Identification of Bulinus forskalii as a potential intermediate host of Schistosoma hæmatobium in Senegal

Papa Mouhamadou Gaye; Souleymane Doucouré; Doudou Sow; Cheikh Sokhna; Stéphane Ranque

doi:10.1371/journal.pntd.0010584

. 2023 May 9;17(5):e0010584. doi: 10.1371/journal.pntd.0010584

Identification of Bulinus forskalii as a potential intermediate host of Schistosoma hæmatobium in Senegal

Papa Mouhamadou Gaye ^1,^2,^3,⁴, Souleymane Doucouré ², Doudou Sow ⁵, Cheikh Sokhna ^2,³, Stéphane Ranque ^2,^3,^*

Editor: Wannaporn Ittiprasert⁶

PMCID: PMC10198482 PMID: 37159452

Abstract

Understanding the transmission of Schistosoma hæmatobium in the Senegal River Delta requires knowledge of the snails serving as intermediate hosts. Accurate identification of both the snails and the infecting Schistosoma species is therefore essential. Cercarial emission tests and multi-locus (COX1 and ITS) genetic analysis were performed on Bulinus forskalii snails to confirm their susceptibility to S. hæmatobium infection. A total of 55 Bulinus forskalii, adequately identified by MALDI-TOF mass spectrometry, were assessed. Cercarial shedding and RT-PCR assays detected 13 (23.6%) and 17 (31.0%), respectively, Bulinus forskalii snails parasitized by S. hæmatobium complex fluke. Nucleotide sequence analysis identified S. hæmatobium in 6 (11.0%) using COX1 and 3 (5.5%) using ITS2, and S. bovis in 3 (5.5%) using COX1 and 3 (5.5%) using ITS2. This result is the first report of infection of Bulinus forskalii by S. hæmatobium complex parasites in Senegal using innovative and more accurate identification methods to discriminate this snail and characterize its infection by S. hæmatobium.

Author summary

Schistosomiasis is one of the most important neglected tropical diseases in the world. It is caused by blood flukes of the genus Schistosoma. In Senegal, the species Schistosoma hæmatobium is the most widespread and responsible for urinary Schistosomiasis in humans. Freshwater snails of the genus Bulinus including Bulinus truncatus, Bulinus globosus, Bulinus senegalensis and Bulinus umbilicatus are its main intermediate hosts. However, Bulinus forskalii, morphologically similar to Bulinus senegalensis is also frequently found but no study has ever mentioned its sensibility to S. hæmatobium in Senegal. The aim of our research is to reveal the relevance of Bulinus forskalii as a potential intermediate host of S. hæmatobium but also to provide an accurate identification of this snail. This study demonstrated the susceptibility of Bulinus forskalii to the S. hæmatobium parasite in Senegal by using innovative and refined identification methods to discriminate this snail and to characterize its infection. This result significantly contributes to the improvement of our knowledge on host-parasite interactions and should be taken into account in future epidemiological studies and schistosomiasis control programs.

Introduction

Snails of the genus Bulinus (Müller, 1781) are intermediate hosts for the larval development of trematodes parasite species of the Schistosoma hæmatobium species complex in Africa, the eastern Mediterranean, and Madagascar [1]. Several species of the S. hæmatobium group are endemic in Africa, notably S. hæmatobium, S. intercalatum, S. guineensis, S. bovis and S. curassoni. Only the first three are involved in human diseases [2,3]. Urogenital schistosomiasis, caused by S. hæmatobium (Bilharz, 1852), is present in most countries on the African continent [4], especially in all regions of Senegal [5]. Schistosoma hæmatobium is highly endemic in sub-Saharan Africa, where 600 million people are at risk of infection, and 200 million urinary schistosomiasis cases [6], including 150,000 deaths [7], are recorded per year.

In endemic areas, transmission of S. hæmatobium involves various freshwater gastropod snails species of the genus Bulinus [8–10]. In Senegal, Bulinus truncatus, Bulinus senegalensis, Bulinus globosus and Bulinus umbilicatus are the main intermediate hosts of S. hæmatobium [9,11,12]. Bulinus forskalii (Ehrenberg, 1831) occurs in the north in the Senegal River, in areas of permanent transmission of S. hæmatobium [10,13]. It is an area with perennial water (streams, ponds, irrigation networks…) and is the preferred habitat of Bulinus forskalii [14]. Bulinus forskalii is often misidentified as Bulinus senegalensis, a species with which it shares similar morphological features and often the same biotopes [15]. Bulinus senegalensis is found in abundance in areas with seasonal transmission, particularly in the center of the country [9], in cohabitation with Bulinus forskalii. The species Bulinus senegalensis shows a strong resistance to the drying up of temporary pools during drought compared to other intermediate host snails of Schistosomes [16].These two species are genetically similar and form, with Bulinus camerunensis, the Bulinus forskalii group [15,17]. The presence of Bulinus forskalii has been reported to be involved in S. bovis, S. guineensis, and S. intercalatum biological cycle in Western and Central Africa [3,18,19]. Whereas this Bulinus species has never been reported to be infected with S. hæmatobium in Senegal [20], previous studies have indicated that Bulinus forskalii could be a potential intermediate host for S. hæmatobium in Niger [21]. The main limitation of these finding was that the snails had been identified on morphological features. And identification errors cannot be excluded due to the known morphological similarity between Bulinus forskalii and Bulinus senegalensis [15].

The correct identification of intermediate host snails based on morphological and molecular (sequencing) criteria has limitations [22]. Morphological identification requires highy skilled experts, a specific documentation (good and updated identification keys) and also intact specimens. DNA-based identification is relatively time consuming costly, and the reference nucleotide sequence databases, notably Genbank, are not exhaustive.

Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) has revolutionized microbial identification in clinical microbiology. It has also used been successfully used in entomology for rapid identification of many arthropods including mosquitoes, ticks, lice, fleas, and bed bugs [23–26]. More recently, this tool has been presented as an alternative tool for rapid identification of bivalve snails [27] and medically important gastropods [28]. Because MALDI-TOF MS is relatively fast, low-cost, it could be advantageously used for the high-throughput rapid identification of snail populations in schistosomiasis control programs. Therefore, this study was aimed to assess the involvement of Bulinus forskalii as a potential intermediate host of S. hæmatobium and to provide an accurate identification of this snail.

Methods

Snail collection and morphological identification

Snails were collected as part of a malacological survey conducted in the Senegal River Delta (SRD) in September 2020. The SRD represents the terminal part of the Senegal River located in the northwest of the country (between latitudes 16°/14°40’N and longitudes 15°30/16°30’W), in the region of Saint-Louis. It is a marginal-littoral zone [29], covering an area of 6,000 km² (Fig 1A). Its density is 13.7 inhabitants/km² with a higher human concentration near the main water bodies [29,30]. Irrigated rice cultivation and artisanal fishing are the main activities carried out by the populations [16–18]. The SRD is characterized by a semi-desert climate with an average rainfall of approximately 300–400 mm [31]. The area has become endemic to schistosomiasis with perennial transmission dynamics [32] since the construction of the Diama and Manantali dams in the 1980s.

Fig 1 — (A) A map of Senegal showing the snail sampling site, the Senegal River Delta (between latitudes 16°/14°40’N and longitudes 15°30/16°30’W), located in the Saint-Louis region. The map was produced using the Geographic Information System software QGIS v3.18.3-Zürich; http://www.qgis.org. (B) Morphological features of the *Bulinus forskalii* snail species analyzed in the current study (Sinister, brownish shell with a shoulder angle and twisted columellar lip).

The snails were collected at water points located along the riverbanks. They were collected from aquatic plants, leaves, and dead branches in the water using a scoop net and a soft claw or by hand for some snails attach to the underside of aquatic vegetation. Snails from the same water point were placed together in the same pre-labelled containers (locality name, collection date) containing cold water to inhibit cercarial excretion during transport. The taxonomic status of the collected snails was assessed by microscopy (Zeiss Axio Zoom.V16, Zeiss, Marly-le-Roi, France) using the Mandahl-Barth identification key [33] based on snail shell morphology. Several species were collected but only snails identified as Bulinus forskalii were included in this study. The species Bulinus forskalii presents a shell with a sinister opening, brownish to whitish, shouldered and strongly keeled with presence of a shoulder angle. The columellar lip is torse (Fig 1B).

Cercarial shedding test

Cercarial shedding tests were then performed, by placing individual snails in the wells of a glass pillbox (24 wells) containing 5–10 ml of filtered water. All collected snails were then exposed to electric light for 30 min to 1 h to stimulate cercarial shedding. Schistosoma cercariae released from the snails were observed and identified morphologically using a binocular magnifying glass and a taxonomic key [34] but not kept (Fig 2). The snails were classified into infected and non-infected batches and stored in the laboratory at -80°C.

MALDI-TOF MS identification of snails

Each snail specimen (n = 55) was carefully extracted from its shell and dissected with a new sterile lame for Deoxyribo Nucleic Acid (DNA) extraction and Matrix Assisted Laser Desorption/Ionization-Time of Flight Mass Spectrometry (MALDI-TOF MS) analysis. The feet of the snails were used for MALDI-TOF MS identification as described by Hamlili et al. (2021) [28]. The feet were successively rinsed with 70% ethanol and distilled water for 2 min and dried on sterile filter paper. They were then individually placed in 1.5 ml Eppendorf tubes with glass beads (Sigma, Lyon, France) and a mix containing 70% (v/v) formic acid (Sigma), 50% (v/v) acetonitrile (Fluka, Buchs, Switzerland), and high-quality liquid chromatography (HPLC) water. All samples were ground with 30μl of the mix using a TissueLyser II (Qiagen, Hilden, Germany) on three 1-min cycles at a frequency of 30 Hertz.

