48 10.98 10.50 10.46 9.08 10.78 10.99 1.04 0.932 0.664 0.898 0.819 0.397 0.172 0.726 0.482

1Data represent the least square means of 8 replications except for 3 treatments: (1) one pig in NC group, (2) one pig in the group fed ZnO at 2,500 mg/kg, and (3) one pig in the group fed ZnGly at 400 mg/kg and ZnO at 700 mg/kg. Pigs had to be removed due to severe BW loss following the IACUC guideline after the statistical confirmation as outliers.

2No challenge.

3F18+E. coli challenge on day 7 after weaning.

4Dose response effects of ZnO supplementation (ZnO at 0, 700, 1,400, and 2,357 mg/kg) with ZnGly at 400 mg/kg.

5Dose response effects of ZnGly supplementation [ZnGly at 0 (PC), 400, 800, and 1,200 mg/kg].

6ZnGly at 400 mg/kg vs. ZnO at 2,500 mg/kg.

7PC vs. ZnGly at 400 mg/kg + ZnO at 2,500 mg/kg.

8Firmicutes to Bacteroidetes ratio.

Dose response of ZnGly on growth and intestinal health of nursery pigs challenged with F18+E. coli

In the pre challenge period, increasing supplemental levels of ZnGly from 0 to 1,200 mg/kg in the diets did not affect growth performance of nursery pigs (Table 4). In the post challenge period, increasing supplemental levels of ZnGly from 0 to 1,200 mg/kg in the diets tended to linearly decrease average daily feed intake of nursery pigs challenged with F18+E. coli by 10% (P = 0.090; 902 to 808 g/d) during days 21 to 28, by 13% (P = 0.066; 611 to 540 g/d) during days 7 to 28, and by 13% (P = 0.068; 754 to 666 g/d) during phase 2. Increasing supplemental levels of ZnGly from 0 to 1,200 mg/kg in the diets tended to linearly increase (P = 0.092) G:F (0.69–0.81) of nursery pigs challenged with F18+E. coli by 17% during phase 1.

Increasing supplemental levels of ZnGly from 0 to 1,200 mg/kg in the diets linearly decreased (P < 0.05) fecal score (4.1–3.5) of nursery pigs challenged with F18+E. coli by 15% during days 7–14 (Table 5). Increasing supplemental levels of ZnGly from 0 to 1,200 mg/kg in the diets had quadratic effects (P < 0.05) on crypt depth (minimum 259 μm at 654 mg/kg of ZnGly) of nursery pigs challenged with F18+E. coli (Table 6). Increasing supplemental levels of ZnGly from 0 to 1,200 mg/kg in the diets tended to have quadratic effects on TNF-α (P = 0.065; minimum 1.51 pg/mg at 405 mg/kg of ZnGly), IL-8 (P = 0.093; minimum 0.53 ng/mg at 494 mg/kg of ZnGly), and protein carbonyl (P = 0.054; minimum 2.30 pg/mg at 675 mg/kg of ZnGly) in the jejunum of nursery pigs challenged with F18+E. coli (Table 7).

Increasing supplemental levels of ZnGly from 0 to 1,200 mg/kg in the diets tended to linearly enhance the expression of Zn transporters including ZIP4 (P = 0.057; 0.69 to 1.03) and ZnT5 (P = 0.075; 0.92 to 1.22) in the jejunum of nursery pigs challenged with F18+E. coli (Table 8). However, there was no difference in the expression of the amino acid transporters in jejunum of nursery pigs challenged with F18+E. coli by increasing supplemental levels of ZnGly from 0 to 1,200 mg/kg in the diets.

Increasing supplemental levels of ZnGly from 0 to 1,200 mg/kg in the diets tended to linearly decrease (P = 0.065) Chao1 index (150.6–144.6) in the jejunum of nursery pigs challenged with F18+E. coli (Table 9). Increasing supplemental levels of ZnGly from 0 to 1,200 mg/kg in the diets linearly increased (P < 0.05) relative abundance of Actinobacteria (13.10–16.26%) and decreased (P < 0.05) relative abundance of others (4.49–3.60%) at the phylum level in the jejunum of nursery pigs challenged with F18+E. coli (Table 10). Increasing supplemental levels of ZnGly from 0 to 1,200 mg/kg in the diets had quadratic effects (P < 0.05) on relative abundance of Cyanobacteria (minimum 0.67% at 625 mg/kg of ZnGly) and Proteobacteria (minimum 45.6% at 735 mg/kg of ZnGly) at the phylum level in the jejunum of nursery pigs challenged with F18+E. coli.

Increasing supplemental levels of ZnGly from 0 to 1,200 mg/kg in the diets linearly increased (P < 0.05) relative abundance of Alcaligenaceae (1.83–2.97%), Micromonosporaceae (1.36–1.99%), and Nocardiaceae (1.35–2.05%) and tended to linearly decrease relative abundance of Pseudoalteromonadaceae (P = 0.071; 3.40–2.69%) and increase relative abundance of Clostridiaceae (P = 0.097; 16.22–13.47%) and Streptomycetaceae (P = 0.059; 5.52–7.21%) at family level in the jejunum of nursery pigs challenged with F18+E. coli (Table 11). Increasing supplemental levels of ZnGly from 0 to 1,200 mg/kg in the diets had quadratic effects (P < 0.05) on relative abundance of Enterobacteriaceae (minimum 4.79% at 660 mg/kg of ZnGly), Methylococcaceae (maximum 1.45% at 467 mg/kg of ZnGly), and Sphingomonadaceae (maximum 9.40% at 607 mg/kg of ZnGly).

Dose response of ZnO with ZnGly supplementation at 400 mg/kg on growth and intestinal health of nursery pigs challenged with F18+E. coli

