Linoleic acid ameliorates intestinal mucosal barrier injury in early weaned pigeon squabs (Columba livia)

Abstract

The study aimed to investigate whether linoleic acid could improve the intestinal barrier function of squabs under weaning stress conditions. Totally 320 7-d-old weaned squabs were randomly divided into four treatment groups, including control group (CON), 0.7% linoleic acid addition group (LA007), 1.4% linoleic acid addition group (LA014) and 2.1% linoleic acid addition group (LA021). At 21 d, eight squabs were randomly selected from each treatment group for sampling and determination. The results showed that adding linoleic acid could improve (P < 0.05) the body weight of weaned squabs, and LA014 had the best effect. With the increase of linoleic acid dosage, villi height and villi area increased linearly or quadratically (P < 0.05), and reached the maximum in LA021 or LA014, respectively. The linoleic acid supplementation could improve the intestinal tight junction of weaned squabs, and the LA014 was the most significant (P < 0.05). With the linoleic acid increasing, the levels of intestinal IL-6 and TNF-α decreased linearly (P < 0.05), while intestinal IL-10 increased quadratically (P < 0.05) and reached the maximum in LA014. Serum endotoxin and diamine oxidase levels decreased linearly (P < 0.05) and reached the lowest level in LA014. The ultrastructure of villi revealed that the length of ileal microvilli in LA014 was significantly increased (P < 0.05) and the microvilli became dense, and the mitochondria in epithelial cells returned to normal state. Further exploring the mechanism of linoleic acid alleviating intestinal injury caused by weaning stress in squabs, it was found that linoleic acid down-regulated (P < 0.05) the relative protein expression of TLR4, MyD88, phosphorylated JNK, and phosphorylated p38, reducing secretion of pro-inflammatory factors IL-6 and TNF-α. This study indicated that linoleic acid could alleviate intestinal barrier injury of early weaned squabs by down-regulating TLR4-MyD88-JNK/p38-IL6/TNF-α pathway.

Under weaning stress conditions, linoleic acid could improve the intestinal villus development, strengthen the tight junction, decrease intestinal permeability, and promote the anti-inflammatory factor secretion.

Linoleic acid supplementation could be applied as a means of nutrition regulation to alleviate the intestinal barrier damage caused by early weaning stress in pigeon squabs, reducing the occurrence of intestinal diseases in squabs.

Introduction

Pigeon squab is the main product of the meat pigeon farming industry, which is young pigeon within 4 wk of the age. The squab is considered a senior tonic nourishment, because it tastes delicious, and is rich in amino acids, vitamins and minerals. Recently, the squab has been an important ­representative of high-quality characteristic animal products (Ji et al., 2020; Xu et al., 2020a). In the present-day society, people’s pursuit of food is not only for satiety but also nutrition, hence the consumer demand for squab is gradually increasing, which requires squab production to keep up with market demand. However, as an altricial bird, the squab is unable to ingest feed independently after hatching (Sales and Janssens, 2003). During the rearing process of more than 20 d before reaching the market weight, squabs are fed with crop milk secreted by the parent pigeons in a beak-to-beak manner (Vandeputte-Poma, 1980; Bharathi et al., 1993). Therefore, most pigeon farms still adopt the traditional squab breeding mode, that is, the parents secrete crop milk for squab feeding. This natural feeding of pigeon has restricted the emergence rate of squab, which has become the restriction factor in the pursuit of maximum economic benefits. Under natural conditions, squabs rely entirely on their parents for feeding, and generally leave the nest at 18–28 d of age. Squab “weaning” and leaving from the nest earlier could make the parent pigeons lay eggs 10–20 d earlier, and the annual production of squabs per parent pigeon pair could increase from 6 to 10–15 (Xu et al., 2022). Early weaning of squabs means early artificial feeding. Artificial feeding of early weaned squabs can reduce the burden of breeding pigeons and shorten the breeding cycle, which is an important measure to improve the production efficiency of squabs.

However, similar to early weaned mammals, early weaned squabs also need to undergo a transition from parent feeding to artificial feeding, from the dependent environment where parents and young live together to an independent life, which would inevitably cause severe physiological and psychological stress responses. At present, the artificial feeding technology of 1–7-d-old squabs have not formed a relatively mature method. The squab weaned at this stage is sickly, grow slowly, and the mortality is high. After 7 d of age, the mortality of the weaned squabs decreased greatly, but there was still a distinct gap between early weaned squabs and parent feeding squabs. The growth performance and immunity of early weaned squabs were inferior to those of the parent feeding squabs (Wen et al., 2022). This was mainly due to the immaturity of intestinal barrier function of squabs in early growth and development and the lack of immunoglobulin and other bioactive substances in artificial pigeon milk, which resulted in intestinal mucosal barrier damage of early weaned squabs and thus their susceptibility to diseases (Gillespie et al., 2011). Therefore, the application of nutrients to alleviate the intestinal barrier damage caused by early weaning stress is particularly significant to ensure that the squabs acclimatize to artificial feeding as soon as possible after hatching, thus reducing the occurrence of intestinal diseases and decreasing the mortality of squabs.