After centrifugation at 2000 rpm for 30 seconds, 1 μl of the supernatant from each homogenate was deposited on a MALDI-TOF MS target plate (Bruker Daltonics, Wissembourg, France) in 10 replicates. Each deposit was covered with one microlitre of a CHCA matrix suspension consisting of saturated α-cyano-4 hydroxycinnamic acid (Sigma, Lyon. France), 50% acetonitrile (v/v), 2.5% trifluoroacetic acid (v/v) (Aldrich, Dorset, UK), and HPLC grade water to allow co-crystallization. After drying for several minutes at room temperature, the target was introduced into the MALDI-TOF Microflex LT mass spectrometer (Bruker Daltonics, Breman, Germany) for analysis. To confirm the morphological identification of the snails, the MALDI TOF MS spectra obtained from the foot of each specimen were compared to the reference spectra from the in-house database (available at https://doi.org/10.35088/f605-3922) [28] using MALDI-Biotyper v3.0 software (Bruker Daltonics). The homemade reference spectra database already contains (n = 64) reference spectra of freshwater gastropod snails from Senegal (S1 Table). The blind test identification quality is estimated via log score values (LSV) (range 0 from 3), which quantifies the degree of identity between the query and the reference spectra in the database. A sample is considered correctly identified when the LSV value is ≥ 1.7.

A dendrogram was performed using MALDI-Biotyper v.3.0 software to visualize the level of heterogeneity of MS spectra from Bulinus forskalii, Bulinus senegalensis and Biomphalaria pfeifferi specimens as out-group. MS protein profiles from one to seven specimens of each snail species were randomly selected and used to create a dendrogram. Similarly Principal Component Analysis (PCA) performed using ClinProTools 2.2 software.

DNA extraction

The remaining body of each specimen was used for genomic DNA extraction as a substrate to detect the parasite and confirm the molecular identity of the snails. DNA was extracted using the EZ1 DNA Tissue kit (Qiagen) following the manufacturer’s recommendations. Each snail specimen was placed in a 1.5 mL Eppendorf tube and incubated at 56°C overnight in 180 μl of G2 lysis buffer (Qiagen Hilden, Germany) and 20 μl of proteinase K (Qiagen Hilden, Germany). The supernatant was recovered in another tube and then extracted using the EZ1 BioRobot extraction device (Qiagen Hilden, Germany). Genomic DNA from each sample was eluted with 200 μl of Tris-EDTA buffer (Qiagen) and stored at -20°C until use.

Real-time PCR (RT-PCR) and PCR sequencing

Real-time PCR was used to detect Schistosoma hæmatobium group in all DNA extracts from Bulinus forskalii snails. The RT-PCR reaction targets the sequence of the highly repeated region Dra1 specific to the S. hæmatobium group [35]. The primers used Sh-FW and Sh-RV (Table 1), were identical to those initially described by Hamburger et al.[35] and the probe utilized was described by Cnops et al.[36]. The qPCR reaction was performed using a CFX96 thermal cycler (Bio-Rad, Marnes-la-Coquette, France) in a 20 μL reaction mixture containing 5 μL of DNA,10 μL of the Master Mix, 3.5 μL of sterile distilled water, and 0.5 μl of each of the primers and the TaqMan probe (Applied Biosystems, Foster City, CA, USA). Our amplification program consisted of an initial 2-min denaturation step at 50°C followed by a 3-min denaturation at 95°C, then 40 cycles of 95°C for 30 s and 60°C for 1 min before holding the sample at 4°C. For each qPCR plate, negative (sterile distilled water) and positive (S. hæmatobium egg DNA extract) controls were used. Samples with a cycle threshold (Ct) value less than 35 were considered positive.

Table 1. Primers used in the real-time PCR, Schistosoma parasite and snails sequencing protocols.

Primer sequences and names are given with the target marker, target organism and amplicon length.

Primer names	Marker	Target organism	Length	Primer sequences (5’-3’)	Authors
Real-time PCR
Sh- FW	DraI	Schistosoma hæmatobium complex	120	GATCTCACCTATCAGACGAAAC	Hamburger et al. (2001) [35]
Sh- RV				TCACAACGATACGACCAAC	Hamburger et al. (2001) [35]
Probe (FAM 5’- 3’ZEN)				TGTTGGTGGAAGTGCCTGTTTCGCAA	Cnops et al. (2013) [36]
Schistosoma spp. sequencing
Asmit1	COX1	Schistosoma spp.	-	TTTTTTGGTCATCCTGAGGTGTAT	Webster et al. (2010) [37]
Sh.R		S. hæmatobium	543	TGATAATCAATGACCCTGCAATAA
Sb.R		S. bovis	306	CACAGGATCAGACAAACGAGTACC
ITS2_Schisto_F	ITS2	Schistosoma spp.	±369	GGAAACCAATGTATGGGATTATTG	Schols et al. (2019) [38]
ITS2_Schisto_R	ITS2	Schistosoma spp.		ATTAAGCCACGACTCGAGCA	Schols et al. (2019) [38]
Snail sequencing
LCO1490	COX1	Snails	±710	GGTCAACAAATCATAAAGATATTGG	Folmer et al. (1994) [39]
HC02198	COX1	Snails		TAAACTTCAGGGTGACCAAAAAATCA	Folmer et al. (1994) [39]

Open in a new tab

"±": possible variation in amplicon length due to interspecific variation

Only RT-PCR positive samples were subjected to PCR sequencing of cytochrome C oxidase subunit I (COX1) [37] and the second internal transcribed spacer (ITS2) of the rRNA gene [38] to identify parasites within the S. hæmatobium group including S. hæmatobium and S. bovis. DNA obtained from each specimen was used for PCR reaction. The amplification reaction was performed in a thermal cycler (Applied Biosystems, 2720, Foster City, U.S.A.) with AmpliTaq Gold 360 PCR master mix (Applied Biosystems, Waltham, MA., U.S.A.) using universal forward primer Asmit1 and reverse primers (Sh and Sb) and ITS2 with primers Schisto_F and Schisto_R (Table 1) [37,38]. The amplification protocol was carried out with initial denaturation at 95°C for 15 min, with 39 cycles at 95°C for 30 s, 58°C for 1 min (at 56°C for 1 min 30 s for ITS2), 72°C for 1 min, and a final step at 72°C for 7 min.

The amplified products were purified using a Macherey Nagel plate (NucleoFast 96 PCR, Düren, Germany) and sequenced using the same primers. Sequencing was performed using BigDye Terminator v1.1, v3.15x Sequencing Buffer (Applied Biosystems, Warrington, UK) and run on an ABI 3100 automated sequencer (Applied Biosystems). The resulting sequences were assembled and corrected using Chromas Pro v.1.77 (Technelysium Pty. Ltd, Tewantin, Australia) and BioEdit v. 7.0.5.3 to be used for a Basic Local Alignment Search Tool (BLAST) search on the National Center for Biotechnology Information (NCBI) online database (http://blast.ncbi.nlm.nih.gov).

The Bulinus forskalii MS identification was confirmed by nucleotide sequence-based analysis of the Folmer region of COX1. The same protocol as the one above was applied for sequencing the Folmer region using universal primers LCO1490 and HCO2198 (Table 1) [39]. However, the PCR amplification program here consists of an initial denaturation at 95°C for 15 min, with 40 cycles at 95°C for 30s, at 40°C for 30 s, 72°C for 1min 30s and a final stage at 72°C for 7 min.

Results

MS identification of snails

All snails were identified as Bulinus forskalii by MALDI-TOF MS with log scores ranging from 1.89 to 2.63 [mean (SD) = 2.31 (0.20)] and reproducible spectra, indicative of a reliable identification (S1 Fig). Dendrogram analysis revealed specific clustering on distinct branches of snails by species. The specimens of the same species were clustered in the same part of the MSP dendrogram (Fig 3A). Principal component analysis (PCA) using ClinProTools 2.2 software showed that snail specimens of the same species cluster together (Fig 3B).

Fig 3 — (A) Dendrogram constructed using MALDI-Biotyper v.3.3 software including representative random MS spectra of *Bulinus forskalii* (green), *Bulinus senegalensis* (red) and *Biomphalaria pfeifferi* (blue). (B) Principal component analysis (PCA) performed on spectra of *Bulinus forskalii* (green), *Bulinus senegalensis* (red) and *Biomphalaria pfeifferi* (blue) using ClinProTools 2.2.

Molecular identification of snails and detection of S. hæmatobium complex infection

Bulinus forskalii identification were further confirmed by 100.00% identity with the COX-Folmer of Bulinus forskalii (GenBank Accession No: OM535893.1) [3,22]. In the 55 Bulinus forskalii specimens, 13 (23.6%) and 17 (30.9%) were infected with Schistosoma parasites with the cercarial shedding tests or the Dra1-RT-PCR, respectively (S2 Table). The percentage of infected snails observed by the cercarial shedding test did not significantly differ from that obtained with real-time PCR (χ2 = 0.41, df = 1, p = 0.52). The RT-PCR was positive (Cycle threshold (Ct) ≤ 35) in each snail that shed cercariae (S2 Table).

DNA sequence-based identification of Schistosoma spp. parasites

The COX1 nucleotide sequence further identified six (10.9%) S. hæmatobium, and three (5.5%) S. bovis. In contrast, ITS2 nucleotide sequence based identification yielded three (5.5%) for both S. hæmatobium and S. bovis. BLAST query of the NCBI nucleotide database identified either S. hæmatobium or S. bovis, as detailed in Table 2.

Table 2. MALDI-TOF MS identification of the snail parasitized by S. hæmatobium complex fluke, and COX1 and ITS2 DNA sequence-based identification of the Schistosoma spp. parasites.