In the pre challenge period (weaning to day 7), supplementation of ZnGly reducing the levels of ZnO from 2,357 to 0 mg/kg did not affect (P > 0.10) the growth performance of nursery pigs (Table 4). In the post challenge period, supplementation of ZnGly reducing the levels of ZnO from 2,357 to 0 mg/kg had quadratic effects (P < 0.05) on BW of nursery pigs challenged with F18+E. coli on day 14 (minimum 8.6 kg at 1,100 mg/kg of ZnO in the diets), day 21 (minimum 11.6 kg at 1,063 mg/kg of ZnO), and day 28 (minimum 16.3 kg at 1,100 mg/kg of ZnO). Supplementation of ZnGly reducing the levels of ZnO from 2,357 to 0 mg/kg linearly decreased (P < 0.05) ADG (338 to 256 g/d) of nursery pigs challenged with F18+E. coli by 24% during days 7 to 14. Supplementation of ZnGly reducing the levels of ZnO from 2,357 to 0 mg/kg had quadratic effects (P < 0.05) on ADG of nursery pigs challenged with F18+E. coli during days 7 to 14 (minimum 211 g/d at 738 mg/kg of ZnO), during days 7 to 28 (minimum 438 g/d at 1,043 mg/kg of ZnO), phase 1 (minimum 145 g/d at 1,013 mg/kg of ZnO), and throughout the overall period (minimum 352 g/d at 1,013 mg/kg of ZnO). Supplementation of ZnGly reducing the levels of ZnO from 2,357 to 0 mg/kg linearly decreased (P < 0.05) ADFI (414 to 331 g/d) of nursery pigs challenged with F18+E. coli by 20% during days 7 to 14 and tended to linearly decrease (P = 0.060) ADFI (291 to 248 g/d) of nursery pigs challenged with F18+E. coli by 15% during phase 1. Supplementation of ZnGly reducing the levels of ZnO from 2,357 to 0 mg/kg had quadratic effects (P < 0.05) on ADFI of nursery pigs challenged with F18+E. coli during days 7 to 14 (minimum 352 g/d at 1,013 mg/kg of ZnO), days 7 to 28 (minimum 556 g/d at 989 mg/kg of ZnO), phase 1 (minimum 213 g/d at 905 mg/kg of ZnO), and throughout the overall period (minimum 447 g/d at 1,105 mg/kg of ZnO). Supplementation of ZnGly reducing the levels of ZnO from 2,357 to 0 mg/kg tended to have quadratic effects on ADFI during days 14 to 21 (P = 0.064; minimum 528 g/d at 1,067 mg/kg of ZnO) and phase 2 (P = 0.076; minimum 692 g/d at 1,045 mg/kg of ZnO). Supplementation of ZnGly reducing the levels of ZnO from 2,357 to 0 mg/kg tended to have quadratic effects on G:F during phase 1 (P = 0.095; minimum 0.68 at 1,000 mg/kg of ZnO).

Supplementation of ZnGly reducing the levels of ZnO from 2,357 to 0 mg/kg linearly increased (P < 0.05) fecal score (3.5–4.0) by 14% and tended to have quadratic response on the fecal score (maximum 4.2 at 667 mg/kg of ZnO) of nursery pigs challenged with F18+E. coli during days 7 to 14 during post challenge period (Table 5). Supplementation of ZnGly reducing the levels of ZnO from 2,357 to 0 mg/kg linearly decreased (P < 0.05) crypt depth (285–245 μm) by 16% and enterocyte proliferation (26.3–25.7%) by 2.3% and tended to linearly decrease villus height (515–438 μm) by 18% in the jejunum of nursery pigs challenged with F18+E. coli (Table 6). Supplementation of ZnGly reducing the levels of ZnO from 2,357 to 0 mg/kg linearly decreased (P < 0.05) IL-8 (0.94–0.58 ng/mg of protein) by 39% and MDA (0.49–0.34 μM/mg of protein) by 31% in jejunum of nursery pigs challenged with F18+E. coli (Table 7). However, supplementation of ZnGly reducing the levels of ZnO from 2,357 to 0 mg/kg did not affect the expression of Zn and amino acid transporters in the jejunum of nursery pigs challenged with F18+E. coli (Table 8).

Supplementation of ZnGly reducing the levels of ZnO from 2,357 to 0 mg/kg linearly increased (P < 0.05) Chao1 index (142.2–148.7) by 5% and decreased (P < 0.05) Shannon index (4.08–3.99) by 2% and tended to linearly decrease (P = 0.070) Simpson index (0.962–0.955) by 0.7% in jejunum of nursery pigs challenged with F18+E. coli (Table 9). Supplementation of ZnGly reducing the levels of ZnO from 2,357 to 0 mg/kg linearly decreased (P < 0.05) relative abundance of Actinobacteria (16.52–14.63%) by 11% at the phylum level in the jejunum of nursery pigs challenged with F18+E. coli (Table 10). Supplementation of ZnGly reducing the levels of ZnO from 2,357 to 0 mg/kg tended to have quadratic effects (P = 0.075) on relative abundance of Actinobacteria at the phylum level (minimum 13.59% at 675 mg/kg of ZnO) in the jejunum of nursery pigs challenged with F18+E. coli. Supplementation of ZnGly reducing the levels of ZnO from 2,357 to 0 mg/kg linearly decreased (P < 0.05) relative abundance of Streptomycetaceae (9.41–6.56%) by 30% at family level in the jejunum of nursery pigs challenged with F18+E. coli (Table 11). Supplementation of ZnGly reducing the levels of ZnO from 2,357 to 0 mg/kg had quadratic effects (P < 0.05) on relative abundance of Pseudomonadaceae (minimum 6.15% at 1,000 mg/kg of ZnO) and Streptomycetaceae (minimum 5.91% at 800 mg/kg of ZnO) at the family level in the jejunum of nursery pigs challenged with F18+E. coli. Supplementation of ZnGly reducing the levels of ZnO from 2,357 to 0 mg/kg tended to have quadratic effects on relative abundance of Comamonadaceae (P = 0.090; minimum 3.29% at 1,278 mg/kg of ZnO) and Pseudoalteromonadaceae (P = 0.067; maximum 3.03% at 571 mg/kg of ZnO) at the family level in the jejunum of nursery pigs challenged with F18+E. coli.

Discussion

Enterotoxigenic E. coli is one of the most prominent bacteria responsible for post weaning diarrhea, which negatively impacts swine production. Previous studies demonstrated that enterotoxigenic E. coli attaches to glycoprotein receptors on enterocytes, produces enterotoxins including STa and STb, and induces the imbalance of microbiota in the intestine (Fairbrother et al., 2005; Duarte and Kim, 2022), leading to immune system activation, diarrhea, and thus, growth retardation (Sun and Kim, 2017; Duarte et al., 2020; Sun et al., 2021). In particular, nursery pigs are susceptible to the negative impacts of enterotoxigenic E. coli due to their immature intestinal development (Moeser et al., 2007; Sun and Kim, 2017). Previous studies also showed that pigs challenged with enterotoxigenic E. coli had impaired intestinal barrier functions, and increasing inflammation and oxidative stress with severe diarrhea (Duarte et al., 2020; Xu et al., 2022). In this study, the F18+E. coli challenge successfully impaired the intestinal health of nursery pigs by increasing inflammation and oxidative stress in the jejunal epithelium resulting in damages to intestinal villi and in turn increasing enterocyte proliferation. However, the growth, fecal score, and some intestinal health parameters partly recovered during the second phase of this study. Although the fecal score was increased by the F18+E. coli challenge right after inoculation, the extent of increase was smaller than the results in previous reports (Duarte et al., 2020; Sun et al., 2021).