Previous study found that fatty acids, not carbohydrates, are the primary source of energy for squabs to maintain the life activities in the early stage of growth and development (Shetty and Hegde, 1991). Further study on the fatty acid composition of pigeon milk showed that linoleic acid was the most abundant polyunsaturated fatty acid, suggesting that it played an important role in the growth and development of squabs (Zhang et al., 2016). Besides, previous studies have also shown that linoleic acid is an essential fatty acid for poultry. Lack of linoleic acid led to adverse consequences such as severely hindered growth and decreased immune resistance of poultry, while diets rich in linoleic acid can promote growth (Watkins, 1991; Sijben et al., 2000). In studies in vitro on small intestine of pigeons, researchers found that only linoleic acid and arachidonic acid (which can be converted from linoleic acid) in pigeon milk instead of other fatty acids significantly increased the expression of intestinal fatty acid-binding protein which is an important carrier of fatty acids specifically expressed in small intestine (Xie et al., 2013). Besides, both linoleic acid and arachidonic acid could promote the intestinal cell proliferation and inhibit the intestinal cell apoptosis (Xie, 2013). Our previous studies have found that the addition of linoleic acid in the parental diet can improve the intestinal immune function and lipid metabolism of squabs under natural feeding, and can be used as a means of nutritional regulation, especially in strengthening the intestinal mucosal barrier of squabs and maintaining the integrity of their intestinal epithelium (Xu et al., 2020b, 2021).

Therefore, questions arose whether the addition of linoleic acid in artificial pigeon milk can alleviate intestinal mucosal barrier damage of early weaned squabs under stress conditions and what is the possible molecular mechanism of regulation. This study aimed to explore these questions by determining the growth performance of squabs, intestinal morphology, gene expression of tight junction proteins, cytokine concentrations, intestinal permeability, ultrastructure of intestinal villus epithelium, and relative protein expression of key proteins of toll-like receptor (TLR) signaling pathway in early weaned squabs.

Materials and Methods

All experimental protocols involving animals were approved by the Animal Care and Welfare Committee of Animal Science College and the Scientific Ethical Committee of Zhejiang University (No. ZJU2013105002) (Hangzhou, China).

Birds and experimental design

A total of 320 early (7-d-old) weaned White King pigeon squabs (Columba livia) were selected on the day 7 post-hatch. They were kept in 3-layer complete ladder cages in a windowed pigeon house with a controlled ventilation regime and a wet curtain cooling system. The squabs were housed two birds per cage (60 cm × 50 cm × 50 cm; length × width × height) with a perch and a nest. These squabs were divided into four groups randomly: the control group (CON), 0.7% linoleic acid addition group (LA007), 1.4% linoleic acid addition group (LA014) and 2.1% linoleic acid addition group (LA021). Each group consisted of 8 replications, and each replication included 10 squabs. The squabs in CON group were fed with artificial pigeon milk (contained 17.76% protein, 13.07 MJ/kg energy and 1.50% linoleic acid) according to our previous study (Xu et al., 2022). The basal formula and nutrient composition are shown in Supplementary Table S1. Three treatment groups were supplemented with three doses of linoleic acid on the basis of artificial pigeon milk. LA (>99.0% purity) was obtained from a commercial supplier (Hebei Bawei Biotechnology Co., Ltd, Handan, China). All experimental diets were isonitrogenous and isocaloric. The LA source was substituted for colleseed oil of the same weight to equalize the total fat level among diets according to Qi et al. (2011). The squabs were given to water ad libitum and were fed three times daily (8:00 a.m., 12:00 noon, and 6:00 p.m.). The ambient temperature was 18–26 °C, and the relative humidity was 60%–70%. The photoperiod was 12:12 (L:D) h throughout the total study period.

Sample collection

On the day 7 post-hatch, eight squabs were randomly selected from each experimental group (one squab per replication) for sampling, respectively. The squabs are weighed before slaughter, and blood samples were collected from wing vein for determining serum endotoxin, diamine oxidase and d-lactate. The selected squabs were sedated and then killed by ­cervical dislocation. Ileal mucosa was collected to assess mRNA expression of intestinal tight junction proteins, concentration of cytokines and protein expression of key proteins related to TLR signal pathway. Ileal sections were collected for morphology analysis and ultrastructural observation.

Intestinal morphology under optical microscope

Approximately 0.5-cm ileal samples were collected and fixed in 10% neutral-buffered formalin solution. Each sample was dehydrated, cleared and embedded in paraffin. Serial sections (5 μm) were placed on glass slides and submitted to hematoxylin–eosin staining. Three staining images per sample were used to identify villus height, villus surface area, crypt depth, and the ratio of villi to crypts (VCR). The examination was performed with optical microscope (Nikon Corp., Tokoyo, Japan) using Image-Pro Plus 6.0 (Media Cybernetics, Inc., Rockville, MD, USA). At least 24 villi and crypts were measured per sample. The villus height and crypt depth were measured using the line tool of software, and the villus surface area was measured using the area tool of software.

RNA extraction and quantitative PCR analysis

Total RNA of the ileal mucosa was extracted using the MolPure^® Cell/Tissue Total RNA Kit (Yeasen Biotech Co., Ltd, Shanghai, China) according to the instructions of the manufacturer. The extracted RNA was quantified by a NanoDrop ND-2000 spectrophotometer (NanoDrop Technologies Inc., Wilmington, DE, USA). The RNA integrity was verified by native RNA electrophoresis on a 1.0% agarose gel. Complementary DNA was synthesised from 1 μg of total RNA by Hifair^® Ⅲ 1st Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus) (Yeasen Biotech Co., Ltd, Shanghai, China) following the protocol of the manufacturer. The abundance of mRNA was assayed on the Bio-Rad CFX Manager 3.0 system (CFX96 Touch, Bio-Rad Laboratories, Inc., Hercules, CA, USA). The specific primers used are shown in Table 1. Hieff qPCR SYBR Green Master Mix (No Rox) (Yeasen Biotech Co., Ltd, Shanghai, China) was used for PCR, which was consisted of an initial DNA denaturation of 95 °C for 5 min and following 40 cycles of 95 °C for 10 s and 60 °C for 30 s. Glyceraldehyde-3-phosphate dehydrogenase was considered an appropriate endogenous reference. The average gene expression relative to the endogenous reference for each sample was calculated according to the 2^−ΔΔCt method (Schmittgen, 2001). The calibrator for each gene in the study was the average ΔCt value of the control group.

Table 1.

Gene-specific primers used for quantitative real-time PCR analysis

Gene	Accession	Primer sequences (5’-3’)	Product size (bp)
CLDN1	XM_005513213.2	TCTTTGGTGGGGTGATGT	109
		TTGACAGGGGTGTAAGGG
CLDN2	XM_021283269.1	GTGCAGATGGGAACAAGGT	119
		GAGCCAAGGAAGCTACGG
CLDN3	XM_005515008.2	ACCTCATCCCCGTCTCCT	109
		CAGCCCACGTAGAGCGA
CLDN4	XM_021282730	AATGAAGCTGTTGGAAGGG	135
		ATCTGGGTTCAAAGATGGC
CLDN16	XM_005513212.2	ACAAAATGCCGTGGACTGTG	134
		GCTGTGATCATCATGGCTCG
OCLN	XM_005509325.2	CAGGACGTGGCAGAGGA	105
		GTGGAAGAGCTTGTTGCGT
TJP1	XM_021299314.1	GAACCAAAGCCAGTGTATG	159
		GGTCCCCTTCCTCTAATC
TJP2	XM_021283254.1	CGTCCTCGGTCGTGTTCATC	228
		TGTAGTGAAACGACCAAGGAAGG
GAPDH	NM_001282835.1	CCGGGCTGCTATTCTCTCTG	141
		TTCCCATTCTCGGCCTTGAC

CLDN, claudin; OCLN, occludin; TJP, tight junction protein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Cytokine concentration analysis

The homogenates of ileal mucosa were prepared with PBS for cytokine concentration analysis. The concentration of interleukin-4 (IL-4), IL-6, IL-10, IL-1β, tumor necrosis factor-α (TNF-α), and interferon-γ (IFN-γ) was determined with commercial ELISA kits (Shanghai Enzyme-linked Biotechnology Co., Ltd, Shanghai, China). The standard samples and diluent solution were added at 100 μL per well in duplicate. The plate was incubated for 2 h at 37 °C, and washed by washing solution for three times. The biotin-antibody was added at 100 μL per well, with incubation at 37 °C for 1 h and washing for five times. The HRP conjugate was added at 100 μL per well, with incubation at 37 °C for 1 h and washing for five times. Next, 100 μL color solution was added into each well and develop color at 37 °C for 15 min. Finally, 50 μL stop solution was added into each well to stop the reaction. The absorbance changes at a wavelength of 450 nm were immediately determined with a SpectraMax M5 microplate reader (Molecular Devices, Sunnyvale, CA, USA). The final cytokine concentration was expressed as picogram per milligram of protein.

Intestinal mucosal permeability

The levels of endotoxin, diamine oxidase, and d-lactate in serum were determined by a SpectraMax M5 microplate reader (Molecular Devices, Sunnyvale, CA, USA) using commercial ELISA kits (Shanghai Enzyme-linked Biotechnology Co., Ltd, Shanghai, China) according to the manufacturer’s protocol.

Villus morphology under transmission electron microscope

Approximately 1 × 3 mm samples of ileum were collected. Samples were first fixed with 2.5% glutaraldehyde in phosphate buffer (0.1 M, pH 7.0) for more than 4 h and washed three times in the phosphate buffer (0.1 M, pH 7.0) for 15 min at each step. Then these samples were postfixed with 1% OsO₄ in phosphate buffer for 1 h and washed three times in the phosphate buffer (0.1 M, pH 7.0) for 15 min at each step. Next, the samples were first dehydrated by a graded series of ethanol (30%, 50%, 70%, 80%, 90%, and 95%) for about 15 min at each step, dehydrated by alcohol for 20 min, and transferred to absolute acetone for 20 min. The samples were placed in 1:1 mixture of absolute acetone and the final Spurr resin mixture for 1 h at room temperature, then transferred to 1:3 mixture of absolute acetone and the final resin mixture for 3 h and to final Spurr resin mixture for overnight. These samples were placed in eppendorf contained Spurr resin and heated at 70 °C for more than 9 h, after which the samples were sectioned in an ultramicrotome (LEICA EM UC7). The sections were stained by uranyl acetate and alkaline lead citrate for 5–10 min, respectively, and observed under transmission electron microscope (Hitachi Model H-7650). The measurement of microvillus length was in line with Karcher and Applegate (2008).

Protein extraction and western blotting

RIPA lysate (strong) was supplemented with 50*cooktail, PMSF (100 mM) and phosphorylase inhibitors before use according to instruction. The ileal mucosa was cut into small pieces and placed in EP tubes, and the lysate was added at a ratio of 50 mg tissue to 1 mL lysate. The samples were homogenized at 4 °C. After centrifugation at 12,000 × g for 5 min, the supernatant was collected, which was the total protein solution. The protein concentration was determined by BCA protein quantitative detection kit. Pregel (4%–20%) (Genscript Biotechnology Co., Ltd) were obtained. The protein sample was added to 1/4 sample volume of 5× protein loading buffer and heated in a metal bath at 95 °C for 10 min to fully denature the protein. Allow to cool to room temperature before loading directly. Electrophoresis was carried out by connecting the electrophoresis apparatus, and the voltage was set to 180 V. Electrophoresis could be stopped when the blue dye reached the bottom of the gel. After electrophoresis, gently pry open the two layers of glass, remove the gel, and cut corners to mark. The PVDF membrane of the same size as the gel was cut and soaked in methanol for 1 min. Place according to the “sandwich” model: black plate, wet sponge, wet thick filter paper, glue, film, wet thick filter paper, wet sponge and red plate. Avoid bubbles during operation. Put the “sandwich” in the membrane transfer box, black on black, red on red. Connect the power supply, set the conditions of transfer parameters: 300 mA, 30 min constant current, and start membrane transfer. After the transfer, the PVDF membrane was obtained and immersed in blocking solution, shielded from light, and blocked on a shaker for 1 h. The PVDF membrane was washed three times with TBST buffer for 5 min each time. After washing, the PVDF membrane was immersed in primary antibody (diluted according to the instructions), shielded from light, and incubated at 4 °C overnight. The antibody was recycled, and the PVDF membrane was washed in TBST buffer for three times. The secondary antibody (diluted according to the instructions) was added and the PVDF membrane was incubated for 1 h at room temperature in darkness. After incubation, the ­secondary antibody was ­recycled, and the PVDF membrane was washed three times with TBST buffer for 5 min each time. The luminescence solution was prepared according to the ECL chemiluminescence kit (Wuhan Servicebio Technology Co. Ltd, Wuhan, China), and the membrane with protein was immersed in the ECL luminescence solution. The reaction was carried out for 2 min at room temperature, and the chemiluminescence detector was used for imaging observation. Analysis of protein bands were performed on Image J.

Statistical analysis

The data obtained from this experiment except ultrastructural observation and protein expression determination were subjected to a one-way analysis of variance in SPSS 24.0 (SPSS Inc., Chicago, USA) for Windows. The differences between means were tested by Tukey’s multiple range test. The effect of age was determined using orthogonal polynomials for linear and quadratic effects. The data obtained from ultrastructural observation and protein expression determination were subjected to an independent-sample t-test in SPSS 24.0 (SPSS Inc., Chicago, USA) for Windows. The level of significance was chosen at P < 0.05. Plotting was performed with GraphPad Prism 8.0 (GraphPad Software Inc., San Diego, USA). Values were presented as means with their standard errors of eight squabs.

Results

Growth performance

Figure 1 shows effects of linoleic acid addition on final body weight, feed intake, and mortality of early weaned squabs. There was no significant difference in initial body weight of squabs among four groups. The final body weight of weaned squabs increased linearly (P = 0.016) and quadratically (P = 0.011) with the increase of linoleic acid supplemental dose, and reached the maximum in LA014 group. The mortality of weaned squabs decreased linearly (P = 0.011) with the increase of linoleic acid supplementation, and the minimum is observed in LA014 group. There was no significant change (P > 0.05) in average daily feed intake among four groups.

Figure 1.

Effects of linoleic acid addition on body weight of early weaned squabs. CON, control group; LA007, 0.7% linoleic acid addition group; LA014, 1.4% linoleic acid addition group; LA021, 2.1% linoleic acid addition group. Values are means ± SEM, n = 8. ^a,b Means sharing no common superscripts differ significantly (Tukey’s test, P < 0.05).

Intestinal morphology under optical microscope

The effects of different levels of linoleic acid on ileal morphology of weaned squabs were observed by hematoxylin and eosin staining sections under optical microscope (Figure 2). The villus height increased linearly (P < 0.001) with the increase of linoleic acid supplemental dose, and reached the maximum value in LA021 group. The villus area increased quadratically (P = 0.019) with the supplementation of linoleic acid increasing, and the maximum value was observed in LA014 group. There was no significant change (P > 0.05) in VCR among four groups. In addition, ileal crypt depth in LA021 group was significantly higher than that in control group.

Figure 2.

Effects of linoleic acid addition on small intestinal morphology of early weaned squabs. (A) villus height, (B) villus area, (C) crypt depth, (D) the ratio of villus height to crypt depth (VCR), (E) hematoxylin–eosin staining of small intestines in four groups. Bar = 200 μm. CON, control group; LA007, 0.7% linoleic acid addition group; LA014, 1.4% linoleic acid addition group‘ LA021, 2.1% linoleic acid addition group. Values are means ± SEM, n = 8. ^a,b Means sharing no common superscripts differ significantly (Tukey’s test, P < 0.05).

Gene expression of tight junction proteins

The effects of linoleic acid addition on the gene expression of tight junction protein in early weaned squabs were shown in Figure 3. With the increase of linoleic acid supplementation, the gene expression levels of claudin1 (CLDN1), tight junction protein1 (TJP1) and occludin (OCLN) were linearly up-regulated (P = 0.002, P < 0.001, P = 0.001, respectively), and reached the maximum in LA014 or LA021 group. The gene expression level of CLDN2 was down-regulated linearly (P = 0.002) and quadratically (P = 0.009) with the increase of linoleic acid supplementation, and reached the minimum in LA014 group. In addition, the CLDN3 gene expression was up-regulated linearly (P = 0.001) and quadratically (P = 0.003) with the supplementation of linoleic acid increasing, and reached the maximum in LA014 group.

Figure 3.

Effects of linoleic acid addition on the gene expression of tight junction protein in early weaned squabs. (A) relative mRNA expression of claudin 1 (CLDN1), (B) relative mRNA expression of claudin 2 (CLDN2), (C) relative mRNA expression of claudin 3 (CLDN3), (D) relative mRNA expression of claudin 4 (CLDN4), (E) relative mRNA expression of claudin 16 (CLDN16), (F) relative mRNA expression of tight junction protein 1 (TJP1), (G) relative mRNA expression of tight junction protein 2 (TJP2), (H) relative mRNA expression of occludin (OCLN). CON, control group, LA007, 0.7% linoleic acid addition group, LA014, 1.4% linoleic acid addition group, LA021, 2.1% linoleic acid addition group. Values are means ± SEM, n = 8. ^a,b Means sharing no common superscripts differ significantly (Tukey’s test, P < 0.05).

Intestinal cytokine concentrations

The effects of linoleic acid addition on cytokine concentrations in ileum of early weaned squabs were shown in Figure 4. The levels of IL-6 and TNF-α in ileum of weaned squabs decreased linearly with the increase of linoleic acid addition (P < 0.001, P = 0.032, respectively). Besides, the IL-10 level showed a quadratic (P = 0.044) increase with the increase of linoleic acid supplementation, and reached the maximum in LA014 group. However, linoleic acid supplementation had no significant effects on levels of IL-1β, IL-4 and IFN-γ in squab ileum (P > 0.05).

Figure 4.

Effects of linoleic acid addition on cytokine concentrations in ileum of early weaned squabs. (A) interleukin-4 (IL-4), (B) IL-6, (C) tumor necrosis factor-α (TNF-α), (D) IL-10, (E) IL-1β, (F) interferon-γ (IFN-γ). CON, control group, LA007, 0.7% linoleic acid addition group, LA014, 1.4% linoleic acid addition group, LA021, 2.1% linoleic acid addition group. Values are means ± SEM, n = 8. ^a,b Means sharing no common superscripts differ significantly (Tukey’s test, P < 0.05).

Intestinal permeability

The effects of linoleic acid addition on the intestinal permeability of squabs were shown in Figure 5. The intestinal permeability of squabs was reflected by the levels of endotoxin, diamine oxidase and D-lactic acid in serum. The level of serum endotoxin decreased linearly (P < 0.001) and quadratically (P = 0.017) with the increase of linoleic acid supplementation, and reached the minimum in LA014 group. However, the supplementation of linoleic acid at different doses had no significant effect on the serum D-lactic acid of early weaned squabs (P > 0.05).

Figure 5.

Effects of linoleic acid addition on indicators of intestinal permeability in early weaned squabs. (A) serum D-lactic acid, (B) serum endotoxin, (C) serum diamine oxidase. CON, control group, LA007, 0.7% linoleic acid addition group, LA014, 1.4% linoleic acid addition group, LA021, 2.1% linoleic acid addition group. Values are means ± SEM, n = 8. ^a,b Means sharing no common superscripts differ significantly (Tukey’s test, P < 0.05).

Ultrastructure of villous epithelium

The effects of linoleic acid addition on the ultrastructure of intestinal villus epithelium in early weaned squabs were shown in Figure 6. The intestinal villus epithelium was observed under transmission electron microscope at 20,000×. It was found that the length of microvilli in the brush border of ileum villi in the LA014 group was significantly increased (P < 0.01) compared to that in the control group. Besides, the microvilli became dense and the mitochondria in the epithelial cells returned to their normal state.

Figure 6.

Effects of linoleic acid addition on the ultrastructure of intestinal villus epithelium in early weaned squabs. (A) Ultrastructure under transmission electron microscope. That marked in white circle are the swollen vacuolated mitochondria. The arrow points to the microvilli. (B) Microvilli length. ** represents extremely significant difference between the two groups, P < 0.01. Bar = 500 nm. CON, control group, LA014, 1.4% linoleic acid addition group.

Relative protein expression

The effects of linoleic acid addition on the relative protein expression of TLRs in the ileum of early weaned squabs were shown in Figure 7. LA014 group significantly increased the relative protein expression of TLR4 in weaned squabs (P < 0.01), while linoleic acid supplementation had no significant effect on the relative protein expression of TLR2 (P > 0.05). The effects of linoleic acid supplementation on the relative protein expression of adapter protein MyD88 in the ileum of early weaned squabs were shown in Figure 8. The relative protein expression of MyD88 in LA014 group was significantly lower than that in CON group (P < 0.01).

Figure 7.

Effects of linoleic acid addition on the relative protein expression of toll-like receptors (TLRs) in ileum of early weaned squabs. * represents P < 0.05 between the two groups. CON, control group, LA014, 1.4% linoleic acid addition group.

Figure 8.

Effects of linoleic acid addition on the relative protein expression of MyD88 in ileum of early weaned squabs. ** represents P < 0.01 between the two groups. CON, control group, LA014, 1.4% linoleic acid addition group.

The effects of linoleic acid addition on the relative expression of key molecular proteins of mitogen-activated protein kinase (MAPK) pathway in the ileum of early weaned squabs were shown in Figure 9. Linoleic acid supplementation significantly decreased the protein expression levels of phosphorylated jun N-terminal kinase (JNK) and phosphorylated p38 mitogen-activated protein kinase (p38) (both P < 0.01). However, the relative expression of JNK and p38 protein did not change significantly. Compared with CON group, the expression levels of extracellular signal-regulated kinase (ERK) and phosphorylated ERK protein in LA014 group had no significant changes (P > 0.05).

Figure 9.

Effects of linoleic acid addition on the relative expression of key molecular proteins of mitogen-activated protein kinase pathway in ileum of early weaned squabs. JNK, Jun N-terminal kinase, ERK, extracellular signal-regulated kinase, p38, p38 mitogen-activated protein kinase. ** represents P < 0.01 between the two groups. CON, control group, LA014, 1.4% linoleic acid addition group.

The effects of linoleic acid addition on the relative expression of key molecular proteins of NF-κB pathway in the ileum of early weaned squabs were shown in Figure 10. Linoleic acid addition had no significant effect on the relative protein expression of IκBα, phosphorylated IκBα and p65NF-κB in the ileum of squabs (P > 0.05).

Figure 10.

Effects of linoleic acid addition on the relative expression of key molecular proteins of NF-κB pathway in ileum of early weaned squabs. ** represents P < 0.01 between the two groups. CON, control group, LA014, 1.4% linoleic acid addition group.

Discussion

Previous studies on weaning stress mainly focus on young mammals. As described, early weaning is an important and complex event in the life of piglets that may result in oxidative damage, increased release of pro-inflammatory cytokines, weakened immune responses, loose tight junctions, and impaired barrier function in intestine (Boudry et al., 2004; Pié et al., 2004; Moeser et al., 2007; Hu et al., 2013; Yin et al., 2014). Pigeon squabs are altrices with immature intestinal development and weak intestinal mucosal immune function. Similar in early weaned piglets, weaning stress changed intestinal structure and function of squabs, including villus atrophy, impaired barrier function and increased intestinal mucosal permeability according to our previous work (Xu et al., 2022). However, considering the economic benefits, early weaning and artificial feeding need be applied to squabs. Therefore, how to alleviate the injury induced by early weaning stress in squabs is a problem demanding prompt solution. Previously, we found that linoleic acid supplementation in parental diet can be used as a nutritional regulation method for squabs, especially in maintaining the integrity of intestinal epithelium and strengthening the intestinal barrier (Xu et al., 2021). Based on the preliminary work, the current study investigated the regulation of linoleic acid on growth and intestinal barrier function of squabs under stress conditions by adding proper amount of linoleic acid to ordinary artificial pigeon milk.

As is well-known, squabs are famous for their meat, and the meat production ability is an important economic index. The muscle yield tends to be proportional to body weight in squabs (Gao et al., 2016). In our current study, the body weight of weaned squabs increased linearly and quadratically with the increase of linoleic acid supplementation. The result indicated that linoleic acid could alleviate the growth retardation of squabs caused by early weaning, which was beneficial to production efficiency. Previous studies have demonstrated that functional maturation of the small intestine involving morphological and physiological changes is a major factor limiting early optimal growth in birds (Konarzewski et al., 1990). Therefore, the growth promotion effect of linoleic acid on weaned squabs may be due to the alleviating effect on intestinal function injury of early weaned squabs.

Intestinal morphology, such as villus height, villus area and crypt depth, are the most basic points reflecting intestinal function (Li et al., 2019). In the present study, the villus height and villus area of weaned squabs showed linear or quadratic growth with the increasing addition of linoleic acid, respectively, suggesting that linoleic acid improved the intestinal villus development of weaned squabs. The intestinal epithelium is a first-line protective barrier between the host and the external environment against enteric pathogens, food antigens, and physiological and chemical stress (Buzza et al., 2010; Pinton et al., 2012). Intestinal epithelial cells are the main component of intestinal epithelium (Hui et al., 2019), which consume energy when performing functions. And mitochondria are responsible for providing energy for cells (Kahlert et al., 2016). The ultrastructure under transmission electron microscope showed that linoleic acid increased the length and density of brush border microvilli in villous epithelial cells of the ileum, and the mitochondria in epithelial cells returned to normal form from vacuolation state, suggesting that linoleic acid could alleviate mitochondrial damage in intestinal epithelial cells caused by weaning stress. Tight junctions exist between each individual enterocyte (Karcher and Applegate, 2008). These tight junctions form a major barrier in the intercellular space that regulates the movement of water and solutes across the epithelium (Anderson et al., 2001). The protein composition of tight junctions mainly includes claudins and occludin (Khatlab et al., 2019). The family of claudins play different functions and can be roughly divided into two categories: one involved in barrier formation and the other important in channel formation (Colegio et al., 2002). The gene expression of ileal tight junction proteins showed that addition of linoleic acid (mainly 1.4%–2.1%) could strengthen the intestinal epithelial tight junction of early weaned squabs by up-regulating the gene expression of “tight” tight junction proteins and down-regulating the gene expression of “loose” tight junction protein, which could reduce intestinal permeability and lessen bacterial translocation. The decreased levels of endotoxin and diamine oxidase in serum also confirmed that linoleic acid reduced intestinal permeability and strengthened intestinal barrier. Previously, we have studied on intestinal barrier injury and its mechanism in early weaned squab, and found that weaning stress could activate MyD88-mediated MAPK (ERK/JNK) signaling pathway by upregulation of TLR2/4 to induce the secretion of pro-inflammatory cytokines IL-6 and TNF-α, produce inflammatory response, affect the intestinal flora of squab, and cause intestinal mucosal barrier dysfunction (data unpublished). In this study, linoleic acid was shown to ­alleviate the damage of intestinal barrier function induced by early weaning stress. There comes the problem, that is, what is the regulatory mechanism.

By determining the cytokine levels in the ileal mucosa, we found that the secretion of pro-inflammatory cytokines IL-6 and TNF-α decreased linearly with the increase of linoleic acid addition, which means that linoleic acid promoted the weakening of inflammatory response. Therefore, we suspect that linoleic acid could achieve the alleviating effect by inhibiting TLR signaling pathway activated by weaning stress. Next, the relative protein expression of TLR2 and TLR4 was measured, and it was found that adding linoleic acid had no significant effect on the relative protein expression of TLR2, while the protein level of TLR4 was significantly down-regulated, suggesting that the alleviating effect of linoleic acid is to down-regulate the expression of subsequent pathways by inhibiting TLR4 rather than TLR2. MyD88 is a key adaptor molecule in TLR signaling pathway, which plays an important role in upstream information transmission and immune response mediation (Verstak et al., 2009). The adaptor protein MyD88 is required for the ultimate induction of TNF-α and IL-6 in pathways by TLR4. In the current study, linoleic acid significantly reduced the protein level of MyD88, thus, we hypothesized that linoleic acid might inhibit the subsequent MyD88-mediated signaling pathway by down-regulating TLR4. Under the premise of MyD88-dependent pathway, the key molecules of NF-κB pathway and MAPK pathway community were next determined. The protein expression of IκBα, phosphorylation IκBα and p65NF-κB in the NF-κB pathway showed that linoleic acid did not affect NF-κB pathway in intestine of early weaned squabs. The MAPK family includes three MAPK signaling cascades, namely JNK, ERK and p38 (Xiao et al., 2002; Shifflett et al., 2004). The three MAPK signaling cascades are considered to be parallel pathways, but there may be crosstalk between them. In this experiment, there was no significant change in the protein expression of phosphorylated ERK, but the protein expression of phosphorylated JNK and phosphorylated p38 were significantly decreased, suggesting that linoleic acid could inhibit MyD88-mediated MAPK (JNK/p38) signaling pathway by down-regulating TLR4, reduce the secretion of pro-inflammatory factors such as IL-6 and TNF-α, and weaken the inflammatory response, alleviating intestinal epithelial barrier damage in weaned squabs. In the study of Li et al. (2020), β-carotene also attenuated weaning induced apoptosis by inhibiting JNK/p38 MAPK signaling pathway in the jejunum of piglets. The results suggest that linoleic acid does inhibit the TLR/MAPK signaling pathway activated by weaning stress, but the specific pathways are not completely consistent based on our previous study (data unpublished). Notably, in the determination of cytokine secretion levels, we found a significant increase in the anti-inflammatory factor IL-10, suggesting that the alleviation of weaning stress by linoleic acid may be more than inhibiting the MyD88-mediated MAPK (JNK/p38) signaling pathway. Studies have shown that the intestinal metabolite of linoleic acid, 10-hydroxy-12-octadecanoic acid, can significantly improve the anti-inflammatory ability (IL-10/TNF-α ratio) of LDS-stimulated dendritic cells (mDCs), down-regulate the pro-inflammatory response, and simultaneously activate the nuclear factor erythroid 2-induced cell protective defenses in mDCs and rat intestinal epithelial cell line (Bergamo et al., 2014). Thus, it seems reasonable to speculate that the alleviation of weaning stress by linoleic acid might be related to IL-10 involved signaling pathways and the corresponding anti-inflammatory ability. Further research is needed to follow up. In the future, we should try to culture squab intestinal epithelial cells to further explore and verify the signal network of relieving stress by linoleic acid in vitro.

In conclusion, under weaning stress conditions, linoleic acid could down-regulate the expression of TLR4-MyD88-MAPK (JNK/p38) pathway to reduce the secretion of pro-inflammatory factors such as IL-6 and TNF-α, weaken the inflammatory response, and alleviate the intestinal epithelial barrier damage of weaned squabs, specifically by promoting the development of intestinal villi, strengthening the tight junction, reducing intestinal permeability, and promoting the secretion of anti-inflammatory factors.

Glossary

Abbreviations

CLDN

claudin

CON

control group

ERK

extracellular signal-regulated kinase

IFN-γ

interferon-γ

IL

interleukin

JNK

jun N-terminal kinase

LA007

0.7% linoleic acid addition group

LA014

1.4% linoleic acid addition group

LA021

2.1% linoleic acid addition group

MAPK

mitogen-activated protein kinase

OCLN

occluding

p38

p38 mitogen-activated protein kinase

TJP

tight junction protein

TLR

toll-like receptor

TNF-α

tumor necrosis factor-α

VCR

ratio of villi to crypts

Acknowledgments

This work was supported by Zhejiang Provincial Natural Science Foundation (LY22C170002) and National Natural Science Foundation of China (31902173).

Conflict of Interest Statement

The authors declare that they have no conflict of interests.

Consent for Publication

Not applicable.

Availability of Data and Materials

All data generated or analyzed during this study are included in this published article.