Samples ID	Snail species ID by MS	LSV	cercarial shedding test^*	RT-PCR (Ct)	Schistosomes species ID by Cox1 (% Identity)	GB Accession No^**	Schistosomes species ID by ITS2 (% identity)	GB Accession No^**
KABfI4	Bulinus forskalii	2.37	(+)	29.43	S. hæmatobium (100.00%)	MT579447.1	NA^***	-
KABfI5	Bulinus forskalii	2.60	(+)	29.23	S. hæmatobium (99.78%)	MT579447.1	NA	-
KABfNI5	Bulinus forskalii	1.89	(-)	28.57	S. hæmatobium (99.78%)	MT579447.1	NA	-
S20BfI7	Bulinus forskalii	2.55	(+)	23.01	S. hæmatobium (99.78%)	MT579447.1	S. bovis (100.00%)	MT580958.1
S20BfI9	Bulinus forskalii	2.56	(+)	31.17	S. hæmatobium (99.78%)	MT579447.1	NA	-
S20BfI10	Bulinus forskalii	2.63	(+)	25.00	NA	-	S. hæmatobium (100.00%)	MT580959.1
KSD2BfI1	Bulinus forskalii	2.29	(+)	19.39	S. bovis (99.23%)	MT159594.1	S. bovis (100.00%)	MT580958.1
KSD2BfI4	Bulinus forskalii	2.38	(+)	25.41	S. bovis (99.61%)	MT159594.1	S. bovis (100.00%)	MT580958.1
S9BfNI1	Bulinus forskalii	2.31	(-)	34.94	S. hæmatobium (100.00%)	MT579447.1	S. hæmatobium (100.00%)	MT580959.1
SOBfNI1	Bulinus forskalii	2.11	(-)	33.88	S. bovis (99.61%)	MT159594.1	S. hæmatobium (100.00%)	MT580959.1

Open in a new tab

*Cercarial shedding test: (+), positive; (-), negative.

** Accession numbers of the Nucleotide GenBank sequences with the highest identity percentage

*** NA: not available, because of sequencing failure

Discussion and conclusion

Studies aiming to detect and identify parasites of the S. hæmatobium group in snails are scarce in Senegal. Our findings demonstrate that Bulinus forskalii can be parasitized by S. hæmatobium complex fluke, in particular, S. hæmatobium s.s., S. bovis s.s and by S. hæmatobium x S. bovis hybrids. Our findings contrast with those of Tian-Bi et al. [40] who found no infected Bulinus forskalii based on cercarial shedding tests. Nevertheless, studies conducted in Bulinus senegalensis and Bulinus umbilicatus in central Senegal have shown similar results [11]. The evidence of S. hæmatobium cercariae excretion by Bulinus forskalii demonstrates that this snail is an intermediate host, in which the parasite develops from miracidium to the cercaria.

In our study, all the snails that were positive in the shedding test were also positive in the RT-PCR, but the reverse was not true. This could be explained by the fact that parasites are excreted only at maturity in the shedding test whereas RT-PCR is able to detect them at all stages of their development in the snail. Our results do not show a statistically significant difference between the two techniques, which could be related to our relatively small sample size. However, other studies have shown that the cercarial shedding test largely underestimates snail infection when compared to PCR-based assays [41–43].

Identification of snail hosts is essential for mapping the transmission and risk of transmission of human and animal schistosomiasis. Some snail specimens, especially those belonging to related species such as Bulinus forskalii and Bulinus senegalensis, are often difficult to identify as mentioned in some previous studies [14,15]. Here, Bulinus forskalii was identified by sequencing and MALDI-TOF MS. The latter is a robust identification tool validated in several snail species [28] which might be particularly advantageous in large epidemiological surveys.

Morphological misidentification may also be related to invisible characters of snail specimens or to changes in their shells induced by environmental parameters. In our study, all intact and good quality specimens of Bulinus forskalii with well-preserved shells were correctly identified by morphology but had to be confirmed by another identification method, MALDI-TOF MS. The use of MALDI-TOF MS thus removed any ambiguity related to the identification of our snails with the advantage of economizing on time and consumables. Previous studies of the same type have presented ambiguities or errors in the identification of the species Bulinus forskalii. A study by McCullough et al. [44] identified snails involved in the transmission of S. hæmatobium and S. bovis as Bulinus forskalii, however, their species status was later confirmed as Bulinus senegalensis by Smithers [45]. This shows the importance of rapid and more reliable identification tools including MALDI-TOF MS.

In numerous previous studies, the snail species Bulinus forskalii had not been identified as a natural S. hæmatobium host in Senegal [12,14,32]. The evidence that Bulinus forskalii can be an intermediate host of S. hæmatobium complex parasites which are in the main schistosomiasis agents in Senegal, is a significant advancement of knowledge on host-parasite interactions. It should be taken into account in further epidemiological surveys and schistosomiasis control programs. The main limitation of our study is that discrepant ITS2 and COX1-based identification in a given snail specimen can be interpreted either as an infection with one hybrid parasite or a co-infection with two distinct parasite species. Further studies on isolated cercariae should give a final answer this open question.

Supporting information

S1 Table. List of Gastropod species present in our homemade MALDI-TOF MS database.

(DOCX)

Click here for additional data file.^{(15.6KB, docx)}

S2 Table. Detailed results of MALDI-TOF MS identification, cercarial emission test and RT-PCR detection of S. hæmatobium complex performed of all snails.

(DOCX)

Click here for additional data file.^{(25.4KB, docx)}

S1 Fig

(A) Distinction of MALDI-TOF MS spectra of Bulinus forskalii (blue) and Bulinus senegalensis (red), illustrated by the spectral profiles of some specimens. a.u.: arbitrary units; m/z: mass/charge ratio. (B) Superimposed spectra of Bulinus forskalii (blue) and Bulinus senegalensis (red) with visually observed discriminating peaks indicated by black arrows.

(TIF)

Click here for additional data file.^{(1.1MB, tif)}

Acknowledgments

The authors would like to thank the population of the Senegal River Delta for their support.

Data Availability

All relevant data are within the manuscript and its Supporting Information files; all described nucleotide sequences have been deposited in the NCBI GenBank nucleotide data base. All reference nucleotide sequences used to identify snails and their parasites are from the NCBI GenBank nucleotide database and can be viewed by BLAST on http://blast.ncbi.nlm.nih.gov. The reference spectra of our in-house MALD-TOF MS database are available and can be downloaded with the following DOI number: https://doi.org/10.35088/f605-3922. The accession numbers detailed in the manuscript are: GenBank Accession No: OM535893.1, OQ860246, OQ860247 (MT579447.1, MT159594.1, MT580958.1, MT580959.1).