ZnO has been one of the most common feed additives used in swine diets to control enteric disease and promote the growth of pigs (Poulsen, 1995). However, most countries have legally reduced the excessive use of ZnO in the feeds due to health and environmental concerns (Szuba-Trznadel et al., 2021). With the increase in the need to find alternatives to reducing the pharmaceutical use of ZnO, ZnGly, as an organic form of Zn source in the feeds, has been suggested to replace the use of inorganic Zn sources for the pigs through the relatively high utilization of Zn in the body (Diao et al., 2021). The results of this study show that ZnGly supplementation, especially at a range of 400 to 675 mg/kg in nursery feeds, could reduce the negative impacts of F18+E. coli on the growth and intestinal health of nursery pigs. In addition, ZnGly supplementation at 400 mg/kg in nursery feeds have similar effects to the pharmaceutical use of ZnO, without negatively affecting growth performance of the pigs. Therefore, this study indicates that ZnGly supplementation could be an alternative to the pharmaceutical use of ZnO in the nursery feeds for growth and intestinal health of pigs under the F18+E. coli challenge, reducing Zn supplementation from 1,813 to 104 mg/kg.

Zn is an essential micro-mineral involved in various physiological responses related to cell repair and division, and immune and oxidative responses, possibly due to its function as a cofactor for over 300 metalloenzymes in the body (McCall et al., 2000). In this study, the effects of ZnGly supplementation at a range of 405 to 675 mg/kg in the feeds considerably reduced the concentrations of proinflammatory cytokines, including TNF-α and IL-8, and protein carbonyl, in addition to decreased crypt depth in the jejunum of nursery pigs challenged with F18+E. coli. These results could be related to the need for increased Zn intake, which is significantly elevated by enterotoxigenic E. coli challenge during the postweaning period (Maywald et al., 2017). Mocchegiani and Malavolta (2007) also showed that proinflammatory cytokines could promote the expression of metallothionein and alpha-2-macroglobulin, which are involved in cellular Zn homeostasis and responding to stress and inflammation. According to the NRC (2012), growing pigs need Zn at 100 mg/kg in the feeds for growth and maintenance. In this study, Zn was supplied as Zn sulfate from a mineral premix in the diets to meet the Zn requirement. In this study, the pigs, were not fed with additional Zn sources, were more susceptible to adverse impacts of F18+ E. coli on intestinal health through activation of the immune and oxidative stress responses in the jejunum. Maywald et al. (2017) also described that Zn deficiency could increase susceptibility to inflammatory responses due to acute disruption of the activities and differentiation of immune cells. Kloubert et al. (2018) reported that the Zn-deficient pigs had impaired innate and adaptive immunity with decreased phagocytosis and imbalanced differentiation of T-lymphocytes. Zn can also be essential in alleviating oxidative stress by improving total antioxidant capacity and decreasing activity of superoxide dismutase (Hao et al., 2021).

This study also suggests that the positive changes in intestinal immune and oxidative stress responses of the pigs could be related to glycine as an amino acid compound in ZnGly. According to Yang and Liao (2019), glycine can effectively protect enterocytes from harmful agents because glycine can be a substrate for synthesizing glutathione as an agent to protect from oxidative damage and can also be conjugated with toxin compounds for biochemical detoxification. Ji et al. (2022) showed that glycine supplementation could positively regulate mucosal immunity through the deactivation of gene expression involved in the secretion and signaling of proinflammatory cytokines in the jejunum of nursery pigs. Meléndez-Hevia et al. (2021) also described that glycine could be utilized to synthesize collagen as the main protein of the extracellular matrix, physically protecting the cells from the invasions of microorganisms. According to previous study, supplementation of ZnGly could improve intestinal barrier function and increase gene expression of IL-1β in the jejunal mucosa of nursery pigs (Diao et al., 2021). Therefore, ZnGly supplementation, especially a range of 405 to 675 mg/kg in the feeds, may help to support Zn homeostasis under F18+E. coli challenge to alleviate inflammation and oxidative stress in the jejunum of nursery pigs.

Dietary Zn absorption can be related to a regulatory mechanism to mediate intestinal expression of Zn transporters. In this study, RT–PCR was performed to accurately determine the jejunal mRNA abundance of Zn and amino acid transporters to investigate how ZnGly supplementation can improve the Zn absorption in the jejunum of nursery pigs challenged with F18+E. coli. The ZIP4, ZnT1, and ZnT5 are the main Zn transporters, and GLYT1, a sodium and chloride–dependent glycine-specific transporter, b0,+AT, a neutral amino acid transporter, and y+LAT1, the alternative light subunit that makes up the heterodimeric transport system y + L for cationic and neutral amino acids. In this study, the F18+E. coli challenge decreased the mRNA expression of ZIP4 and ZnT1 in the jejunum of nursery pigs. The ZIP4 is a protein predominantly expressed in the small intestine and responsible for Zn uptake from the extracellular space into the cytoplasm, whereas ZnT1 is a protein of a major Zn transporter abundant along the basolateral membranes of enterocytes and is responsible for cellular Zn efflux to plasma (Cousins, 2010; Hara et al., 2017). Lang et al. (2007) also showed that the inflammation could selectively regulate the mRNA expression of Zn transporters belonging to the Solute Carrier Family 39 (SLC39; ZIP) and Solute Carrier Family 30 (SLC30; ZnT) in a mouse model. Thus, this study shows that the F18+E. coli challenge may negatively affect the Zn homeostasis in the jejunum of nursery pigs.

Increasing supplemental levels of ZnGly from 0 to 1,200 mg/kg linearly increased the mRNA expression of jejunal ZIP4 and ZnT5 in pigs challenged with F18+E. coli without affecting mRNA expression of amino acid transporters. The ZnT5 is responsible for Zn transport from the cytoplasm into the Golgi apparatus for secretary granules, and can contribute to the activity of metalloenzymes in the enterocyte (Wang and Zhou, 2010). Interestingly, a previous study showed the opposite result, as supplementation of ZnGly decreased the mRNA expression level of jejunal ZIP4 in nursery pigs, especially under normal conditions (Diao et al., 2021). Thus, the results in this study could indicate that ZnGly would be efficiently utilized to support intestinal Zn homeostasis in the intestine of nursery pigs under stressful or disease conditions. Furthermore, supplementation of ZnO at various levels did not change the mRNA expression of Zn and amino acid transporters in the jejunum of nursery pigs challenged with F18+E. coli. This could be related to the relatively high bioavailability of chelated minerals rather than inorganic source forms. A possible reason for this observation could be that chelated minerals reach the jejunum without interacting with other compounds, such as phytate, and the Zn ions would be free to be absorbed into intestinal epithelial cells into intestinal epithelial cells (Gupta et al., 2015). Based on previous findings, ZnGly may have a distinctive mode of action to directly support Zn homeostasis and improve the intestinal health of pigs under F18+E. coli challenge.