Funding Statement

DS was funded by the Département Soutien et Formation, Institut de Recherche pour le Développement (https://www.ird.fr/), Grant Number: DA08022018. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Tchuem Tchuenté L-A, Southgate VR, Jourdane J, Webster BL, Vercruysse J. Schistosoma intercalatum: an endangered species in Cameroon? Trends Parasitol. 2003;19: 389–393. doi: 10.1016/s1471-4922(03)00193-4 [DOI] [PubMed] [Google Scholar]
2.Webster BL, Southgate VR, Littlewood DTJ. A revision of the interrelationships of Schistosoma including the recently described Schistosoma guineensis. International Journal for Parasitology. 2006;36: 947–955. doi: 10.1016/j.ijpara.2006.03.005 [DOI] [PubMed] [Google Scholar]
3.Kane RA, Stothard JR, Emery AM, Rollinson D. Molecular characterization of freshwater snails in the genus Bulinus: a role for barcodes? Parasit Vectors. 2008;1: 15. doi: 10.1186/1756-3305-1-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Chitsulo L, Engels D, Montresor A, Savioli L. The global status of schistosomiasis and its control. Acta Trop. 2000;77: 41–51. Available: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5633072/ doi: 10.1016/s0001-706x(00)00122-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Webster BL, Diaw OT, Seye MM, Faye DS, Stothard JR, Sousa-Figueiredo JC, et al. Praziquantel treatment of school children from single and mixed infection foci of intestinal and urogenital schistosomiasis along the Senegal River Basin: monitoring treatment success and re-infection patterns. Acta Trop. 2013;128: 292–302. doi: 10.1016/j.actatropica.2012.09.010 [DOI] [PubMed] [Google Scholar]
6.Niangaly H, Djimde AA, Traore B, Sangare CPO, Guindo D, Konate D, et al. Variations saisonnières de l’infestation par les helminthes intestinaux et Schistosoma haematobium en zone rurale sahélienne au Mali. Médecine et Santé Tropicales. 2012;22: 430–434. doi: 10.1684/mst.2012.0123 [DOI] [PubMed] [Google Scholar]
7.Gryseels B, Polman K, Clerinx J, Kestens L. Human schistosomiasis. Lancet. 2006;368: 1106–1118. doi: 10.1016/S0140-6736(06)69440-3 [DOI] [PubMed] [Google Scholar]
8.Sellin Bertrand, Simonkovich Emeric, Roux J. Etude de la répartition des mollusques hôtes intermédiaires des schistosomes en Afrique de l’Ouest: premiers résultats. Médecine Tropicale. 1980;40: 31–39. [PubMed] [Google Scholar]
9.Senghor B, Diaw OT, Doucoure S, Seye M, Talla I, Diallo A, et al. Study of the snail intermediate hosts of urogenital schistosomiasis in Niakhar, region of Fatick, West central Senegal. Parasit Vectors. 2015;8. doi: 10.1186/s13071-015-1030-z [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Bakhoum S, Ndione RA, Haggerty CJE, Wolfe C, Sow S, Ba CT, et al. Influence of physicochemical parameters on the spatial distribution of snail species that are intermediate hosts of human schistosomes in the Senegal River Delta. Médecine et Santé Tropicales. 2019;29: 61–67. doi: 10.1684/mst.2019.0883 [DOI] [PubMed] [Google Scholar]
11.Gaye PM, Doucoure S, Senghor B, Faye B, Goumballa N, Sembène M, et al. Bulinus senegalensis and Bulinus umbilicatus Snail Infestations by the Schistosoma haematobium Group in Niakhar, Senegal. Pathogens. 2021;10: 860. doi: 10.3390/pathogens10070860 [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Picquet M, Ernould JC, Vercruysse J, Southgate VR, Mbaye A, Sambou B, et al. The epidemiology of human schistosomiasis in the Senegal river basin. Transactions of the Royal Society of Tropical Medicine and Hygiene. 1996;90: 340–346. doi: 10.1016/S0035-9203(96)90501-5 [DOI] [PubMed] [Google Scholar]
13.Haggerty CJE, Bakhoum S, Civitello DJ, Leo GAD, Jouanard N, Ndione RA, et al. Aquatic macrophytes and macroinvertebrate predators affect densities of snail hosts and local production of schistosome cercariae that cause human schistosomiasis. PLOS Neglected Tropical Diseases. 2020;14: e0008417. doi: 10.1371/journal.pntd.0008417 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Joof E, Sanneh B, Sambou SM, Wade CM. Species diversity and distribution of schistosome intermediate snail hosts in The Gambia. PLoS Negl Trop Dis. 2021;15: e0009823. doi: 10.1371/journal.pntd.0009823 [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Zein-Eddine R, Djuikwo-Teukeng FF, Al-Jawhari M, Senghor B, Huyse T, Dreyfuss G. Phylogeny of seven Bulinus species originating from endemic areas in three African countries, in relation to the human blood fluke Schistosoma haematobium. BMC Evol Biol. 2014;14: 271. doi: 10.1186/s12862-014-0271-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Diaw OT, Seye M, Sarr Y. [Resistance to drought of mollusks of the genus Bulinus, vectors of human and animal trematode infections in Senegal. II. Study under natural conditions in the North-Sudan area. Ecology and resistance to drought of Bulinus umbilicatus and B. senegalensis]. Rev Elev Med Vet Pays Trop. 1989;42: 177–187. [PubMed] [Google Scholar]
17.Akinwale OP, Hock TT, Chia-Kwung F, Zheng Q, Haimo S, Ezeh C, et al. Differentiating Schistosoma haematobium from Schistosoma magrebowiei and other closely related schistosomes by polymerase chain reaction amplification of a species specific mitochondrial gene. Trop Parasitol. 2014;4: 38–42. doi: 10.4103/2229-5070.129163 [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Abbasi I, King CH, Sturrock RF, Kariuki C, Muchiri E, Hamburger J. Differentiation of Schistosoma haematobium from related schistosomes by pcr amplifying an inter-repeat sequence. The American Journal of Tropical Medicine and Hygiene. 2007;76: 950–955. doi: 10.4269/ajtmh.2007.76.950 [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Diaw OT, Vassiliades G. Epidémiologie des schistosomoses du bétail au Sénégal. Revue d’Elevage et de Médecine Vétérinaire des Pays Tropicaux. 1987;40: 265–274. Available: https://agritrop.cirad.fr/400749/ [PubMed] [Google Scholar]
20.Southgate VR, Rollinson D, Ross GC, Knowles RJ, Vercruysse J. On Schistosoma curassoni, S. haematobium and S. bovis from Senegal: development in Mesocricetus auratus, compatibility with species of Bulinus and their enzymes. Journal of Natural History. 1985;19: 1249–1267. doi: 10.1080/00222938500770801 [DOI] [Google Scholar]
21.Labbo R, Djibrilla A, Garba A, Chippaux J-P. Bulinus forskalii: a new potential intermediate host for Schistosoma haematobium in Niger. Transactions of the Royal Society of Tropical Medicine and Hygiene. 2007;101: 847–8. doi: 10.1016/j.trstmh.2007.03.016 [DOI] [PubMed] [Google Scholar]
22.Raahauge P, Kristensen TK. A comparison of Bulinus africanus group species (Planorbidae; Gastropoda) by use of the internal transcribed spacer 1 region combined by morphological and anatomical characters. Acta Trop. 2000;75: 85–94. doi: 10.1016/s0001-706x(99)00086-8 [DOI] [PubMed] [Google Scholar]
23.Boucheikhchoukh M, Laroche M, Aouadi A, Dib L, Benakhla A, Raoult D, et al. MALDI-TOF MS identification of ticks of domestic and wild animals in Algeria and molecular detection of associated microorganisms. Comparative Immunology, Microbiology and Infectious Diseases. 2018;57: 39–49. doi: 10.1016/j.cimid.2018.05.002 [DOI] [PubMed] [Google Scholar]
24.Mewara A, Sharma M, Kaura T, Zaman K, Yadav R, Sehgal R. Rapid identification of medically important mosquitoes by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Parasites & Vectors. 2018;11: 281. doi: 10.1186/s13071-018-2854-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Ouarti B, Laroche M, Righi S, Meguini MN, Benakhla A, Raoult D, et al. Development of MALDI-TOF mass spectrometry for the identification of lice isolated from farm animals. Parasite. 2020;27. doi: 10.1051/parasite/2020026 [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Yssouf A, Almeras L, Raoult D, Parola P. Emerging tools for identification of arthropod vectors. Future Microbiology. 2016;11: 549–566. doi: 10.2217/fmb.16.5 [DOI] [PubMed] [Google Scholar]
27.Stephan R, Johler S, Oesterle N, Näumann G, Vogel G, Pflüger V. Rapid and reliable species identification of scallops by MALDI-TOF mass spectrometry. Food Control. 2014;46: 6–9. doi: 10.1016/j.foodcont.2014.04.047 [DOI] [Google Scholar]
28.Hamlili F, Thiam F, Laroche M, Doucoure S, Gaye P, Fall C, et al. MALDI-TOF mass spectrometry for the identification of freshwater snails from Senegal, including intermediate hosts of schistosomes. PLOS Neglected Tropical Diseases. 2021;15: e0009725. doi: 10.1371/journal.pntd.0009725 [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Ernould J. C., Ba K. Epidémiologie des bilharzioses humaines: évolution récente dans le bas-delta du Sénégal. In: Hervé Jean-Pierre [ed.], Brengues Jacques[ed.]. Aménagements hydro-agricoles et santé (vallée du fleuve Sénégal). Paris: ORSTOM, (Colloques et Séminaires). Eau et Santé: Colloque, Dakar (SEN), 1994/11/14-15. Paris: Paris: ORSTOM; 1998. [Google Scholar]
30.Kamara S. Développements hydrauliques et gestion d’un hydrosystème largement anthropisé: le delta du fleuve Sénégal.: 472. [Google Scholar]
31.Abdellahi M, Ndir O, Niang S. Assessment of schistosomiasis prevalence among children 5 to 14 years old after several years of mass drug administration in the Senegal River basin. Sante Publique. 2016;28: 535–540. [PubMed] [Google Scholar]
32.Southgate VR. Schistosomiasis in the Senegal River Basin: before and after the construction of the dams at Diama, Senegal and Manantali, Mali and future prospects. J Helminthol. 1997;71: 125–132. doi: 10.1017/s0022149x00015790 [DOI] [PubMed] [Google Scholar]
33.Mandahl-Barth G. Key to the identification of East and Central African freshwater snails of medical and veterinary importance. Bull World Health Organ. 1962;27: 135–150. Available: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2555811/ [PMC free article] [PubMed] [Google Scholar]
34.Frandsen F, Christensen NO. An introductory guide to the identification of cercariae from African freshwater snails with special reference to cercariae of trematode species of medical and veterinary importance. Acta Trop. 1984;41: 181–202. [PubMed] [Google Scholar]
35.Hamburger J, He-Na null, Abbasi I, Ramzy RM, Jourdane J, Ruppel A. Polymerase chain reaction assay based on a highly repeated sequence of Schistosoma haematobium: a potential tool for monitoring schistosome-infested water. Am J Trop Med Hyg. 2001;65: 907–911. doi: 10.4269/ajtmh.2001.65.907 [DOI] [PubMed] [Google Scholar]
36.Cnops L, Soentjens P, Clerinx J, Esbroeck MV. A Schistosoma haematobium-Specific Real-Time PCR for Diagnosis of Urogenital Schistosomiasis in Serum Samples of International Travelers and Migrants. PLOS Neglected Tropical Diseases. 2013;7: e2413. doi: 10.1371/journal.pntd.0002413 [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Webster BL, Rollinson D, Stothard JR, Huyse T. Rapid diagnostic multiplex PCR (RD-PCR) to discriminate Schistosoma haematobium and S. bovis. Journal of Helminthology. 2010;84: 107–114. doi: 10.1017/S0022149X09990447 [DOI] [PubMed] [Google Scholar]
38.Schols R, Carolus H, Hammoud C, Mulero S, Mudavanhu A, Huyse T. A rapid diagnostic multiplex PCR approach for xenomonitoring of human and animal schistosomiasis in a ‘One Health’ context. Transactions of The Royal Society of Tropical Medicine and Hygiene. 2019;113: 722–729. doi: 10.1093/trstmh/trz067 [DOI] [PubMed] [Google Scholar]
39.Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Marine Biol Biotechnol. 1994;3: 294–299. [PubMed] [Google Scholar]
40.Tian-Bi Y-NT, Webster B, Konan CK, Allan F, Diakité NR, Ouattara M, et al. Molecular characterization and distribution of Schistosoma cercariae collected from naturally infected bulinid snails in northern and central Côte d’Ivoire. Parasit Vectors. 2019;12: 117. doi: 10.1186/s13071-019-3381-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Born-Torrijos A, Poulin R, Raga JA, Holzer AS. Estimating trematode prevalence in snail hosts using a single-step duplex PCR: how badly does cercarial shedding underestimate infection rates? Parasites & Vectors. 2014;7: 243. doi: 10.1186/1756-3305-7-243 [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Bakuza JS, Gillespie R, Nkwengulila G, Adam A, Kilbride E, Mable BK. Assessing S. mansoni prevalence in Biomphalaria snails in the Gombe ecosystem of western Tanzania: the importance of DNA sequence data for clarifying species identification. Parasites & Vectors. 2017;10: 584. doi: 10.1186/s13071-017-2525-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Joof E, Andrus PS, Sowunmi K, Onyango VM, Wade CM. Comparing PCR techniques against conventional cercarial shedding methods for detecting Schistosoma mansoni infection in Biomphalaria snails. Acta Tropica. 2020;212: 105716. doi: 10.1016/j.actatropica.2020.105716 [DOI] [PubMed] [Google Scholar]
44.McCullough FS, Duke BOL. Schistosomiasis in the Gambia. Annals of Tropical Medicine & Parasitology. 1954;48: 277–286. doi: 10.1080/00034983.1954.11685625 [DOI] [PubMed] [Google Scholar]
45.Smithers SR, Terry RJ. The Immunology of Schistosomiasis. Advances in Parasitology. 1976;14: 399–422. doi: 10.1016/s0065-308x(08)60518-7 [DOI] [PubMed] [Google Scholar]

PLoS Negl Trop Dis. doi: 10.1371/journal.pntd.0010584.r001

Decision Letter 0

Makedonka Mitreva, Wannaporn Ittiprasert

16 Aug 2022

Dear Stephane Ranque,

Thank you very much for submitting your manuscript "Identification of Bulinus forskalii as a potential intermediate host of Schistosoma hæmatobium in Senegal" for consideration at PLOS Neglected Tropical Diseases. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by independent and expertise reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments.

Your manuscript has been assessed by 3 expertise reviewers in schistosomiasis research. The manuscript reports the novel information of Bulinus forskalii snail and its potential to be S. haematobium intermediate host in the endemic area. Even through, there is no additional experiments suggested from reviewers, but there are major concerns of the sample size and insufficient statistic used in the current version. All the reviewers suggested to improve the statistic used in the study along with other questions/comments to clarify the materials and methods, and result sections. Additional information in the introduction especially MALDI-TOF MS including the related-references will improve the manuscript as well.

Please clarify the reviewer comments, suggestions and/or questions, then and address them point-by-point that would improve the manuscript.

We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.

Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Wannaporn Ittiprasert, Ph.D

Academic Editor

PLOS Neglected Tropical Diseases

Makedonka Mitreva

Section Editor

PLOS Neglected Tropical Diseases

***********************

PNTD-D-22-00788

Identification of Bulinus forskalii as a potential intermediate host of Schistosoma haematobium in Senegal

Dear Dr. Stephane Ranque,

Thank you for submitting your manuscript ‘Identification of Bulinus forskalii as a potential intermediate host of Schistosoma haematobium in Senegal’ to PLoS NTD. Your manuscript has been assessed by 3 expertise reviewers in schistosomiasis research. The manuscript reports the novel information of Bulinus forskalii snail and its potential to be S. haematobium intermediate host in the endemic area. Even through, there is no additional experiments suggested from reviewers, but there are major concerns of the sample size and insufficient statistic used in the current version. All the reviewers suggested to improve the statistic used in the study along with other questions/comments to clarify the materials and methods, and result sections. Additional information in the introduction especially MALDI-TOF MS including the related-references will improve the manuscript as well.

Please clarify the reviewer comments, suggestions and/or questions, then and address them point-by-point that would improve the manuscript.

Best regards,

Wannaporn Ittiprasert, Ph.D

PLoS NTD

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #1: (No Response)

Reviewer #2: -Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

The objectives and hypothesis have been implicitly stated. These could be explicitly stated in an additional paragraph in the introduction.

-Is the study design appropriate to address the stated objectives?

Yes.

-Is the population clearly described and appropriate for the hypothesis being tested?

While the study focuses on B. forskalii, inclusion and/or discussion of other snail species found in the field sampling area would strengthen the manuscript.

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

Yes, assuming the hypothesis is something to the effect of "B. forskalii snails that reside in the delta region of the Senegal River can carry S. haematobium infections". The current study conducted experiments on a smaller scale in terms of geographical location compared to other referenced studies of intermediate hosts of Schistosoma parasites.

-Were correct statistical analysis used to support conclusions?

No statistical analyses were described. Perhaps there could be a test to correlate cercarial shedding to Ct value or COX1 and ITS2 (yes/no) status.

-Are there concerns about ethical or regulatory requirements being met?

No, there are no ethical or regulatory concerns.

-Other comments

Consider adding information to the methods section to answer the following questions: How was the cercarial shedding test done? How was the DNA extracted? How was the RT-PCR conducted? How was the PCR sequencing conducted?

Reviewer #3: P.M. Gaye et al build on their previous work from 2021 where they use MALDI-TOF MS to identify host snails. Here they collect 55 Bu forskalli from the Senegal river delta and look for evidence of S.haemotobium infection. The methods section of the paper is not sufficient to describe their study, but can be easily improved upon.

1) Please describe in more detail the area of the delta where the Bu forskalli was collected; a map may be helpful here.

2) Include in your methods how the snails were held (under what conditions) until the experiment to determine the presence of Sh or other parasites.

3) Describe your shedding protocol. How were the cercariae induced from the Bu forskalli?

4) On line 75, the authors tell us they used a reference spectra database and provide the link. Please describe this database as it was not intuitive and this Reviewer could not find the relevant page for snail references.

--------------------

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #1: Improve figure 1 quality.

Reviewer #2: -Does the analysis presented match the analysis plan?

Yes.

-Are the results clearly and completely presented?

As suggested below, more of the data could be made available, such as the results for all 55 B. forskalii specimens in Table 1.

-Are the figures (Tables, Images) of sufficient quality for clarity?

Yes. See below for suggestions.

Figure 2: If possible, consider showing (or explicitly labeling) the MALDI-TOF MS spectra of the reference sample for B. forskalii and, if available, those of other Bulinus members. Also consider showing the corresponding log score values for each spectra.

Table 1: The text describes 55 samples, while this table shows 10. How were these chosen? Are these specimens that met the Ct cutoff of 35 for the RT-PCR? Consider clarifying this in the text and/or caption. These results also do not show completely uninfected specimens, that is, specimens with a negative shedding test, CT>35, and negative sequencing results for COX1 and ITS2. Perhaps there were some, but they are not shown in the table? Consider including the data for all tested specimens, if not in this table, as supplementary information.

-Other comments

On line 67, the manuscript states that "[the authors] collected (n=55) snails from the Senegal River Delta area, identified as B. forskalii". Were there other Bulinus snail species present but not considered for analysis? While perhaps outside the scope of the study, such information might help describe the contribution of B. forskalii relative to other Bulinus species as an intermediate host for S. haematobium.

Reviewer #3: The authors claim in their results that the Bu forskalli were identified using MALDI-TOF MS, but also confirmed by COX-Folmer. Can they include that data in this manuscript?

--------------------

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #1: (No Response)

Reviewer #2: -Are the conclusions supported by the data presented?

Yes.

-Are the limitations of analysis clearly described?

Yes.

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

There could be more discussion about how this new knowledge that B. forskalii can carry S. haematobium infection can help improve epidemiological studies, surveillance efforts, and contribute to controlling schistosomiasis. For example, in surveillance studies, have researchers previously dismissed the possibility that B. forskalii snails could carry S. haematobium, and thus would assess a region to be at low risk of S. haematobium infections if only B. forskalii were found? If so, the findings in this study would encourage researchers to re-evaluate the guidelines for this hypothetical assessment.

-Is public health relevance addressed?

Yes, but, as suggested above, it could be more thoroughly discussed.

-Other comments

On line 112, the text asserts "Our findings demonstrate that B. forskalii can be parasitised by S. hæmatobium complex fluke, in particular, S. hæmatobium s.s., S. bovis s.s., and hybrids between them." The results do not necessarily demonstrate that S. haematobium x S. bovis hybrid species were detected in these snails. As stated on line 124, "discrepant ITS and COX-based identification in a given snail specimen can be interpreted either as an infection with one hybrid parasite or a co-infection with two distinct parasite species." Consider slightly modifying the statement to the effect of "Our findings demonstrate that B. forskalii can be parasitised by S. hæmatobium complex fluke, in particular, S. hæmatobium s.s., S. bovis s.s., and possibly S. haematobium x S. bovis hybrids."

Reviewer #3: The authors' conclusions are supported by the data presented.

--------------------

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #1: Introduction:

There is some data of B. forskalii and B. senegalensis distribution in Senegal? If so consider adding this information as it is extremely relevant to this study as some of B. senegalensis could be misidentified due to the similarity of the species.

I suggest you add some information about the MALDI-TOF MS as a research tool and its relevance to several species’ identification.

Maybe you can add a sentence with the relevance of the present study at the end of the introduction.

Methods:

Since according to Hamlili FZ et. al, 2021 it is necessary a specific database depending on the storage condition and can impact the quality of the tool I suggest you indicate the storage condition performed in the present study. You can indicate that the methods were performed as Hamlili FZ et. al, 2021, but quickly describe it.

The same I can point to the other methods - genomic DNA extraction, nucleotide sequence-based analysis, Real-time-Polymerase Chain Reaction (RT-PCR), and PCR sequencing - readers need to know exactly the methods you performed (reproducible study).

Results:

What is the relevance of the MALDI-TOF MS technique if the identification differentiation between B. forskalii and B. senegalensis can be performed by molecular identification using the COI gene?

To improve the results view and comparison I think that characteristic MALDI-TOF MS spectra acquired from B. senegalensis feet should be added to the Figure 1 as a control.

Can the infected snails be different from the non-infected under the MALDI-TOF MS analysis?