The desire to understand the function of the intestinal microbiota has been growing as it is highly involved in the intestinal barrier function and its interactions with commensal bacteria for host health and prevention of the invasion of opportunistic harmful bacteria (Shi et al., 2017; Duarte and Kim, 2021). According to previous studies, enterotoxigenic E. coli challenge can cause the imbalance of jejunal microbiota, resulting in a decreased abundance of commensal bacteria, including Firmicutes and Bacteroidetes, and an increased the abundance of opportunistic harmful bacteria such as Proteobacteria, including Helicobacteraceae and Enterobacteriaceae (Duarte et al., 2020; Xu et al., 2022). However, the results in this study show that the F18+E. coli challenge did not change the diversity and relative abundance of mucosa-associated microbiota at phylum and family levels in the jejunum of nursery pigs. According to Luise et al. (2019b), the physiological response of pigs to enterotoxigenic E. coli challenge has been varied, and the dosage of enterotoxigenic E. coli was not clearly defined among previously published articles for the oral inoculated challenge model. The results of this study indicate that the F18+E. coli challenge at 6 × 109 CFU/mL may lead to less severe changes to the biological significance of the consistent impacts of F18+E. coli challenge on jejunal mucosa-associated microbiota of nursery pigs.

Enterobacteriaceae, a large family of Gram-negative bacteria found in the intestine of pigs, is considered opportunistic harmful bacteria and includes Escherichia, Klebsiella, Salmonella, Shigella, and Citrobacter spp, and thus Enterobacteriaceae have been connected to intestinal bowel diseases as these bacteria impaired intestinal barrier function and increase inflammation, oxidative stress, and crypt cell proliferation (Baldelli et al., 2021). According to Duarte and Kim (2022), enterotoxigenic E. coli challenge can also stimulate the overgrowth of Enterobacteriaceae, disrupting the balance of mucosa-associated microbiota in the intestine of pigs. The disrupted microbiota could be related to increased inflammatory response and oxidative stress (Jang et al., 2021). The results in this study show that ZnGly supplementation could reduce the abundance of Enterobacteriaceae, but there is limited information on how ZnGly could directly affect the Gram-negative bacteria or specific pathogenic bacteria that cause intestinal bowel diseases. Xia et al. (2021) described that Zn ions would be utilized upon pathogen invasion to produce several types of antibacterial proteins including calprotectin, psoriasin, and calgranulins, and then these antibacterial proteins lead to inactivation of superoxide defense of bacteria, inducing superoxide formation for antibacterial activity and inhibiting the growth of potential opportunistic harmful bacteria. Based on the results of this study related to changes in the expression of Zn transporters on intestinal epithelium, ZnGly is more likely to reach the intestinal mucosa tissue when compared with ZnO, leading to an effective supply of Zn ions for the modulation of jejunal mucosa-associated microbiota. Ashmead (2001) described that glycine chelation may improve the stability of metal ions possibly due to its low molecular weight among amino acids, and thus, it prevents undesirable chemical reactions in the gastrointestinal tract.

This study also shows that ZnGly supplementation increased relative abundances of Actinobacteria by increasing Micromonosporaceae, Nocardiaceae, Streptomycetaceae, and had quadratic effects on Proteobacteria through a change in relative abundances of Alcaligenaceae, Methylococcaceae Pseudoalteromonadaceae, and Sphingomonadaceae. These changes would be associated with microbial fermentation of two compounds, Zn and glycine, in ZnGly. Actinobacteria is a major phyla in the bacterial community and plays an important role in maintaining intestine homeostasis (Binda et al., 2018). According to Presentato et al. (2020), the microbes belonging to Actinobacteria could be tolerant or resistant to metal compounds, including Zn, within the expected concentration range due to the high mineral utilization such as biosorption, bioaccumulation, biotransformation, and metal efflux processes. Proteobacteria is also one of the most abundant amino acid fermenting bacteria in small intestine (Dai et al., 2011) and glycine would be utilized as a substrate by Proteobacteria for VFA production (Barker, 1981). Ji et al. (2022) also showed glycine supplementation at 2% could reduce the abundance of pathogenic bacteria such as Escherichia, Shigella, Clostridium, and Burkholderiales spp. in the intestine of nursery pigs.

Supplementation of ZnGly could not partially replace the pharmaceutical use of ZnO in the feeds without affecting any performance variables for nursery pigs challenged with F18+E. coli. According to the regression model on the BW gain of nursery pigs challenged by F18+E. coli during post challenge period, the BW gain by the pharmaceutical use of ZnO at 2,500 mg/kg would be equal to BW gain when ZnO was supplemented at 2,300 mg/kg with ZnGly at 400 mg/kg in the diet. However, ZnGly supplementation without the addition of ZnO into the feeds had similar effects on growth performance of the pigs compared with the pharmaceutical use of ZnO at 2,500 mg/kg during post challenge period. This may be because the dose response of ZnO did not rationally follow the inclusion levels. Thus, it could indicate that supplementation of ZnGly at 400 mg/kg would partially reduce the pharmaceutical use of ZnO. However, ZnO supplementation at 700 mg/kg with ZnGly at 400 mg/kg could not alleviate the negative impacts of F18+E. coli on growth performance and diarrhea of the nursery pigs. It could also indicate that the lower level of ZnO, compared with the pharmaceutical level, exacerbated the negative impacts of F18+E. coli challenge on growth of nursery pigs. However, there is limited information about the negative impacts of the low level of ZnO in nursery feeds, and previous studies have shown inconsistency in the dose response of ZnO to growth performance and other variables of interest in nursery pigs (Pieper et al., 2012; Upadhaya et al., 2018; Oh et al., 2021; Hansen et al., 2022). The pharmaceutical use of ZnO has been known as having a strong effect on preventing post weaning diarrhea and promoting the growth of nursery pigs (Kim et al., 2019), but the underlying properties or the mode of action of ZnO are still not well-determined by dose response. In general, the high level of ZnO has been known to have antimicrobial properties by inducing reactive oxygen species in the bacteria (Sharma et al., 2012). Regarding the antimicrobial properties, previous studies interestingly showed that trace amounts of antibiotics below the recommended dose could exacerbate diarrhea and systemic immune response with the imbalance of intestinal microbiota and metabolic modification of nursery pigs challenged with enterotoxigenic E. coli (Kim et al., 2021). Considering the antimicrobial properties, ZnO at low levels may cause intestinal microbiota and metabolic modification in nursery pigs challenged with F18+E. coli. Although this study did not investigate the metabolic conditions of the pigs, the results also show that the jejunal immune response and oxidative stress were exacerbated by ZnO supplementation at the levels lower than the pharmaceutical level with a reduction in the diversity estimates on jejunal mucosa-associated microbiota. However, it was not entirely acceptable, because these changes would be possibly associated with the ratio among the Zn sources, combinational effects, interactions with feedstuff, or relation to E. coli strains. Thus, future studies are needed to determine the negative impacts of lower levels of ZnO as opposed to the pharmaceutical level on the intestinal health of nursery pigs.