Reviewer #2: Line 70: "Desoxyribo" should be Deoxyribo

Line 72: ".. of Flight (MALDI-TOF MS)": Consider ".. of Flight Mass Spectrometry (MALDI-TOF MS)"

Line 31: "Nucleotide sequence analysis identified 6 (11.0%), using COX1, and 3 (5.5%), using ITS2, S. hæmatobium, and 3 (5.5%) S. bovis" could be clarified to something to the effect of "Nucleotide sequence analysis identified 6 (11.0%) using COX1 and 3 (5.5%) using ITS2 for S. hæmatobium, and 3 (5.5%) using COX1 and 3 (5.5%) using ITS2 for S. bovis"

On line 32, the manuscript asserts that "This result is the first report of infection of B. forskalii by S. hæmatobium complex parasites." However, the study by Labbo and coworkers (reference 19) have previously reported B. forskalii with S. haematobium infection. The statement could be modified by appending "in Senegal" or otherwise rewritten to reflect that the current study, in contrast to the previous study, uses more precise methods to differentiate between B. forskalii and B. senegalensis in identifying B. forskalii infected with S. haematobium.

Reviewer #3: The paper is well written; no editorial suggestions.

--------------------

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #1: The present study is relevant since it is the first report of B. forskalii infected by S. hæmatobium complex parasites in Senegal. Although it improves the knowledge about host-parasite interactions it also highlights that more similar studies should be held in endemic sites to better understand the transmission of Schistosoma species. It is relevant that MALDI-TOF mass spectrometry analysis was applied again as a tool that allows the differential identification of B. forskalii and B. senegalensis snails since B. senegalensis is already one of the main intermediate hosts of S. hæmatobium.

Reviewer #2: -Summary of study

The manuscript describes a study of 55 B. forskalii snails with respect to S. haematobium and S. bovis infection in the delta region of the Senegal River in September 2020. The study addresses the challenge of differentiating B. forskalii and B. senegalensis by using MALDI-TOF MS and PCR sequencing (COX-Folmer primers) analyses and follows with a cercarial shedding test and PCR sequencing analyses for S. haematobium COX1 and ITS2, showing that B. forskalii of this region can carry S. haematobium, S. bovis, or possibly S. haematobium x S. bovis hybrid parasites.

-Strengths

The analysis methods (MALDI-TOF MS and PCR sequencing) increase the confidence that snail specimens represent B. forskalii, not B. senegalensis, and that these B. forskalii snails are carrying S. haematobium parasites.

-Weaknesses

Field sampling included a single region in Senegal during a limited temporal window in September 2020. Sampling of more regions over a larger temporal period would increase the confidence that B. forskalii, under a broader range of conditions and environments, can carry S. haematobium infection.

Reviewer #3: The authors' finding is important for the field of Schistosomiasis, particularly in endemic areas because they show definitively that Bu forskalli can host Sh. This finding will be of interest to parasitologists and malacologists; not only for the technology used to draw the study's conclusions, but also because of the implications for human infection. My "major revision" recommendation is mainly to address deficiencies in the Methods section, but does not necessarily require new experiments.

--------------------

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Kenji Ishida

Reviewer #3: No

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

PLoS Negl Trop Dis. 2023 May 9;17(5):e0010584. doi: 10.1371/journal.pntd.0010584.r002

Author response to Decision Letter 0

19 Oct 2022

Attachment

Submitted filename: Responses to Reviewers 23.09.22.docx

Click here for additional data file.^{(34KB, docx)}

PLoS Negl Trop Dis. doi: 10.1371/journal.pntd.0010584.r003

Decision Letter 1

Makedonka Mitreva, Wannaporn Ittiprasert

27 Feb 2023

Dear Stephane Ranque,

Thank you for submitting your revised manuscript. The revised version has been backed to assess by expertise reviewers. The revised manuscript have great improvement to clarify the information in materials and methods, statistic used and others. However, there is still minor comments/suggestion to clarify the number of specimens used, especially in table 3 and discuss in depth for the advantage of MADOI-TOF-MS method rather than morphology identification.

Please prepare and submit your revised manuscript within 30 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to all review comments, and a description of the changes you have made in the manuscript.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Thank you again for your submission to our journal. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Wannaporn Ittiprasert, Ph.D

Academic Editor

PLOS Neglected Tropical Diseases

Makedonka Mitreva

Section Editor

PLOS Neglected Tropical Diseases

***********************

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #1: Sentence lines 160-162 is duplicated on lines 163-166. (manuscript with track changes)

Table 1 consider change it to Supplementary data.

Reviewer #2: (No Response)

Reviewer #4: The objetives are clearly articulated with a clear testable hypothesis stated

Sample size is somewhat small. This limits the statistical analysis.

Reviewer #5: 1- Line 100: Fig1 could not be downloaded in high resolution

2- Line 115: Please add the genomic coordinates of the area in which the snails were sampled

3- Line 119: Please make it clear which morphological features of the Bulinus forskalii snail species were analyzed

4- Line 145: sentence is duplicated, needs correction

5- Table 1 needs correction: some terms are truncated (Ethanol absolu) or incorrect (Coordonates), etc

6- Line 180: please specify what has been used as negative and positive controls

--------------------

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #1: Line 264 change paratised to parasitized. (manuscript with track changes)

Why on table 3 do you only have 10 specimens identified on the table? On lines 259 - 260 you indicate that 13 were positives through shedding and 17 through RT-PCR.

Reviewer #2: (No Response)

Reviewer #4: (No Response)

Reviewer #5: The quality of the figures should be improved.

--------------------

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #1: Line 283 change paratised to parasitized. (manuscript with track changes)

Reviewer #2: (No Response)

Reviewer #4: (No Response)

Reviewer #5: Line 250: Has the authors tried/identified sporocystes in the collected Bulinus forskalii snails?

--------------------

Editorial and Data Presentation Modifications?

Reviewer #1: (No Response)

Reviewer #2: (No Response)

Reviewer #4: (No Response)

Reviewer #5: (No Response)

--------------------

Summary and General Comments

Reviewer #1: I suggested minor revision just to adjust some details and regarding the Table 3 that I still didn’t understand why only consider 10 specimens to add on the table 3.

Reviewer #2: The authors have adequately addressed the reviewers' comments and have improved the quality of the manuscript in this revision. The manuscript is suitable for publication.

Reviewer #4: The paper presented by Mouhamadou et al, entitled Identification of Bulinus forskalii as a potential intermediate host of

Schistosoma haematobium in Senegal, describes a field study for the collection and identification of B. foskalii snails for infection with S. haematobium and S. bovis in an area of the Senegal River during the month of September 2020.

The finding that B. forskalli snails may be intermediate hosts of S. haematobiun is of great interest for the control of schistosomiasis in Sengegal.

The manuscript is well written and structured and allows a good understanding.

Methodologically it is correct, but I would like the authors to discuss in more depth the advantages of the MADI-TOF MS technique for the identification of snails, taking into account that they have previously been identified without problems by morphological characters. They comment in the introduction that morphological identification requires a great deal of expertise, that DNA identification is time-consuming and that there is not much information in databases. In schistosomiasis endemic areas, is it feasible to make a MALDITOF ? It also requires knowledge and experience to do it, as well as the databases to make a good comparison of identifications. Please try to explain this in more detail. Maybe there are not so many advantages compared to an identification of snails by morphology.

Typo in Line 188; S. bovis should be written in italics.

Reviewer #5: The authors provide a report that is centered around the identification/description of Bulinus forskalii snails that can host S. hæmatobium in a limited region of the Senegal River. The manuscript has been greatly improved after the first revision: the descriptions are clearer, the results better presented now, and additional discussions improved the interpretations. I have two main concerns:

1- the fact that a single, limited region in Senegal was sampled in a short temporal window (September 2020). Additional sampling in other regions over a larger period could strengthen the authors’ claim.

2- a demonstration that Bulinus forskalii can be infected by S. hæmatobium outside the field, in the laboratory could strengthen the manuscript. Has this been already performed, or is it possible?

Other points that should be considered are below:

Introduction

1- Line 77: Replace “exclude” by “excluded”

--------------------

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Kenji Ishida

Reviewer #4: No

Reviewer #5: No

Figure Files:

Data Requirements:

Reproducibility:

References

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article's retracted status in the References list and also include a citation and full reference for the retraction notice.

PLoS Negl Trop Dis. 2023 May 9;17(5):e0010584. doi: 10.1371/journal.pntd.0010584.r004

Author response to Decision Letter 1

16 Mar 2023

Attachment

Submitted filename: Reviewers Responses to questions.docx

Click here for additional data file.^{(20.7KB, docx)}

PLoS Negl Trop Dis. doi: 10.1371/journal.pntd.0010584.r005

Decision Letter 2

Makedonka Mitreva, Wannaporn Ittiprasert

17 Apr 2023

Dear Dr. Stephane Ranque,

We are pleased to inform you that your manuscript 'Identification of Bulinus forskalii as a potential intermediate host of Schistosoma hæmatobium in Senegal' has been provisionally accepted for publication in PLOS Neglected Tropical Diseases.

Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.

Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.

IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.

Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.

Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Wannaporn Ittiprasert, Ph.D

Academic Editor

PLOS Neglected Tropical Diseases

Makedonka Mitreva

Section Editor

PLOS Neglected Tropical Diseases

***********************************************************

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #1: (No Response)

Reviewer #4: (No Response)

Reviewer #5: (No Response)

**********

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #1: (No Response)

Reviewer #4: (No Response)

Reviewer #5: (No Response)

**********

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #1: (No Response)

Reviewer #4: (No Response)

Reviewer #5: (No Response)

**********

Editorial and Data Presentation Modifications?

Reviewer #1: (No Response)

Reviewer #4: (No Response)

Reviewer #5: (No Response)

**********

Summary and General Comments

Reviewer #1: My recommendation is the acceptance of the manuscript since all the suggestions and modifications of reviewers were properly addressed by the authors, and the quality of figures, and manuscript text were also improved. I'm adding my final suggestions to the authors so they can add some modifications before publishing the paper.

AUTHOR SUMMARY

Line 52 (manuscript with track changes): change “characterise” to characterize.

INTRODUCTION

Line 81: change “Bulinid” to Bulinus.

Also, check on the manuscript text where to write Bulinus or just B.

METHODS

Line 127: change “The” to the.

Line 129: the coordinates are 15°30W, as is written on the text, or 15°42W as is written on the S1 table?

Line 131: change “analysed” to analyzed.

On the cercarial shedding test, add the Schistosoma morphological identification, if you performed it.

Did you have any documentation approval, from the Senegal government, to do the snail collection? Can you please add it?

DISCUSSION

Line 317: change “economising” to economizing.

Reviewer #4: (No Response)

Reviewer #5: (No Response)

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #4: No

Reviewer #5: No

PLoS Negl Trop Dis. doi: 10.1371/journal.pntd.0010584.r006

Acceptance letter

Makedonka Mitreva, Wannaporn Ittiprasert

4 May 2023

Dear Pr Ranque,

We are delighted to inform you that your manuscript, "Identification of Bulinus forskalii as a potential intermediate host of Schistosoma hæmatobium in Senegal," has been formally accepted for publication in PLOS Neglected Tropical Diseases.

We have now passed your article onto the PLOS Production Department who will complete the rest of the publication process. All authors will receive a confirmation email upon publication.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Editorial, Viewpoint, Symposium, Review, etc...) are generated on a different schedule and may not be made available as quickly.

Soon after your final files are uploaded, the early version of your manuscript will be published online unless you opted out of this process. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Shaden Kamhawi

co-Editor-in-Chief

PLOS Neglected Tropical Diseases

Paul Brindley

co-Editor-in-Chief

PLOS Neglected Tropical Diseases

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Table. List of Gastropod species present in our homemade MALDI-TOF MS database.

(DOCX)

Click here for additional data file.^{(15.6KB, docx)}

S2 Table. Detailed results of MALDI-TOF MS identification, cercarial emission test and RT-PCR detection of S. hæmatobium complex performed of all snails.

(DOCX)

Click here for additional data file.^{(25.4KB, docx)}

S1 Fig

(TIF)

Click here for additional data file.^{(1.1MB, tif)}

Attachment

Submitted filename: Responses to Reviewers 23.09.22.docx

Click here for additional data file.^{(34KB, docx)}

Attachment

Submitted filename: Reviewers Responses to questions.docx

Click here for additional data file.^{(20.7KB, docx)}

Data Availability Statement

[pntd.0010584.ref001] 1.Tchuem Tchuenté L-A, Southgate VR, Jourdane J, Webster BL, Vercruysse J. Schistosoma intercalatum: an endangered species in Cameroon? Trends Parasitol. 2003;19: 389–393. doi: 10.1016/s1471-4922(03)00193-4 [DOI] [PubMed] [Google Scholar]

[pntd.0010584.ref002] 2.Webster BL, Southgate VR, Littlewood DTJ. A revision of the interrelationships of Schistosoma including the recently described Schistosoma guineensis. International Journal for Parasitology. 2006;36: 947–955. doi: 10.1016/j.ijpara.2006.03.005 [DOI] [PubMed] [Google Scholar]

[pntd.0010584.ref003] 3.Kane RA, Stothard JR, Emery AM, Rollinson D. Molecular characterization of freshwater snails in the genus Bulinus: a role for barcodes? Parasit Vectors. 2008;1: 15. doi: 10.1186/1756-3305-1-15 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pntd.0010584.ref004] 4.Chitsulo L, Engels D, Montresor A, Savioli L. The global status of schistosomiasis and its control. Acta Trop. 2000;77: 41–51. Available: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5633072/ doi: 10.1016/s0001-706x(00)00122-4 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pntd.0010584.ref005] 5.Webster BL, Diaw OT, Seye MM, Faye DS, Stothard JR, Sousa-Figueiredo JC, et al. Praziquantel treatment of school children from single and mixed infection foci of intestinal and urogenital schistosomiasis along the Senegal River Basin: monitoring treatment success and re-infection patterns. Acta Trop. 2013;128: 292–302. doi: 10.1016/j.actatropica.2012.09.010 [DOI] [PubMed] [Google Scholar]

[pntd.0010584.ref006] 6.Niangaly H, Djimde AA, Traore B, Sangare CPO, Guindo D, Konate D, et al. Variations saisonnières de l’infestation par les helminthes intestinaux et Schistosoma haematobium en zone rurale sahélienne au Mali. Médecine et Santé Tropicales. 2012;22: 430–434. doi: 10.1684/mst.2012.0123 [DOI] [PubMed] [Google Scholar]

[pntd.0010584.ref007] 7.Gryseels B, Polman K, Clerinx J, Kestens L. Human schistosomiasis. Lancet. 2006;368: 1106–1118. doi: 10.1016/S0140-6736(06)69440-3 [DOI] [PubMed] [Google Scholar]

[pntd.0010584.ref008] 8.Sellin Bertrand, Simonkovich Emeric, Roux J. Etude de la répartition des mollusques hôtes intermédiaires des schistosomes en Afrique de l’Ouest: premiers résultats. Médecine Tropicale. 1980;40: 31–39. [PubMed] [Google Scholar]

[pntd.0010584.ref009] 9.Senghor B, Diaw OT, Doucoure S, Seye M, Talla I, Diallo A, et al. Study of the snail intermediate hosts of urogenital schistosomiasis in Niakhar, region of Fatick, West central Senegal. Parasit Vectors. 2015;8. doi: 10.1186/s13071-015-1030-z [DOI] [PMC free article] [PubMed] [Google Scholar]

[pntd.0010584.ref010] 10.Bakhoum S, Ndione RA, Haggerty CJE, Wolfe C, Sow S, Ba CT, et al. Influence of physicochemical parameters on the spatial distribution of snail species that are intermediate hosts of human schistosomes in the Senegal River Delta. Médecine et Santé Tropicales. 2019;29: 61–67. doi: 10.1684/mst.2019.0883 [DOI] [PubMed] [Google Scholar]

[pntd.0010584.ref011] 11.Gaye PM, Doucoure S, Senghor B, Faye B, Goumballa N, Sembène M, et al. Bulinus senegalensis and Bulinus umbilicatus Snail Infestations by the Schistosoma haematobium Group in Niakhar, Senegal. Pathogens. 2021;10: 860. doi: 10.3390/pathogens10070860 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pntd.0010584.ref012] 12.Picquet M, Ernould JC, Vercruysse J, Southgate VR, Mbaye A, Sambou B, et al. The epidemiology of human schistosomiasis in the Senegal river basin. Transactions of the Royal Society of Tropical Medicine and Hygiene. 1996;90: 340–346. doi: 10.1016/S0035-9203(96)90501-5 [DOI] [PubMed] [Google Scholar]

[pntd.0010584.ref013] 13.Haggerty CJE, Bakhoum S, Civitello DJ, Leo GAD, Jouanard N, Ndione RA, et al. Aquatic macrophytes and macroinvertebrate predators affect densities of snail hosts and local production of schistosome cercariae that cause human schistosomiasis. PLOS Neglected Tropical Diseases. 2020;14: e0008417. doi: 10.1371/journal.pntd.0008417 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pntd.0010584.ref014] 14.Joof E, Sanneh B, Sambou SM, Wade CM. Species diversity and distribution of schistosome intermediate snail hosts in The Gambia. PLoS Negl Trop Dis. 2021;15: e0009823. doi: 10.1371/journal.pntd.0009823 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pntd.0010584.ref015] 15.Zein-Eddine R, Djuikwo-Teukeng FF, Al-Jawhari M, Senghor B, Huyse T, Dreyfuss G. Phylogeny of seven Bulinus species originating from endemic areas in three African countries, in relation to the human blood fluke Schistosoma haematobium. BMC Evol Biol. 2014;14: 271. doi: 10.1186/s12862-014-0271-3 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pntd.0010584.ref016] 16.Diaw OT, Seye M, Sarr Y. [Resistance to drought of mollusks of the genus Bulinus, vectors of human and animal trematode infections in Senegal. II. Study under natural conditions in the North-Sudan area. Ecology and resistance to drought of Bulinus umbilicatus and B. senegalensis]. Rev Elev Med Vet Pays Trop. 1989;42: 177–187. [PubMed] [Google Scholar]

[pntd.0010584.ref017] 17.Akinwale OP, Hock TT, Chia-Kwung F, Zheng Q, Haimo S, Ezeh C, et al. Differentiating Schistosoma haematobium from Schistosoma magrebowiei and other closely related schistosomes by polymerase chain reaction amplification of a species specific mitochondrial gene. Trop Parasitol. 2014;4: 38–42. doi: 10.4103/2229-5070.129163 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pntd.0010584.ref018] 18.Abbasi I, King CH, Sturrock RF, Kariuki C, Muchiri E, Hamburger J. Differentiation of Schistosoma haematobium from related schistosomes by pcr amplifying an inter-repeat sequence. The American Journal of Tropical Medicine and Hygiene. 2007;76: 950–955. doi: 10.4269/ajtmh.2007.76.950 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pntd.0010584.ref019] 19.Diaw OT, Vassiliades G. Epidémiologie des schistosomoses du bétail au Sénégal. Revue d’Elevage et de Médecine Vétérinaire des Pays Tropicaux. 1987;40: 265–274. Available: https://agritrop.cirad.fr/400749/ [PubMed] [Google Scholar]

[pntd.0010584.ref020] 20.Southgate VR, Rollinson D, Ross GC, Knowles RJ, Vercruysse J. On Schistosoma curassoni, S. haematobium and S. bovis from Senegal: development in Mesocricetus auratus, compatibility with species of Bulinus and their enzymes. Journal of Natural History. 1985;19: 1249–1267. doi: 10.1080/00222938500770801 [DOI] [Google Scholar]