This study also shows that Zn glycine supplementation at 400 mg/kg could have analogous effects to pharmaceutical use of ZnO at 2,500 mg/kg on growth performance and diarrhea of the pigs, except during the first week of the post challenged period. It could also indicate that ZnGly had a different mode of action in positively affecting the intestinal health of the pigs challenged with F18+E. coli when compared with the pharmaceutical use of ZnO, especially during the first week of the post challenge period. The significant amount of unabsorbed ZnO would directly affect intestinal microbiota and inhibit the cultivation of F18+E. coli due to the improvements in growth and fecal score during the first week of the post challenge period without the changes in the expression of jejunal Zn transporters. ZnO might directly reduce the negative impacts of F18+E. coli by antimicrobial properties preventing the adhesion to the intestinal epithelium and enterotoxin productions (Fairbrother et al., 2005; Duarte and Kim, 2022). In contrast, ZnGly supplementation reduced the immune and oxidative stress responses with enhancement in the expression of Zn transporters in the jejunum of the pigs. Previous studies have also shown the positive impacts of ZnGly supplementation on Zn bioavailability, growth, and intestinal barrier function of pigs (Nitrayova et al., 2012). Thus, ZnGly would be utilized to indirectly reduce the negative impacts of F18+E. coli on intestinal health by providing high Zn bioavailability to support Zn homeostasis of intestinal epithelium for recovery from the damages sustained during the overall post challenge period.

In conclusion, F18+E. coli challenge negatively affected growth performance and the fecal score of nursery pigs by damaging intestinal villi and increasing jejunal enterocyte proliferation, inflammation, and oxidative stress. Supplementation of ZnGly at a range of 400 to 675 mg/kg could reduce the negative impacts of F18+E. coli on growth performance and diarrhea of nursery pigs. These positive changes are related to reducing jejunal inflammation and oxidative stress by enhancing jejunal Zn absorption with positive changes in jejunal mucosa-associated microbiota in the pigs. Specifically, ZnGly supplementation at 400 mg/kg could effectively reduce the use of ZnO in nursery feeds by having similar effects to the pharmaceutical use of ZnO without negatively affecting growth performance of the pigs. The main reasons for ZnGly at 400 mg/kg capable of replacing pharmaceutical use of ZnO include improved intestinal Zn absorption, reduced intestinal inflammation, and reduced oxidative stress with positive changes in mucosa-associated microbiota in the jejunum.

Acknowledgments

This research was funded by BASF Corporation (Florham Park, NJ), North Carolina Agricultural Foundation (#660101) and USDA National Institute of Food and Agriculture (Hatch #02893). The authors acknowledge technical supports from the members of Kim Lab at North Carolina State University.

Glossary

Abbreviations

AA

amino acid

ADFI

average daily feed intake

ADG

average daily gain

BW

body weight

CP

crude protein

DM

dry matter

DNA

deoxyribonucleic acid

EE

ether extract

ELISA

enzyme-linked immunoassay

GE

gross energy

G:F

gain to feed ratio

STa

heat-stable toxins A

STb

heat-stable toxins B

IL-8

interleukin-8

IgA

immunoglobulin A

IgG

immunoglobulin G

MDA

malondialdehyde

NADH

nicotinamide adenine dinucleotide

OTU

operational taxonomic units

PBS

phosphate-buffered saline

RNA

Ribonucleic acid

RT–qPCR

Quantitative real-time polymerase chain reaction

SID

standard ileal digestibility

TNF-α

tumor necrosis factor alpha

VH:CD

villus height to crypt depth

ZnGly

zinc glycinate

ZnO

zinc oxide

Contributor Information

Ki Beom Jang, Department of Animal Science, North Carolina State University, Raleigh, NC 27695, USA.

Vitor Hugo C Moita, Department of Animal Science, North Carolina State University, Raleigh, NC 27695, USA.

Nicolas Martinez, BASF Corporation, Florham Park, NJ, 07932, USA.

Adebayo Sokale, BASF Corporation, Florham Park, NJ, 07932, USA.

Sung Woo Kim, Department of Animal Science, North Carolina State University, Raleigh, NC 27695, USA.

Conflict of Interest Statement

N. M. and A. S. are employed by the BASF Corporation. All the other authors have no conflict of interest.

LITERATURE CITED

  1. Ashmead, S. D. 2001. The chemistry of ferrous bis-glycinate chelate. Arch. Latinoam. Nutr. 51:7–12. [PubMed] [Google Scholar]
  2. Baldelli, V., Scaldaferri F., Putignani L., and Del Chierico F.. . 2021. The role of Enterobacteriaceae in gut microbiota dysbiosis in inflammatory bowel diseases. Microorganisms. 9:697. doi: 10.3390/microorganisms9040697. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Barker, H. A. 1981. Amino acid degradation by anaerobic bacteria. Annu. Rev. Biochem. 50:23–40. doi: 10.1146/annurev.bi.50.070181.000323. [DOI] [PubMed] [Google Scholar]
  4. Binda, C., Lopetuso L. R., Rizzatti G., Gibiino G., Cennamo V., and Gasbarrini A.. . 2018. Actinobacteria: a relevant minority for the maintenance of gut homeostasis. Dig. liver Dis. Off. J. Ital. Soc. Gastroenterol. Ital. Assoc. Study Liver. 50:421–428. doi: 10.1016/j.dld.2018.02.012. [DOI] [PubMed] [Google Scholar]
  5. Brugger, D., and Windisch W. M.. . 2019. Zn metabolism of monogastric species and consequences for the definition of feeding requirements and the estimation of feed Zn bioavailability. J. Zhejiang Univ. Sci. B. 20:617–627. doi: 10.1631/jzus.b1900024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Case, C. L., and Carlson M. S.. . 2002. Effect of feeding organic and inorganic sources of additional zinc on growth performance and zinc balance in nursery pigs. J. Anim. Sci. 80:1917–1924. doi: 10.2527/2002.8071917x. [DOI] [PubMed] [Google Scholar]
  7. Castillo, M., Martín-Orúe S. M., Taylor-Pickard J. A., Pérez J. F., and Gasa J.. . 2008. Use of mannanoligosaccharides and zinc chelate as growth promoters and diarrhea preventative in weaning pigs: effects on microbiota and gut function1. J. Anim. Sci. 86:94–101. doi: 10.2527/jas.2005-686. [DOI] [PubMed] [Google Scholar]
  8. Cousins, R. J. 2010. Gastrointestinal factors influencing zinc absorption and homeostasis. Int. J. Vitam. Nutr. Res. 80:243–248. doi: 10.1024/0300-9831/a000030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cutler, S. A., Lonergan S. M., Cornick N., Johnson A. K., and Stahl C. H.. . 2007. Dietary inclusion of colicin e1 is effective in preventing postweaning diarrhea caused by F18-positive Escherichia coli in pigs. Antimicrob. Agents Chemother. 51:3830–3835. doi: 10.1128/aac.00360-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Dai, Z.-L., Wu G., and Zhu W.-Y.. . 2011. Amino acid metabolism in intestinal bacteria: links between gut ecology and host health. Front. Biosci. (Landmark Ed.). 16:1768–1786. doi: 10.2741/3820. [DOI] [PubMed] [Google Scholar]
  11. Deng, Z., Duarte M. E., Jang K. B., and Kim S. W.. . 2022. Soy protein concentrate replacing animal protein supplements and its impacts on intestinal immune status, intestinal oxidative stress status, nutrient digestibility, mucosa-associated microbiota, and growth performance of nursery pigs. J. Anim. Sci. 100:1–16. doi: 10.1093/jas/skac255. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Diao, H., Yan J., Li S., Kuang S., Wei X., Zhou M., Zhang J., Huang C., He P., and Tang W.. . 2021. Effects of dietary zinc sources on growth performance and gut health of weaned piglets. Front. Microbiol. 12. doi: 10.3389/fmicb.2021.771617. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Duarte, M. E., and Kim S. W.. . 2021. Intestinal microbiota and its interaction to intestinal health in nursery pigs. Anim. Nutr. 8:169–184. doi: 10.1016/j.aninu.2021.05.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Duarte, M. E., and Kim S. W.. . 2022. Significance of mucosa-­associated microbiota and its impacts on intestinal health of pigs challenged with F18+ E. coli. Pathogens. 11:589. doi: 10.3390/pathogens11050589. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Duarte, M. E., Sparks C., and Kim S. W.. . 2021. Modulation of jejunal mucosa-associated microbiota in relation to intestinal health and nutrient digestibility in pigs by supplementation of β-glucanase to corn–soybean meal-based diets with xylanase. J. Anim. Sci. 99:skab190. doi: 10.1093/jas/skab190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Duarte, M. E., Tyus J., and Kim S. W.. . 2020. Synbiotic effects of enzyme and probiotics on intestinal health and growth of newly weaned pigs challenged with enterotoxigenic F18+Escherichia coli. Front. Vet. Sci. 7:573. doi: 10.3389/fvets.2020.00573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Dwivedi, S., Wahab R., Khan F., Mishra Y. K., Musarrat J., and Al-Khedhairy A. A.. . 2014. Reactive oxygen species mediated bacterial biofilm inhibition via zinc oxide nanoparticles and their statistical determination. PLoS One. 9:e111289. doi: 10.1371/journal.pone.0111289. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. European Parliament and the Council of the European Union. 2003. Regulation (EC) No 1831/2003. Off. J. Eur. Union. 4:29–43. http://eur-lex.europa.eu/legal-content/PT/TXT/?uri=celex:32003R1831. [Google Scholar]
  19. Fairbrother, J. M., Nadeau E., and Gyles C. L.. . 2005. Escherichia coli in postweaning diarrhea in pigs: an update on bacterial types, pathogenesis, and prevention strategies. Anim. Heal. Res. Rev. 6:17–39. doi: 10.1079/ahr2005105. [DOI] [PubMed] [Google Scholar]
  20. Gupta, R. K., Gangoliya S. S., and Singh N. K.. . 2015. Reduction of phytic acid and enhancement of bioavailable micronutrients in food grains. J. Food Sci. Technol. 52:676–684. doi: 10.1007/s13197-013-0978-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hansen, S. V., Nørskov N. P., Nørgaard J. V., Woyengo T. A., Poulsen H. D., and Nielsen T. S.. . 2022. Determination of the optimal level of dietary zinc for newly weaned pigs: a dose-response study. Animals. 12:1552. doi: 10.3390/ani12121552. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hao, Y., Xing M., and Gu X.. . 2021. Research progress on oxidative stress and its nutritional regulation strategies in pigs. Animals. 11:1–21. doi: 10.3390/ani11051384. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Hara, T., Takeda T., Takagishi T., Fukue K., Kambe T., and Fukada T.. . 2017. Physiological roles of zinc transporters: molecular and genetic importance in zinc homeostasis. J. Physiol. Sci. 67:283–301. doi: 10.1007/s12576-017-0521-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Jang, K. B., and Kim S. W.. . 2019. Supplemental effects of dietary nucleotides on intestinal health and growth performance of newly weaned pigs. J. Anim. Sci. 97:4875–4882. doi: 10.1093/jas/skz334. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Jang, K. B., Purvis J. M., and Kim S. W.. . 2020. Supplemental effects of dietary lysophospholipids in lactation diets on sow performance, milk composition, gut health, and gut-associated microbiome of offspring. J. Anim. Sci. 98:skaa227. doi: 10.1093/jas/skaa227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Jang, K. B., Purvis J. M., and Kim S. W.. . 2021. Dose–response and functional role of whey permeate as a source of lactose and milk oligosaccharides on intestinal health and growth of nursery pigs. J. Anim. Sci. 99. doi: 10.1093/jas/skab008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Ji, Y., Fan X., Zhang Y., Li J., Dai Z., and Wu Z.. . 2022. Glycine regulates mucosal immunity and the intestinal microbial composition in weaned piglets. Amino Acids. 54:385–398. doi: 10.1007/s00726-021-02976-y. [DOI] [PubMed] [Google Scholar]
  28. Kim, K., He Y., Jinno C., Kovanda L., Li X., Song M., and Liu Y.. . 2021. Trace amounts of antibiotic exacerbated diarrhea and systemic inflammation of weaned pigs infected with a pathogenic Escherichia coli. J. Anim. Sci. 99. doi: 10.1093/jas/skab073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Kim, K., He Y., Xiong X., Ehrlich A., Li X., Raybould H., Atwill E. R., Maga E. A., Jørgensen J., and Liu Y.. . 2019. Dietary supplementation of Bacillus subtilis influenced intestinal health of weaned pigs experimentally infected with a pathogenic E. coli. J. Anim. Sci. Biotechnol. 10:52. doi: 10.1186/s40104-019-0364-3. [DOI] [Google Scholar]
  30. Kloubert, V., Blaabjerg K., Dalgaard T. S., Poulsen H. D., Rink L., and Wessels I.. . 2018. Influence of zinc supplementation on immune parameters in weaned pigs. J. trace Elem. Med. Biol. organ Soc. Miner. Trace Elem. 49:231–240. doi: 10.1016/j.jtemb.2018.01.006. [DOI] [PubMed] [Google Scholar]
  31. Kulkarni, R. C., Shrivastava H. P., Mandal A. B., Deo C., Deshpande K. Y., Singh R., and Bhanja S. K.. . 2011. Assessment of growth performance, immune response and mineral retention in colour broilers as influenced by dietary iron. Anim. Nutr. Feed Technol. 11:81–90. [Google Scholar]
  32. Lang, C., Murgia C., Leong M., Tan L. W., Perozzi G., Knight D., Ruffin R., and Zalewski P.. . 2007. Anti-inflammatory effects of zinc and alterations in zinc transporter mRNA in mouse models of allergic inflammation. Am. J. Physiol. - Lung Cell. Mol. Physiol. 292:577–584. doi: 10.1152/ajplung.00280.2006. [DOI] [PubMed] [Google Scholar]
  33. Luise, D., Bertocchi M., Motta V., Salvarani C., Bosi P., Luppi A., Fanelli F., Mazzoni M., Archetti I., Maiorano G., . et al. 2019a. Bacillus sp. probiotic supplementation diminish the Escherichia coli F4ac infection in susceptible weaned pigs by influencing the intestinal immune response, intestinal microbiota and blood metabolomics. J. Anim. Sci. Biotechnol. 10:74. doi: 10.1186/s40104-019-0380-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Luise, D., Lauridsen C., Bosi P., and Trevisi P.. . 2019b. Methodology and application of Escherichia coli F4 and F18 encoding infection models in post-weaning pigs. J. Anim. Sci. Biotechnol. 10:53. doi: 10.1186/s40104-019-0352-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Lynegaard, J. C., Kjeldsen N. J., Bache J. K., Weber N. R., Hansen C. F., Nielsen J. P., and Amdi C.. . 2021. Low protein diets without medicinal zinc oxide for weaned pigs reduced diarrhea treatments and average daily gain. Animal. 15:100075. doi: 10.1016/j.animal.2020.100075. [DOI] [PubMed] [Google Scholar]
  36. Maywald, M., Wessels I., and Rink L.. . 2017. Zinc signals and immunity. Int. J. Mol. Sci. 18:1–34. doi: 10.3390/ijms18102222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Mazzoni, M., Merialdi G., Sarli G., Trevisi P., and Bosi P.. . 2010. Effect of two doses of different zinc sources (inorganic vs. chelated form) on the epithelial proliferative activity and the apoptotic index of intestinal mucosa of early-weaned pigs orally challenged with E. coli K88. Asian-Australas. J. Anim. Sci. 23:777–785. doi: 10.5713/ajas.2010.90352. [DOI] [Google Scholar]
  38. McCall, K. A., Huang C., and Fierke C. A.. . 2000. Function and mechanism of zinc metalloenzymes. J. Nutr. 130:1437S–1446S. doi: 10.1093/jn/130.5.1437s. [DOI] [PubMed] [Google Scholar]
  39. Meléndez-Hevia, E., de Paz-Lugo P., and Sánchez G.. . 2021. Glycine can prevent and fight virus invasiveness by reinforcing the extracellular matrix. J. Funct. Foods. 76:104318. doi: 10.1016/j.jff.2020.104318. [DOI] [Google Scholar]
  40. Messner, K. R., and Imlay J. A.. . 1999. The identification of primary sites of superoxide and hydrogen peroxide formation in the aerobic respiratory chain and sulfite reductase complex of Escherichia coli. J. Biol. Chem. 274:10119–10128. doi: 10.1074/jbc.274.15.10119. [DOI] [PubMed] [Google Scholar]
  41. Mocchegiani, E., and Malavolta M.. . 2007. Zinc dyshomeostasis, ageing and neurodegeneration: implications of A2M and inflammatory gene polymorphisms. J. Alzheimers Dis. 12:101–109. doi:10.3233/JAD-2007-12110. [DOI] [PubMed] [Google Scholar]
  42. Moeser, A. J., Vander Klok C., Ryan K. A., Wooten J. G., Little D., Cook V. L., and Blikslager A. T.. . 2007. Stress signaling pathways activated by weaning mediate intestinal dysfunction in the pig. Am. J. Physiol. Liver Physiol. 292:G173–G181. doi: 10.1152/ajpgi.00197.2006. [DOI] [PubMed] [Google Scholar]
  43. Nagy, B., and Fekete P. Z.. . 2005. Enterotoxigenic Escherichia coli in veterinary medicine. Int. J. Med. Microbiol. 295:443–454. doi: 10.1016/j.ijmm.2005.07.003. [DOI] [PubMed] [Google Scholar]
  44. Nitrayova, S., Windisch W., von Heimendahl E., Müller A., and Bartelt J.. . 2012. Bioavailability of zinc from different sources in pigs. J. Anim. Sci. 90:185–187. doi: 10.2527/jas.53895. [DOI] [PubMed] [Google Scholar]
  45. NRC. 2012. Nutrient requirements of swine: eleventh revised edition. Washington, DC: The National Academies Press. [Google Scholar]
  46. Oh, H. J., Kim M. H., Song M. H., Lee J. H., Kim Y. J., Chang S. Y., An J. W., Bin Go Y., Song D. C., Cho H. A., . et al. 2021. Effects of replacing medical zinc oxide with different ratios of inorganic: organic zinc or reducing crude protein diet with mixed feed additives in weaned piglet diets. Animals. 11:1–13. doi: 10.3390/ani11113132. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Pieper, R., Vahjen W., Neumann K., Van Kessel A. G., and Zentek J.. . 2012. Dose-dependent effects of dietary zinc oxide on bacterial communities and metabolic profiles in the ileum of weaned pigs. J. Anim. Physiol. Anim. Nutr. 96:825–833. doi: 10.1111/j.1439-0396.2011.01231.x. [DOI] [PubMed] [Google Scholar]
  48. Poulsen, H. D. 1995. Zinc oxide for weanling piglets. Acta Agric. Scand. Sect. A — Anim. Sci. 45:159–167. doi: 10.1080/09064709509415847. [DOI] [Google Scholar]
  49. Presentato, A., Piacenza E., Turner R. J., Zannoni D., and Cappelletti M.. . 2020. Processing of metals and metalloids by actinobacteria: cell resistance mechanisms and synthesis of metal(loid)-based nanostructures. Microorganisms. 8:2027. doi: 10.3390/microorganisms8122027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Rhouma, M., Fairbrother J. M., Beaudry F., and Letellier A.. . 2017. Post weaning diarrhea in pigs: risk factors and non-colistin-based control strategies. Acta Vet. Scand. 59:31. doi: 10.1186/s13028-017-0299-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Roselli, M., Finamore A., Garaguso I., Britti M. S., and Mengheri E.. . 2003. Zinc oxide protects cultured enterocytes from the damage induced by escherichia coli. J. Nutr. 133:4077–4082. doi: 10.1093/jn/133.12.4077. [DOI] [PubMed] [Google Scholar]
  52. Satessa, G. D., Kjeldsen N. J., Mansouryar M., Hansen H. H., Bache J. K., and Nielsen M. O.. . 2020. Effects of alternative feed additives to medicinal zinc oxide on productivity, diarrhoea incidence and gut development in weaned piglets. Animal. 14:1638–1646. doi: 10.1017/S1751731120000154. [DOI] [PubMed] [Google Scholar]
  53. Sawai, J., Shoji S., Igarashi H., Hashimoto A., Kokugan T., Shimizu M., and Kojima H.. . 1998. Hydrogen peroxide as an antibacterial factor in zinc oxide powder slurry. J. Ferment. Bioeng. 86:521–522. doi: 10.1016/s0922-338x(98)80165-7. [DOI] [Google Scholar]
  54. Sharma, V., Anderson D., and Dhawan A.. . 2012. Zinc oxide nanoparticles induce oxidative DNA damage and ROS-triggered mitochondria mediated apoptosis in human liver cells (HepG2). Apoptosis. 17:852–870. doi: 10.1007/s10495-012-0705-6. [DOI] [PubMed] [Google Scholar]
  55. Shen, J., Chen Y., Wang Z., Zhou A., He M., Mao L., Zou H., Peng Q., Xue B., Wang L., . et al. 2014. Coated zinc oxide improves intestinal immunity function and regulates microbiota composition in weaned piglets. Br. J. Nutr. 111:2123–2134. doi: 10.1017/S0007114514000300. [DOI] [PubMed] [Google Scholar]
  56. Shi, N., Li N., Duan X., and Niu H.. . 2017. Interaction between the gut microbiome and mucosal immune system. Mil. Med. Res. 4:14. doi: 10.1186/s40779-017-0122-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Skiba, G., Raj S., Sobol M., Kowalczyk P., Barszcz M., Taciak M., Tuśnio A., Čobanová K., Grešáková Ľ., and Grela E. R.. . 2022. Influence of the zinc and fibre addition in the diet on biomechanical bone properties in weaned piglets. Animals. 12:1–12. doi: 10.3390/ani12020181. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Sun, Y., Duarte M. E., and Kim S. W.. . 2021. Dietary inclusion of multispecies probiotics to reduce the severity of post-weaning diarrhea caused by Escherichia coli F18+ in pigs. Anim. Nutr. 7:326–333. doi: 10.1016/j.aninu.2020.08.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Sun, Y., and Kim S. W.. . 2017. Intestinal challenge with enterotoxigenic Escherichia coli in pigs, and nutritional intervention to prevent postweaning diarrhea. Anim. Nutr. (Zhongguo xu mu shou yi xue hui). 3:322–330. doi: 10.1016/j.aninu.2017.10.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Szuba-Trznadel, A., Rząsa A., Hikawczuk T., and Fuchs B.. . 2021. Effect of zinc source and level on growth performance and zinc status of weaned piglets. Animals. 11:2030. doi: 10.3390/ani11072030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Upadhaya, S. D., Kim Y. M., Lee K. Y., and Kim I. H.. . 2018. Use of protected zinc oxide in lower doses in weaned pigs in substitution for the conventional high dose zinc oxide. Anim. Feed Sci. Technol. 240:1–10. doi: 10.1016/j.anifeedsci.2018.03.012. [DOI] [Google Scholar]
  62. Wang, Y., Tang J. W., Ma W. Q., Feng J., and Feng J.. . 2010. Dietary zinc glycine chelate on growth performance, tissue mineral concentrations, and serum enzyme activity in weanling piglets. Biol. Trace Elem. Res. 133:325–334. doi: 10.1007/s12011-009-8437-3. [DOI] [PubMed] [Google Scholar]
  63. Wang, X., and Zhou B.. . 2010. Dietary zinc absorption: a play of zips and znts in the gut. IUBMB Life. 62:176–182. doi: 10.1002/iub.291. [DOI] [PubMed] [Google Scholar]
  64. Xia, P., Lian S., Wu Y., Yan L., Quan G., and Zhu G.. . 2021. Zinc is an important inter-kingdom signal between the host and microbe. Vet. Res. 52:39. doi: 10.1186/s13567-021-00913-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Xu, X., Duarte M. E., and Kim S. W.. . 2022. Postbiotics effects of Lactobacillus fermentate on intestinal health, mucosa-associated microbiota, and growth efficiency of nursery pigs challenged with F18 + Escherichia coli. J. Anim. Sci. 100:1–14. doi: 10.1093/jas/skac210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Yang, Z., and Liao S. F.. . 2019. Physiological effects of dietary amino acids on gut health and functions of swine. Front. Vet. Sci. 6:169. doi: 10.3389/fvets.2019.00169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Yoshinobu, M., Kuniaki Y., Shin-ichi K., and Tetsuaki T.. . 2003. Mode of bactericidal action of silver zeolite and Its comparison with that of silver nitrate. Appl. Environ. Microbiol. 69:4278–4281. doi: 10.1128/AEM.69.7.4278-4281.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Zhang, L., Wang Y. -X., Xiao X., Wang J. -S., Wang Q., Li K. -X., Guo T. -Y., and Zhan X. -A.. . 2017. Effects of zinc glycinate on productive and reproductive performance, zinc concentration and antioxidant status in broiler breeders. Biol. Trace Elem. Res. 178:320–326. doi: 10.1007/s12011-016-0928-4. [DOI] [PubMed] [Google Scholar]
  69. Zhang, Y., Ward T. L., Ji F., Peng C., Zhu L., Gong L., and Dong B.. . 2018. Effects of zinc sources and levels of zinc amino acid complex on growth performance, hematological and biochemical parameters in weanling pigs. Asian-Australas. J. Anim. Sci. 31:1267–1274. doi: 10.5713/ajas.17.0739. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Zheng, L., Duarte M. E., Sevarolli Loftus A., and Kim S. W.. . 2021. Intestinal health of pigs upon weaning: challenges and nutritional intervention. Front. Vet. Sci. 8:91. doi: 10.3389/fvets.2021.628258. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Animal Science are provided here courtesy of Oxford University Press

RESOURCES