[pntd.0010584.ref021] 21.Labbo R, Djibrilla A, Garba A, Chippaux J-P. Bulinus forskalii: a new potential intermediate host for Schistosoma haematobium in Niger. Transactions of the Royal Society of Tropical Medicine and Hygiene. 2007;101: 847–8. doi: 10.1016/j.trstmh.2007.03.016 [DOI] [PubMed] [Google Scholar]

[pntd.0010584.ref022] 22.Raahauge P, Kristensen TK. A comparison of Bulinus africanus group species (Planorbidae; Gastropoda) by use of the internal transcribed spacer 1 region combined by morphological and anatomical characters. Acta Trop. 2000;75: 85–94. doi: 10.1016/s0001-706x(99)00086-8 [DOI] [PubMed] [Google Scholar]

[pntd.0010584.ref023] 23.Boucheikhchoukh M, Laroche M, Aouadi A, Dib L, Benakhla A, Raoult D, et al. MALDI-TOF MS identification of ticks of domestic and wild animals in Algeria and molecular detection of associated microorganisms. Comparative Immunology, Microbiology and Infectious Diseases. 2018;57: 39–49. doi: 10.1016/j.cimid.2018.05.002 [DOI] [PubMed] [Google Scholar]

[pntd.0010584.ref024] 24.Mewara A, Sharma M, Kaura T, Zaman K, Yadav R, Sehgal R. Rapid identification of medically important mosquitoes by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Parasites & Vectors. 2018;11: 281. doi: 10.1186/s13071-018-2854-0 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pntd.0010584.ref025] 25.Ouarti B, Laroche M, Righi S, Meguini MN, Benakhla A, Raoult D, et al. Development of MALDI-TOF mass spectrometry for the identification of lice isolated from farm animals. Parasite. 2020;27. doi: 10.1051/parasite/2020026 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pntd.0010584.ref026] 26.Yssouf A, Almeras L, Raoult D, Parola P. Emerging tools for identification of arthropod vectors. Future Microbiology. 2016;11: 549–566. doi: 10.2217/fmb.16.5 [DOI] [PubMed] [Google Scholar]

[pntd.0010584.ref027] 27.Stephan R, Johler S, Oesterle N, Näumann G, Vogel G, Pflüger V. Rapid and reliable species identification of scallops by MALDI-TOF mass spectrometry. Food Control. 2014;46: 6–9. doi: 10.1016/j.foodcont.2014.04.047 [DOI] [Google Scholar]

[pntd.0010584.ref028] 28.Hamlili F, Thiam F, Laroche M, Doucoure S, Gaye P, Fall C, et al. MALDI-TOF mass spectrometry for the identification of freshwater snails from Senegal, including intermediate hosts of schistosomes. PLOS Neglected Tropical Diseases. 2021;15: e0009725. doi: 10.1371/journal.pntd.0009725 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pntd.0010584.ref029] 29.Ernould J. C., Ba K. Epidémiologie des bilharzioses humaines: évolution récente dans le bas-delta du Sénégal. In: Hervé Jean-Pierre [ed.], Brengues Jacques[ed.]. Aménagements hydro-agricoles et santé (vallée du fleuve Sénégal). Paris: ORSTOM, (Colloques et Séminaires). Eau et Santé: Colloque, Dakar (SEN), 1994/11/14-15. Paris: Paris: ORSTOM; 1998. [Google Scholar]

[pntd.0010584.ref030] 30.Kamara S. Développements hydrauliques et gestion d’un hydrosystème largement anthropisé: le delta du fleuve Sénégal.: 472. [Google Scholar]

[pntd.0010584.ref031] 31.Abdellahi M, Ndir O, Niang S. Assessment of schistosomiasis prevalence among children 5 to 14 years old after several years of mass drug administration in the Senegal River basin. Sante Publique. 2016;28: 535–540. [PubMed] [Google Scholar]

[pntd.0010584.ref032] 32.Southgate VR. Schistosomiasis in the Senegal River Basin: before and after the construction of the dams at Diama, Senegal and Manantali, Mali and future prospects. J Helminthol. 1997;71: 125–132. doi: 10.1017/s0022149x00015790 [DOI] [PubMed] [Google Scholar]

[pntd.0010584.ref033] 33.Mandahl-Barth G. Key to the identification of East and Central African freshwater snails of medical and veterinary importance. Bull World Health Organ. 1962;27: 135–150. Available: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2555811/ [PMC free article] [PubMed] [Google Scholar]

[pntd.0010584.ref034] 34.Frandsen F, Christensen NO. An introductory guide to the identification of cercariae from African freshwater snails with special reference to cercariae of trematode species of medical and veterinary importance. Acta Trop. 1984;41: 181–202. [PubMed] [Google Scholar]

[pntd.0010584.ref035] 35.Hamburger J, He-Na null, Abbasi I, Ramzy RM, Jourdane J, Ruppel A. Polymerase chain reaction assay based on a highly repeated sequence of Schistosoma haematobium: a potential tool for monitoring schistosome-infested water. Am J Trop Med Hyg. 2001;65: 907–911. doi: 10.4269/ajtmh.2001.65.907 [DOI] [PubMed] [Google Scholar]

[pntd.0010584.ref036] 36.Cnops L, Soentjens P, Clerinx J, Esbroeck MV. A Schistosoma haematobium-Specific Real-Time PCR for Diagnosis of Urogenital Schistosomiasis in Serum Samples of International Travelers and Migrants. PLOS Neglected Tropical Diseases. 2013;7: e2413. doi: 10.1371/journal.pntd.0002413 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pntd.0010584.ref037] 37.Webster BL, Rollinson D, Stothard JR, Huyse T. Rapid diagnostic multiplex PCR (RD-PCR) to discriminate Schistosoma haematobium and S. bovis. Journal of Helminthology. 2010;84: 107–114. doi: 10.1017/S0022149X09990447 [DOI] [PubMed] [Google Scholar]

[pntd.0010584.ref038] 38.Schols R, Carolus H, Hammoud C, Mulero S, Mudavanhu A, Huyse T. A rapid diagnostic multiplex PCR approach for xenomonitoring of human and animal schistosomiasis in a ‘One Health’ context. Transactions of The Royal Society of Tropical Medicine and Hygiene. 2019;113: 722–729. doi: 10.1093/trstmh/trz067 [DOI] [PubMed] [Google Scholar]

[pntd.0010584.ref039] 39.Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Marine Biol Biotechnol. 1994;3: 294–299. [PubMed] [Google Scholar]

[pntd.0010584.ref040] 40.Tian-Bi Y-NT, Webster B, Konan CK, Allan F, Diakité NR, Ouattara M, et al. Molecular characterization and distribution of Schistosoma cercariae collected from naturally infected bulinid snails in northern and central Côte d’Ivoire. Parasit Vectors. 2019;12: 117. doi: 10.1186/s13071-019-3381-3 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pntd.0010584.ref041] 41.Born-Torrijos A, Poulin R, Raga JA, Holzer AS. Estimating trematode prevalence in snail hosts using a single-step duplex PCR: how badly does cercarial shedding underestimate infection rates? Parasites & Vectors. 2014;7: 243. doi: 10.1186/1756-3305-7-243 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pntd.0010584.ref042] 42.Bakuza JS, Gillespie R, Nkwengulila G, Adam A, Kilbride E, Mable BK. Assessing S. mansoni prevalence in Biomphalaria snails in the Gombe ecosystem of western Tanzania: the importance of DNA sequence data for clarifying species identification. Parasites & Vectors. 2017;10: 584. doi: 10.1186/s13071-017-2525-6 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pntd.0010584.ref043] 43.Joof E, Andrus PS, Sowunmi K, Onyango VM, Wade CM. Comparing PCR techniques against conventional cercarial shedding methods for detecting Schistosoma mansoni infection in Biomphalaria snails. Acta Tropica. 2020;212: 105716. doi: 10.1016/j.actatropica.2020.105716 [DOI] [PubMed] [Google Scholar]

[pntd.0010584.ref044] 44.McCullough FS, Duke BOL. Schistosomiasis in the Gambia. Annals of Tropical Medicine & Parasitology. 1954;48: 277–286. doi: 10.1080/00034983.1954.11685625 [DOI] [PubMed] [Google Scholar]

[pntd.0010584.ref045] 45.Smithers SR, Terry RJ. The Immunology of Schistosomiasis. Advances in Parasitology. 1976;14: 399–422. doi: 10.1016/s0065-308x(08)60518-7 [DOI] [PubMed] [Google Scholar]

PERMALINK

Identification of Bulinus forskalii as a potential intermediate host of Schistosoma hæmatobium in Senegal

Papa Mouhamadou Gaye

Souleymane Doucouré

Doudou Sow

Cheikh Sokhna

Stéphane Ranque

Roles

Abstract

Author summary

Introduction

Methods

Snail collection and morphological identification

Fig 1.

Cercarial shedding test

Fig 2. An explanatory flow chart of the cercarial shedding protocol in intermediate host snails.

MALDI-TOF MS identification of snails

DNA extraction

Real-time PCR (RT-PCR) and PCR sequencing

Table 1. Primers used in the real-time PCR, Schistosoma parasite and snails sequencing protocols.

Results

MS identification of snails

Fig 3.

Molecular identification of snails and detection of S. hæmatobium complex infection

DNA sequence-based identification of Schistosoma spp. parasites

Table 2. MALDI-TOF MS identification of the snail parasitized by S. hæmatobium complex fluke, and COX1 and ITS2 DNA sequence-based identification of the Schistosoma spp. parasites.

Discussion and conclusion

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Makedonka Mitreva

Wannaporn Ittiprasert

Roles

Author response to Decision Letter 0

Decision Letter 1

Makedonka Mitreva

Wannaporn Ittiprasert

Roles

Author response to Decision Letter 1

Decision Letter 2

Makedonka Mitreva

Wannaporn Ittiprasert

Roles

Acceptance letter

Makedonka Mitreva

Wannaporn Ittiprasert

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases