Fortetropin supplementation prevents the rise in circulating myostatin but not disuse-induced muscle atrophy in young men with limb immobilization: A randomized controlled trial

Changhyun Lim; James McKendry; Taylor Giacomin; Jonathan C Mcleod; Sean Y Ng; Brad S Currier; Giulia Coletta; Stuart M Phillips

doi:10.1371/journal.pone.0286222

. 2023 May 23;18(5):e0286222. doi: 10.1371/journal.pone.0286222

Fortetropin supplementation prevents the rise in circulating myostatin but not disuse-induced muscle atrophy in young men with limb immobilization: A randomized controlled trial

Changhyun Lim ¹, James McKendry ¹, Taylor Giacomin ¹, Jonathan C Mcleod ¹, Sean Y Ng ¹, Brad S Currier ¹, Giulia Coletta ¹, Stuart M Phillips ^1,^*

Editor: Krzysztof Durkalec-Michalski²

PMCID: PMC10204970 PMID: 37220119

Abstract

Supplementation with Fortetropin® (FOR), a naturally occurring component from fertilized egg yolks, reduces circulating myostatin concentration. We hypothesized that FOR would mitigate muscle atrophy during immobilization. We examined the effect of FOR supplementation on muscle size and strength during 2-wk of single-leg immobilization and recovery. Twenty-four healthy young men (22 ± 2 yrs; BMI = 24.3 ± 2.9 kg/m²) were randomly allocated to either a Fortetropin® supplement (FOR-SUPP, n = 12) group consuming 19.8 g/d of FOR or placebo (PLA-SUPP, n = 12) group consuming energy- and macronutrient-matched cheese powder for 6-wk. The 6-wk period consisted of 2-wk run-in, 2-wk single-leg immobilization, and 2-wk recovery phase returning to habitual physical activities. Ultrasonography, dual-energy X-ray absorptiometry, muscle biopsies and isometric peak torque assessments were performed prior to and following each phase (days 1, 14, 28, and 42) to measure vastus lateralis and muscle fiber cross-section area (CSA), leg lean mass (LM), and muscular strength. Blood samples were taken on days 1 and 42 for measurement of plasma myostatin concentration, which increased in PLA-SUPP (4221 ± 541 pg/mL to 6721 ± 864 pg/mL, P = 0.013) but not in FOR-SUPP (5487 ± 489 pg/mL to 5383 ± 781 pg/mL, P = 0.900). After the immobilization phase, vastus lateralis CSA, LM, and isometric peak torque were decreased by 7.9 ± 1.7% (P < 0.001), -1.6 ± 0.6% (P = 0.037), and -18.7 ± 2.7% (P < 0.001) respectively, with no difference between groups. The decreased peak torque was recovered after 2-wk of normal activity (vs. day 1, P = 0.129); however, CSA and LM were not recovered (vs. day 1, P < 0.001 and P = 0.003, respectively), with no differences between groups. Supplementation with FOR prevented the rise in circulating myostatin but not disuse-induced muscle atrophy in young men after 2-wk of single-leg immobilization.

Introduction

Skeletal muscle is a plastic tissue that adapts its structure and metabolism in response to several internal and external variables, particularly mechanical load and protein ingestion [1]. Loss of muscle mass and function occurs rapidly with muscle disuse inherent to bed rest and single-leg immobilization [2, 3], which leads to impaired functional capacity, insulin resistance, and an increased risk for morbidity and mortality [4]. Nutritional support to counter disuse atrophy has included supplementation with essential amino acids [5] or omega-3 fatty acids [6], which have been shown to mitigate disuse-induced atrophy. Further work is warranted to identify effective strategies to maintain muscle mass and function during disuse, leveraging key molecular targets.

Myostatin (or growth differentiation factor-8, GDF-8) is a negative regulator of muscle growth and a member of the transforming growth factor-β family [7]. Various molecular mechanisms regulating protein synthesis and degradation are influenced by myostatin [8]. Myostatin also negatively regulates the activation and self-renewal of satellite cells (SC) by inhibiting the progress of SC into the S phase of the cell cycle [9]. In addition, myostatin reduces IGF-Akt pathway activity resulting in decreased protein synthesis initiation and increased translocation of Forkhead box protein O1 (Foxo1) into the nucleus. This mechanism releases E3 ubiquitin ligases, promoting muscle atrophy [8]. Previous studies reported an increased myostatin mRNA expression in skeletal muscle after 5 days of single-leg immobilization [10] and an increase in myostatin mRNA and protein expression after 3 days of unilateral lower limb suspension in healthy young men [11]. Whereas Jones et al. [12] showed no change in myostatin mRNA expression after 2-wk of single-leg immobilization, although there was an increased tendency of myostatin mRNA.

A previous study reported that 12-wk of Fortetropin® (FOR) ingestion, a non-thermal pasteurized, freeze-dried high protein egg yolk product, with resistance training lowered serum myostatin by 18–22% and increased muscle thickness by 3.7% and lean mass (LM) by 3.3% in trained young men, but placebo did not [13]. Moreover, consuming FOR reduced the expression of ubiquitin monomer protein and polyubiquitination genes and increased the activity of mechanistic target of rapamycin (mTOR) signaling after acute resistance exercise in a rodent model [13]. Evans et al. [14] also reported that muscle protein synthesis (MPS) was increased by 18% in older adults who consumed the FOR supplementation for 21 days compared with placebo; in the absence of changes in circulating myostatin. These previous studies support the notion that FOR may exert an anabolic influence on skeletal muscle. Interestingly, FOR ingestion may prevent disuse-induced muscle atrophy in dogs treated that consumed FOR during eight weeks of exercise restriction [15]. However, the impact of FOR supplementation on circulating myostatin and muscle tissue-level adaptations during muscle disuse in humans is unknown.

The primary aims of this trial were to determine whether FOR supplementation could prevent disuse-induced declines in muscle cross-sectional area (CSA) measured by ultrasonography and muscle biopsy (muscle fiber CSA), LM using dual-energy X-ray absorptiometry (DXA), and isometric strength during two weeks of single-leg immobilization phase. We hypothesized that FOR supplement would attenuate the decline in muscle size during immobilization, which would coincide with a reduction of circulating myostatin and alterations of molecular markers favoring a less catabolic state.

Materials and methods

Participants and ethics approval

A total of 24 young men (mean age of 22 ± 2 years old) with a body mass index (BMI) between 20 and 30 kg/m² were recruited for the study between January 2020 and February 2022 (This trial was paused from March 2020 to August 2021 due to COVID-19-imposed restrictions on human research). Participants were non-smokers, generally healthy according to a medical screening questionnaire, and recreationally active but did not meet Canada’s Physical Activity Guidelines (150 min of moderate-intensity exercise/week) and agreed not to consume eggs for the study duration. Exclusion criteria included severe orthopedic, cardiovascular, pulmonary, renal, liver, infectious disease, immune or metabolic disorder, consuming a vegan diet, taking medications known to affect protein metabolism (i.e., corticosteroids, non-steroidal anti-inflammatory drugs, or strength acne medication), and who had sustained a lower limb injury within a year prior to study participation. Before providing a written informed consent form, all potential participants were informed of the study purpose, experimental procedures, and possible risks. This study was approved by the Hamilton Integrated Research Ethics Board (project number: 7935) and conducted according to the principles expressed in the Declaration of Helsinki. This study was registered (http://clinicaltrials.gov/) as NCT05369026. A consolidated standards of reporting trials (CONSORT) flow diagram and chart can be seen in S1 and S2 Files, respectively.

Based on previous data [6, 16–18], the sample size for this protocol was calculated using G*power (Version 3.1.9.6, Germany) to achieve the expected declines in muscle cross-sectional area and assuming FOR would mitigate atrophy, an effect size of 0.33 (medium-sized effect, where 0.2 is low, 0.5 is medium, and 0.8 is high) [19], alpha was set at 0.05 and power at 0.9. The total sample size was 24 participants or 12/group (i.e., FOR vs. placebo).

Experimental design

This study was a double-blind, randomized parallel group design (n = 12/group). Young men were randomly assigned into one of two groups, FOR-SUPP or PLA-SUPP group. FOR-SUPP group daily consumed 19.8 g of FOR for 6-wk, and PLA-SUPP consumed an energy- and macronutrient-matched cheese powder (placebo supplement). After the screening was performed, at least one week before beginning the study protocol, recruited participants were randomly assigned into the two groups based on a randomly generated sequence using http://www.randomization.com/. An investigator not directly involved with recruitment and testing held a key for the randomization. The study included a pre-treatment (run-in) phase (2-wk), an immobilization phase (2-wk), and a recovery phase (2-wk) for a total 6-wk. Participants were instructed not to alter their habitual physical activity habits and not to perform any intense physical activity, such as resistance exercise, for the duration of the study protocol. The 2-wk immobilization phase was accomplished using the knee brace model we have used previously [6, 16, 20]. Participants were worn a knee brace (X-ACT ROM knee brace, Don Joy, Dallas, TX, USA) on a randomly selected leg. Crutches were provided to allow for mobility throughout the immobilization phase, and the brace angle was adjusted so that participants’ toes could not touch the ground during crutch-assisted ambulation. During the recovery phase, the knee brace was removed, and participants returned to their usual physical activity; however, participants were still required to refrain from any exercise. At 2-wk intervals from baseline (days 1, 14, 28, and 42), participants arrived at the laboratory at ~08:00 in the overnight fasted state and underwent procedures in the following order: DXA scan (following a urinary void) to assess body composition [20], ultrasonography for muscle CSA, blood sampling via venipuncture to assess circulating myostatin concentration and basic metabolic panel (blood urea nitrogen, BUN; creatine; glucose; alanine aminotransferase, ALT; aspartate aminotransferase, ASP; alkaline phosphatase, ALP; albumin; and bilirubin) to evaluate safety and tolerability of the compound (blood sampling were only performed at day 1 and 42), skeletal muscle biopsy to assess fiber type-dependent CSA, the number of myostatin-positive SC, and gene and protein expression related to protein synthesis and degradation, and isometric knee-extensor torque test to assess leg strength. Specific details of the study protocol are presented in Fig 1.

Fig 1 — Muscle biopsies, strength tests, and ultrasonography were performed on the immobilized leg only; DXA, dual-energy X-ray absorptiometry.

Nutritional supplements

FOR is a non-thermal pasteurized, freeze-dried high proteo-lipid, fertilized egg yolk product. It comprises 2.4% carbohydrates, 59% fat, 34% protein, and 3.5% total ash, with an energy content of 6.7 kcal/g. The ingredients of FOR and placebo were analyzed using Association of Official Agricultural Chemists (AOAC) method from a food analysis laboratory (Certified Laboratories Inc., NY, USA). Participants in FOR-SUPP consumed 19.8 g of FOR daily with breakfast, and the PLA-SUPP group consumed 19.8 g of cheese powder that was matched for macronutrient and energy to FOR-SUPP. The supplements were provided pre-mixed into a chocolate pudding to match the flavor and texture to maintain blinding.

Diet and physical activity

Participants were required not to consume alcohol, eggs, or other supplements throughout the protocol to rule out any possibility that could interfere with the FOR effects. Besides that, participants were instructed to consume their regular diets during run-in (days 1 to 14) and the recovery phase (days 28 to 42) and complete a 3-day dietary log (2 weekdays and 1 weekend day) to evaluate their total daily energy, carbohydrate, protein, and fat intake. These values were analyzed using NutriBase software (Cybersoft Inc., version 11.5, Pheonix, AZ, USA). We provided standardized meals that consisted of 1.2 g of protein per body mass per day throughout the two-week immobilization phase. The daily energy requirements of the participants were determined using the Harris-Benedict equation, with appropriate adjustments for physical activity levels (1.5, light activity). Thus, all participants consistently consumed sufficient dietary protein for muscle protein synthesis [21, 22] and tried to minimize diet-induced variability. Standardized meals were provided as pre-packaged frozen meals (Heart-to-Home Meals, Hamilton, ON, Canada), and the meal plans were customized according to each participant’s personal food preferences.

Participants were required to refrain from intense physical activity, including resistance exercise, and not alter their habitual physical activity throughout the protocol. Participants wore an Actigraph wGT2X-BT activity monitor (ActiGraph, Pensacola, FL, USA) on the wrist of their dominant arm to assess their physical activity level (steps/d; physical activity, kcal/d; metabolic equivalents of task [METs/d]) during the study.

Ultrasonography

The CSA of vastus lateralis measured by B-module ultrasonography was validated as a suitable alternative to MRI, which is considered the gold standard for measuring muscle size, for measuring changes in muscle size in response to disuse atrophy [23]. Using this method, with a 18L5 probe (BK Medical North America, Peabody, MA, USA), we measured the CSA of vastus lateralis of the leg randomly assigned for immobilization at days 1, 14, 28, and 42. The procedure involved participants laying supine for more than 10 min to normalize fluid shifts in the body, and we marked the location for imaging, 50% of the distance between the top of the patellar bone and the greater trochanter of the femur, identified by palpation. Afterward, a straight line was drawn along the longitudinal of the vastus lateralis, and the images were taken at 2 cm increments along the line resulting in ~7–9 images. The same investigator collected images during each visit to avoid variability in pressure amongst the images. Acquired images were stitched together using Gnu Image Manipulation Program (GIMP, version 2.9.22, Mountain View, CA, USA) to create a successive image of the vastus lateralis by aligning subcutaneous fat, superficial and deep aponeuroses, and intramuscular fat deposits between images (S1 Fig). These images were blinded to both group and time, and the CSA of vastus lateralis was analyzed using the Polygon tracing tool in ImageJ.

Knee extensor isometric muscle torque

After a familiarization session on the screening day, unilateral isometric knee-extensor torque was measured using the BIODEX (System 3, Biodex Medical Systems, Shirley, NY, USA) on days 1, 14, 28, and 42. The dynamometer was set to 60° from the resting (90°) position, and participants performed four maximal voluntary isometric leg extensions, lasting 5 seconds for 4 repetitions, 2 min apart. The average of the highest recorded 3 trials was used for maximal strength per visit.

Blood measurements

Blood samples were taken from an antecubital vein on days 1 and 42 and collected in EDTA tubes to aliquot plasma. The collected blood samples were stored on ice for 30 min before centrifuging at 1000 g for 10 min at 4°C, and plasma was aliquoted into Eppendorf tubes for analysis. A commercial GDF-8/Myostatin enzyme-linked immunosorbent assay (ELISA) kit (R&D systems, Minneapolis, NM, USA) was used to assess circulating myostatin concentration. Liver enzymes, ALT, ALP, and AST were measured using UV absorbance (Roche Cobas 8000 System, Indianapolis, IN, USA), and BUN, creatinine, glucose, albumin, and bilirubin were measured by UV-Visible Spectrophotometer-CHEM7 by the McMaster University core clinical laboratory services. All assays had an intra-assay CV of less than 3.5%

Muscle biopsy

During the study, four muscle biopsies were collected (days 1, 14, 28, and 42) from the vastus lateralis of the leg that was assigned for immobilization. The first biopsy was collected from approximately 15 cm above the patella, and the subsequent biopsies were collected from ~2 or 3 cm apart between them to avoid the effect of pre-sampling. All muscle biopsies were obtained using a 5-mm Bergstrom needle, custom modified for manual suction under 1% xylocaine local anesthesia. Through manual dissection, muscle tissues were carefully freed from visible connective tissue, fat, and blood. A piece (~40 mg) of the muscle tissue was embedded in optimal cutting temperature compound (OCT, Tissue-Tek, The Netherlands) for immunohistochemical analysis. The rest of the muscle tissue was snap-frozen in liquid nitrogen for gene and protein expression analysis. All muscle samples was stored at -80°C until analysis.

Immunohistochemistry

Muscle samples embedded in the OCT compound were cut into 5 μm sections in a cryostat at -20°C and transferred to the Super Frost Plus microscope slide (Fisher brand, Pittsburgh, PA, USA). Tissue sections were fixed in 4% paraformaldehyde solution for 5 min, permeabilized in 100% methanol for 10 min at– 20°C and 1% triton/phosphate-buffered saline (TPBS) for 10 min. Tissue sections were blocked for 30 min at room temperature in 10% goat serum in TPBS. To assess fiber type dependent CSA, the blocked tissue sections were incubated with primary antibodies against myosin heavy chain (MHC) I (BA.D5, 1:50, DSHB, Iowa City, IA, USA), MHC II (SC-71, 1:50, DSHB, Iowa City, IA, USA), and laminin (ab11575, 1:100, Abcam, Cambridge, MA, USA), and for analysis of the number of SC and Myostatin-positive SC (MSTN+/PAX7+), Pax7 (MAB1675, 1:100, R&D Systems, Minneapolis, MN, USA), Myostatin (AB3239, 1:100, Millipore, Etobicoke, ON, Canada), MHC II (ab91506, 1:1000, Abcam, Cambridge, MA, USA), and laminin (ab11575, 1:100, Abcam, Cambridge, MA, USA) were applied for overnight at 4°C. Appropriate secondary antibodies were applied; for CSA analysis, Alexa 647 goat anti-mouse IgG2b (A21242, 1:250, Invitrogen, Waltham, MA, USA), Alexa 488 goat anti-mouse IgG1 (A21121, 1:500, Invitrogen, Waltham, MA, USA), and Alexa 350 goat anti-rabbit IgG (H+L) (A11046, 1:500, Invitrogen, Waltham, MA, USA), and for SC and MSTN+/PAX7+, Alexa 594 (A11005, 1:500, Invitrogen, Waltham, MA, USA), Alexa 647 (A21244, 1:500, Invitrogen, Waltham, MA, USA), and Alexa 488 (A11008, 1:500, Invitrogen, Waltham, MA, USA). Nuclei were stained with 4,6-diamidino-2-phenylindole (1:2000, Sigma-Aldrich, Oakville, ON, Canada). Stained samples were imaged by a Nikon Eclipse Ti2pad microscope (Nikon Instruments, Melville, NY, USA) with a high-resolution Photometrics Moment 7 Megapixel CMOS camera (Teledyne Photometrics, Tucson, AZ, USA) with 20 times objective and analyzed using Nikon NIS element AR software (Nikon Instruments). All analyses were conducted on more than 100 fibers per fiber type per participant per time point [24, 25], and assessors were blinded to both group and time.

Western blotting

Phosphorylation/total protein content of mTOR and downstream proteins (p70S6K, S6K, and 4EBP1) were analyzed at pre- (day 14) and post-immobilization (day 28) to investigate the anabolic effect of FOR supplement during immobilization. After snap frozen muscle tissues were homogenized with ice-cold lysis buffer (10 μL·mg⁻¹; 25 mM Tris 0.5% vol/ vol Triton X-100 and protease/phosphatase inhibitor cocktail tablets; Complete Protease inhibitor Mini-Tabs [Roche] and aPhosSTOP [Roche Applied Science]), each sample was centrifuged at 11,000 g for 10 min at 4°C. The protein concentration of the supernatants was mixed with 4 × Laemmli buffer containing 10% 2-mercaptoethanol and distilled water to 2 μg/μL of protein concentration. 10 μg of each sample was loaded into wells on 4%–15% TGX Stain-Free Precast Gels (Bio-Rad, Hercules, CA, USA) with a protein ladder (Precision Plus Protein Standard, Bio-Rad, Hercules, CA, USA) and an internal standard calibration curve. Gel electrophoresis was run at 200 V for 45 min at room temperature. After UV activation of the gels, the proteins were transferred to a nitrocellulose membrane by turbo transfer. UV light activation revealed the total protein content on the nitrocellulose membrane, which was evenly loaded among each lane. Membranes were blocked with 5% bovine serum albumin for 90 min at room temperature. Primary antibodies were applied for overnight at 4°C; 1:1000, Cell Signaling Technology, Danvers, MA, USA; total form: mTOR (2972S), p70S6K (9202L), S6K (2217L), and 4EBP1 (9644S); phosphorylation form: mTOR^Ser2448 (5536S), p70S6K^Thr389 (9205L), S6K^ser235/236 (2211S), and 4EBP1^Thr37/46 (2855C). Following Tris-buffered saline and Tween 20 (TBS-T, Millipore, Oakville, ON, Canada) washes, membranes were incubated in appropriate secondary antibodies (anti-rabbit IgG, 7074S, Cell Signaling Technology, Dancers, MA, USA) for 90 min at room temperature. Proteins of interest were detected by chemiluminescence solution (Clarity Western ECL substrate, Bio-Rad, Hercules, CA, USA) and the ChemiDoc MP Imaging system and analyzed by Image Lab Software 6.0.1. Western blotting was performed only on a subgroup of participants (9 of FOR-SUPP and 6 of PLA-SUPP) due to shortage of muscle tissue.

RNA isolation, reverse transcription, and real-time quantitative PCR

E3 ubiquitin ligases [muscle specific F-box protein (Atrogin-1) and muscle RING-finger protein 1 (MuRF1)] were analyzed pre- (day 14) and post-immobilization (day 28) to investigate protein degradation through the ubiquitin-proteasome system (UPS) during immobilization. Total RNA was isolated from 20 mg of snap-frozen muscle tissues using the TRIzol reagent (15596–026, Invitrogen, Waltham, MA, USA) according to the manufacturer’s protocol. RNA was resuspended in 33 μL of RNase-free distilled water (UltraPure water, Invitrogen, Waltham, MA, USA), and RNA concentration and purity were measured using Nano-Drop 2000 Spectrophotometer (Thermo Fisher Scientific Rockville, MD, USA). cDNA was synthesized by reverse transcription using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). 20 ng of the synthesized cDNA samples were run with triplicate 6 μL reactions containing PCR master mix (A6002, GoTaq, Promega, Madison, WI, USA). 5uM of primers (Sigma-Aldrich) of target genes [sequence 5’ to 3’; Atrogin-1, forward: GCAGCTGAACAACATTCAGATCAC, reverse: CAGCCTCTGCATG-ATGTTCAGT; MuRF1, forward: CCTGAGAGCCATTGACTTTGG, reverse: CTTCCCTTC-TGTGGACTCTTCCT] using QuantStudio 5 Real-Time PCR system (Applied Biosystems, Foster City, CA, USA). Data were analyzed using the comparative 2^-ΔΔCt method [26]. 18S (forward: TTCGGAACTGAGGCCGCCATGAT, reverse: TTTCGCTCTGGTCGCTCTTG) was employed as the housekeeping gene since no differences between groups (FOR and PLA) and within the time points (pre and post) were detected.

Statistical analysis

All statistical analyses were performed using SPSS Statistics Software for Windows, version 26.0 (IBM Corp., Armonk, NY, USA). The Shapiro-Wilk test was performed to assess normality for the distribution of data. Non-normally distributed data (the number of SC in type I and II and the phosphorylation ratio to total mTOR and S6K) were log-transformed [27] and showed normal data distribution. Independent t-tests were performed to compare participants’ baseline characteristics and the percentage change in plasma myostatin concentration between groups. Two-way repeated-measures analysis of variance (ANOVA) was used to assess the group (FOR-SUPP vs. PLA-SUPP) by time (day 1, 14, 28, and 42; run-in, immobilization, and recovery phase), and a Tukey’s post hoc test was performed for following analysis of the significant interactions from the ANOVA analysis. Pearson’s correlation coefficients were performed to assess the association between the change in myostatin concentration and CSA measured by ultrasonography. Statistical significance was P < 0.05, and all data are presented as mean ± standard deviation (SD).

Results

Participant’s baseline characteristics

In total, 24 participants were recruited, and 22 completed the protocol; 2 participants dropped out due to the Covid-19 outbreak. Of the participants who completed the study, 2 participants in the PLA-SUPP were excluded due to poor compliance with wearing the knee brace during the immobilization phase (S1 File). The baseline characteristics of the participants are presented in Table 1.

Table 1. Baseline characteristics of the participants.

	FOR-SUPP (n = 11)	PLA-SUPP (n = 9)	P
Age (years)	22 ± 2	22 ± 1	0.74
Height (cm)	178 ± 5	175 ± 8	0.33
Body mass (kg)	75.4 ± 6.3	77.9 ± 15.8	0.05
BMI (kg/m²)	23.6 ± 2.0	25.4 ± 3.4	0.09
Total body LM (kg)	57.6 ± 5.6	55.5 ± 9.3	0.48
Immobilized leg LM (kg)	11.0 ± 1.1	10.5 ± 1.7	0.48

Open in a new tab

Data are expressed as mean ± standard deviation. FOR-SUPP, Fortetropin® supplement; PLA-SUPP, placebo supplement; BMI, body mass index; LM, lean mass.

Physical activity

Physical activity variables are shown in Table 2. During the immobilization phase, steps, energy expenditure by physical activity, and METs were significantly decreased compared to the run-in phase (step, P < 0.001; energy expenditure by physical activity, P < 0.001; METs, P < 0.001) with no difference between groups (step, P = 0.989; energy expenditure by physical activity, P = 0.921; METs, P = 0.304), and the decreased level of the physical activity variables were fully recovered to the level of the run-in phase during the recovery phase (step, P < 0.001; energy expenditure by physical activity, P < 0.001; METs, P < 0.001).

Table 2. Physical activity during each phase.

	Run-in		Immobilization		Recovery
	FOR-SUPP	PLA-SUPP	FOR-SUPP	PLA-SUPP	FOR-SUPP	PLA-SUPP
Steps/d	7782 ± 2488	7992 ± 3870	5550 ± 2232^*	4591 ± 3156^*	7092 ± 2296	7786 ± 3883
Energy expenditure by physical activity (kcal/d)	933 ± 356	972 ± 545	742 ± 340^*	698 ± 548^*	852 ± 320	924 ± 627
METs/d	1.5 ± 0.2	1.6 ± 0.3	1.3 ± 0.1^*	1.3 ±0.2^*	1.4 ± 0.1	1.6 ± 0.3

Open in a new tab

Data are expressed as mean ± standard deviation. FOR-SUPP, Fortetropin® supplement; PLA-SUPP, placebo supplement; * P < 0.05, significantly different from run-in and recovery phase (main effect for time).

Vastus lateralis CSA and LM of the immobilized leg

The results of vastus lateralis CSA and LM of the immobilized leg are presented in Fig 2, and the representative image of vastus lateralis cross-section obtained by ultrasonography is shown in S1 Fig. There were no interactions between group and time for the absolute value of CSA (P = 0.763) and the percentage change in CSA (P = 0.487), but main effect for time in absolute value of CSA (P < 0.001) and the percentage change in CSA (P < 0.001). In the analysis of main effect for time, the mean of absolute CSA from both groups was 28.6 ± 1.3 cm² and 28.6 ± 1.2 cm² on day 1 and 14, respectively, and declined to 26.1 ± 1.1 cm² at day 28 (Day 14 vs. 28, P < 0.001) with no difference between groups (P = 0.351), and the decreased CSA did not return after recovery phase (day 1 vs. 42, P < 0.001; Fig 2A). The percentage change in CSA from day 1 to the end of immobilization (day 28) and the recovery phase (day 42) were– 7.9 ± 1.7% (vs. run-in, P < 0.001) and– 8.0 ± 1.8% (vs. run-in, P < 0.001), respectively (Fig 2B). There was no interaction between the group and time for the immobilization leg LM (P = 0.870) and the percentage change in the LM (P = 0.740), but main effect for time in the immobilization leg LM (P = 0.015) and the percentage change in LM (P = 0.041). In the analysis of main effect for time, the mean of immobilization leg LM from both groups decreased from 10.76 ± 1.37 kg and 10.74 ± 1.33 kg at day 1 and 14, respectively, to 10.58 ± 1.37 kg at day 28 (Day 1 vs. 28, P = 0.015; Day 14 vs. 28, P = 0.043) with no difference between groups (P = 0.499), and the decreased leg LM was not recovered after recovery phase (day 1 vs. 42, P = 0.003; Fig 2C). The percentage changes in the immobilized leg LM from day 1 to the end of the immobilization and recovery phase were -1.6 ± 0.6% (vs. run-in, P = 0.037) and -1.8 ± 0.5% (vs. run-in, P = 0.018), respectively (Fig 2D).

Muscle fiber CSA

The representative images of fiber type-dependent CSA are shown in S2 Fig. There were no interactions between group and time for absolute CSA (P = 0.659), and the percentage change in CSA (P = 0.646) of Type I fibers (Fig 3A and 3B), but main effect for time in the percentage change in Type I fibers CSA (P = 0.033). In the analysis of main effect for time, Type I CSA decreased by 6.5 ± 3.8% after the immobilization phase (vs. run-in, P = 0.036) with no difference between groups (P = 0.669) and did not recover after the recovery phase (vs. run-in, P = 0.853; Fig 3B). There were no interactions between group and time for absolute CSA (P = 0.940) and the percentage change in CSA (P = 0.680) of type II fibers (Fig 3C and 3D), but main effect for time in the absolute (P = 0.033) and the percentage change (P = 0.024) CSA in Type II fibers. In the analysis of main effect for time, Type II CSA decreased from 5113 ± 1185 μm² and 5091 ± 1205 μm² at day 1 and 14, respectively, to 4555 ± 1038 μm² at day 28 (Day 1 vs. 28, P = 0.027; Day 14 vs. 28, P = 0.010) with no difference between groups (P = 0.544) and recovered to 4806 ± 1206 μm² at day 42 (day 1 vs. 42, P = 0.182). The percentage changes in Type II CSA from day 1 to the end of the immobilization and recovery phase were -8.8 ± 4.1% (vs. run-in, P = 0.023) and -5.0 ± 3.8% (vs. run-in, P = 0.080), respectively, with no difference between groups (P = 0.567).

Fig 3 — CSA of Type I (A) and Type II fiber (C) of the immobilized leg at each phase, and the percentage change in CSA of Type I (B) and Type II fiber (D) during each phase. Boxes represent the 25^th to 75^th percentile, with the central horizontal lines indicating the median. The whiskers represent the maximal and minimal values, and the cross represents the mean value. FOR-SUPP, Fortetropin® supplement; PLA-SUPP, placebo supplement; CSA, cross-sectional area. * P < 0.05, significantly different from Day 1 and 14 (main effect), # P < 0.05, significantly different from run-in (main effect).

Isometric knee-extensor torque

There were no group-by-time interactions for the absolute value of isomeric knee-extensor peak torque (P = 0.579) or the percentage change in the peak torque (P = 0.379; Fig 4), but main effect for time in peak torque (P < 0.001) and the percentage change in the peak torque (P = 0.003). In the analysis of main effect for time, the absolute value of peak torque decreased from 160 ± 10 Nm and 162 ± 11 Nm at days 1 and 14 to 129 ± 9 Nm at day 28 (day 1 vs. 28, P < 0.001; day 14 vs. 28, P < 0.001) with no difference between groups (P = 0.638) and recovered to 152 ± 9 Nm at day 42 (day 1 vs. 42, P = 0.129) (Fig 4A). The percentage change in peak torque decreased from day 1 to the end of the immobilization and recovery phases were -18.7 ± 2.7% (vs. run-in, P < 0.001) and -3.5 ± 3.7% (vs. run-in, P = 0.196) with no difference between groups (P = 0.327; Fig 4B).

Fig 4 — Peak torque (A) of the immobilized leg at each phase and the percentage change in peak torque (B) during each phase. Boxes represent the 25^th to 75^th percentile, with the central horizontal lines indicating the median. The whiskers represent the maximal and minimal values, and the cross represents the mean value. FOR-SUPP, Fortetropin® supplement; PLA-SUPP, placebo supplement. * P < 0.05, significantly different from Day 1 and 14 (main effect for time), # P < 0.05, significantly different from run-in and recovery (main effect for time).

Blood variables

The values for the blood variables are presented in Table 3 and Fig 5. There was a significant difference in ALP (P = 0.027) by ANOVA; however, post hoc analysis did not reveal significant pairwise differences between or within groups at any time point (P > 0.05; Table 3). There were no group-by-time interactions for BUN (P = 0.977), creatinine (P = 0.991), glucose (P = 0.267), ALT (P = 0.294), ASP (P = 0.275), albumin (P = 0.329), and bilirubin (P = 0.429) (Table 3). ASP decreased from 24.9 ± 1.2 U/L on day 1 to 20.7 ± 1.7 U/L on day 42 (P = 0.047) with no difference between groups (P = 0.289) (Table 3).

Table 3. Blood variables at day 1 and 42.

	FOR-SUPP		PLA-SUPP
	Day 1	Day 42	Day 1	Day 42
BUN (mM)	5.2 ± 0.9	5.1 ± 1.0	5.3 ± 0.8	5.3 ± 0.5
Creatinine (μM)	91.0 ± 13.1	90.8 ± 9.2	83.9 ± 18.9	83.5 ± 12.7
Glucose (mM)	4.5 ± 0.5	4.8 ± 0.4	5.1 ± 0.4	5.0 ± 0.4
ALT (U/L)	16.0 ± 6.8	19.0 ± 9.0	22.2 ± 11.1	18.2 ± 13.3
ASP (U/L)	22.6 ± 3.8	20.6 ± 9.1^*	27.2 ± 7.1	20.8 ± 4.3^*
ALP (U/L)	57.4 ± 13.2	63.3 ± 15.6	66.4 ± 18.7	56.6 ± 14.7
Albumin (g/L)	42.4 ± 4.9	41.4 ± 4.3	41.7 ± 3.4	42.4 ± 5.2
Bilirubin (μM)	19.5 ± 5.1	17.8 ± 8.4	18.6 ± 6.8	18.9 ± 6.9

Open in a new tab

Data are expressed as mean ± standard deviation. FOR-SUPP, Fortetropin® supplement; PLA-SUPP, placebo supplement; BUN, blood urea nitrogen; ALT; alanine aminotransferase; ASP, aspartate aminotransferase; ALP, alkaline phosphatase; * P < 0.05, significant difference from Day 1 (Main effect).

Fig 5 — Plasma myostatin concentration at days 1 and 42 (A) and the percentage change in plasma myostatin concentration from day 1 to day 42 (B). The scatterplots show the correlation between the percentage change in CSA by ultrasonography and myostatin circulation concentration at day 42 (C), and the percentage change in plasma myostatin concentration (D). Boxes represent the 25^th to 75^th percentile, with the central horizontal lines indicating the median. The whiskers represent the maximal and minimal values, and the cross represents the mean value. FOR-SUPP, Fortetropin® supplement; PLA-SUPP, placebo supplement; CSA, cross-sectional area. * P < 0.05, significantly different from pre within the group, # P < 0.05, significantly different from FOR.

There was no difference in myostatin concentration in plasma between day 1 and 42 in FOR-SUPP (5487 ± 489 pg/mL to 5382 ± 781 pg/mL, P = 0.900); however, in PLA-SUPP, myostatin concentration in plasma increased from 4221 ± 541 pg/mL at day 1 to 6721 ± 86 pg/mL at day 42 (P = 0.013) (Fig 5A). The percentage change in plasma myostatin concentration between days 1 and 42 was 4 ± 32% in FOR-SUPP and 75 ± 89% in PLA-SUPP (FOR-SUPP vs. PLA-SUPP, P = 0.005) (Fig 5B). There was a statistically significant correlation between the percentage change in CSA measured by ultrasonography from day 1 to 42 and post-plasma myostatin concentration with medium association (r = 0.469, P = 0.037) (Fig 5C). Despite no statistically significant correlation (P = 0.066), the correlation between the percentage change in CSA and myostatin concentration from day 1 to 42 showed a medium association (r = 0.419) (Fig 5D).

SC and myostatin-positive SC content

The results of SC (PAX7+) and myostatin-positive SC (MSTN+/PAX7+) are presented in Fig 6. There were no interactions between group and time for the number of SC in type I (P = 0.976, Fig 6B) and II fiber (P = 0.894, Fig 6C) and the percentage of myostatin-positive SC per SC in type I (P = 0.433, Fig 6D) and II fiber (P = 0.938, Fig 6E). With no difference between groups (P = 0.813), the percentage of myostatin-positive SC in type II fiber increased from 35 ± 5% and 42 ± 5% on day 1 and 14, respectively, to 55 ± 5% at day 28 (Day 1 vs. 28, P = 0.001; Day 14 vs. 28, P = 0.022), and the increased the percentage of myostatin-positive SC was back to normal level (36 ± 4%) at day 42 (Day 1 vs. 42, P = 0.903) (Fig 6E).

Gene and protein expression

There were no interactions between group and time for E3 ubiquitin ligases, Atrogin-1 (P = 0.776, Fig 7A) and MuRF1 (P = 0.962, Fig 7B). There were no interactions between group and time for the ratio of phosphorylated to total (P/T) mTOR (P = 0.522, Fig 7C), S6K (P = 0.640, Fig 7E), and 4EBP1 (P = 0.160, Fig 7F). However, P/T p70S6K at post time point increased by 38 ± 46% compared to pre in FOR only (P = 0.032, Fig 7D).

Discussion

In the present study, the effect of FOR supplementation were compared with a macronutrient- and energy-matched placebo on indices of muscle size and strength during two weeks of single-leg immobilization in young, healthy men. We discovered that ingestion of FOR prevented the rise in circulating plasma myostatin. However, FOR supplementation did not attenuate the loss of muscle CSA measured by ultrasonography, muscle fiber CSA in type I and II, and LM of the immobilized leg. In addition, both groups did not recover the immobilization-induced reduction in muscle CSA and LM of the immobilized leg after two weeks of returning to normal physical activity. In line with the results of CSA and LM of the immobilized leg, the molecular mechanisms we probed (the number of myostatin-positive SC and the expression of E3 ubiquitin ligases) showed no effect of FOR supplementation, except that phosphorylation of p70S6K was increased post-immobilization in the FOR-SUPP. Isometric peak torque decreased following two weeks of single-leg immobilization; however, two weeks of returning to normal activity was sufficient to recover the reduction in peak torque.

Myostatin is a potent negative regulator of muscle growth, and an increased circulating concentration of myostatin has been observed in various conditions, including disease or disuse states [28–31]. Previous studies showed unchanged myostatin mRNA [12] or decreased myostatin protein expression [32] in single-leg immobilization model. However, we observed increased plasma myostatin in the PLA-SUPP after the 6-wk protocol, including 2 weeks of single-leg immobilization (Fig 5). On the other hand, the FOR-SUPP did not show a rise (Fig 5). These results are similar to previous studies that reported a positive effect of FOR ingestion on blood myostatin levels in humans [13] and dogs [15]. Furthermore, the percentage change of myostatin concentration in plasma or the circulating myostatin level at day 42 showed a moderate association with the percentage change in CSA measured by ultrasonography, regardless of group (Fig 5C and 5D). Evans et al. [14] reported a positive association between circulating myostatin concentration and MPS on Day 21 of treatments (FOR vs. placebo consumption). These authors [14] suggested that the elevated MPS may result from the increased amino acid availability derived from protein degradation. In the current study, despite preventing myostatin levels from rising, FOR ingestion did not attenuate the loss of muscle size and LM of the immobilized leg during the immobilization phase (Fig 2).

Myostatin circulates in two forms, latent and active, and only activated C-terminal myostatin, after proteolytic processing, can bind to the ActRIIB, thereby initiating signaling, including the pathways activating UPS and inhibiting myogenesis [8]. Thus, one possibility to explain the discordance between myostatin circulation level and muscle mass in the present study is that the ELISA evaluating changes in myostatin concentration might not be sensitive enough to distinguish the different forms of myostatin, as Bergen et al. proposed [33]. In the present study, the molecular kinetics of myostatin activity between blood and muscle at the cellular level are unclear. However, in line with the results of muscle size and LM of the immobilized leg, the expression of MuRF1 and Atrogin-1 (Fig 7A and 7B) were not different between conditions, and neither were the number of myostatin-positive SC (Fig 6D and 6E) between groups at any time points. The number of myostatin-positive SC–myostatin inhibits the progress of SC into the S phase of the cell cycle [9]–increased after 2 weeks of immobilization in both groups. More studies are needed to determine the relationship between disuse-atrophy and myostatin-positive SC. However, it was in line with the previous study reporting the blunted response of the decline in the number of myostatin-positive SC to resistance exercise in older adults, who may have an impaired myogenic capacity compared to young [34]. These results show the role of myostatin in the regulation of SC function. Besides that, we observed the increased phosphorylated p70S6K at post-immobilization in FOR-SUPP (Fig 7D), which should not be disregarded.

The mechanisms of FOR on skeletal muscle growth have not been completely determined. However, egg yolk contains macro- and micro-nutrients (lipid, minerals, vitamins, microRNAs, and more) that may modify pathways related to MPS or degradation [35, 36]. Indeed, Sharp et al. [13] reported that 12 weeks of FOR supplement increased LM and decreased protein degradation markers, increasing mTOR signaling activity in trained young men. Also, Evans et al. [14] showed elevated MPS in older adults who consumed FOR for 21 days, despite no increase in LM. Contrary to our study, these previous studies did not restrict participants’ mobility or physical activity level during FOR consumption [13, 14]. The influence of FOR on muscle metabolism may have been relatively subtle in our study due to the absence of muscular contraction.

After disuse atrophy was induced, the decreased muscle CSA and LM of the immobilized leg were not recovered within 2 weeks of returning to normal activity in both groups (Fig 2). Similar to the period of immobilization, we could not observe any impact of FOR ingestion on skeletal muscle during the recovery phase. A previous study reported that 2 weeks of immobilization was sufficient to induce anabolic resistance–decreased response of MPS to anabolic stimuli–in young adults [16]. Thus, there is a possibility that the impact of FOR was not effective enough to recover the loss of muscle size with anabolic resistance induced by immobilization or needed an extended recovery period. Suetta et al. [37] reported that 4 weeks of resistance exercise rehabilitation recovered 2-wk of immobilization-induced loss of muscle mass in young men; however, given the volume of work and loads lifted during the recovery period, these findings [37] are perhaps unsurprising. In the present study, our participants did not perform any exercise-type rehabilitation during the recovery phase, although they returned to their normal physical activity levels. These results show the necessity of exercise-based rehabilitation to recover disuse-induced loss of muscle mass in the short term.

Contrary to muscle mass, the decreased leg extension peak torque was largely recovered by 2 weeks of normal activity recovery (Fig 4). Generally, reduced muscle mass induced by immobilization is accompanied by a decline in muscle strength and impairment of muscle function [38, 39]. However, the amount of muscle mass does not always align with muscle strength, and neural adaptations are likely involved in determining muscle strength [40]. Sarto et al. [41] reported impaired neuromuscular junction (NMJ) stability, increased motor unit potential complexity, and decreased motor unit firing rate after 10 days of single leg immobilization, but the impaired neural adaptations were fully recovered by 21 days of recovery accompanied resistance exercise. The authors [41] suggested a functional resilience of human NMJ against disuse-induced stress. Thus, strength could be more flexible and recover faster than muscle mass [42]. In line with this thesis, we noted that the resumption of 2 weeks of normal activity recovery was sufficient to reverse the, presumably, neural-level adaption impaired by immobilization, thereby recovering muscle strength.

In the present study, daily ingestion of 19.8 g FOR (6wk) did not adversely affect blood variables (Table 3). However, a significant decline in ASP occurred in both groups; however, the values on both days 1 and 42 were still well within the normal range—5 to 30 U/L [43]. In line with our results, a previous study [13] reported no changes in the blood variables during 12 weeks of FOR ingestion.

Due to the COVID-19 outbreak and the poor compliance with wearing a knee brace, we could not analyze the total number of participants planned to have a medium effect size of power (S1 File) and recognize that our findings are limited to young men. We did not collect blood samples on days 14 and 28.

Conclusions

We showed that FOR ingestion was safe and tolerable, and it prevented the rise in myostatin observed after the 6-wk protocol, which included 2 weeks of single-leg immobilization. However, the unchanged myostatin circulation concentration in the FOR group did not affect the molecular markers related to myostatin-regulated signaling in skeletal muscle and did not attenuate disuse-induced muscle atrophy. We note that 2 weeks of normal activity following two weeks of immobilization was insufficient to recover the decline in muscle CSA and peak torque during disuse.

Supporting information

S1 Fig. A representative image of vastus lateralis CSA obtained by ultrasonography.

VL, vastus lateralis; VI, vastus intermedius, RF, rectus femoris.

(TIF)

Click here for additional data file.^{(5.6MB, tif)}

S2 Fig. Representative images of skeletal muscle fiber type.

(A) merge of all the panels; (B) Type I fibers, purple; (C) Type II fibers, green; (D) Laminin, blue.

(TIF)

Click here for additional data file.^{(4.1MB, tif)}

S1 File. Consolidated standards of Reporting Trials flow diagram.

FOR-SUPP, Fortetropin® supplement; PLA-SUPP, placebo supplement.

(DOC)

Click here for additional data file.^{(56KB, doc)}

S2 File. Consolidated standards of reporting trials chart.

(DOC)

Click here for additional data file.^{(219.5KB, doc)}

S3 File. Minimal dataset.

(XLSX)

Click here for additional data file.^{(26.2KB, xlsx)}

S4 File. Western blot raw images.

(PDF)

Click here for additional data file.^{(11.1MB, pdf)}

Acknowledgments

We want to thank Prior Todd for technical and administrative support and the participants for their time and effort.

Data Availability

All relevant data are within the manuscript and its Supporting information files.

Funding Statement

This work was supported by funding from Myos Corporation (grant number: N/A, URL: http://myoscorp.com) to SMP. The funders had no role in study design, data collection and anlysis, decision to publish, or preparation of the manuscript.

References

1.Lim C, Nunes EA, Currier BS, McLeod JC, Thomas ACQ, Phillips SM. An Evidence-Based Narrative Review of Mechanisms of Resistance Exercise-Induced Human Skeletal Muscle Hypertrophy. Med Sci Sports Exerc. 2022;54(9):1546–59. doi: 10.1249/MSS.0000000000002929 [DOI] [PMC free article] [PubMed] [Google Scholar]
2.English KL, Paddon-Jones D. Protecting muscle mass and function in older adults during bed rest. Curr Opin Clin Nutr Metab Care. 2010;13(1):34–9. doi: 10.1097/MCO.0b013e328333aa66 [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Nunes EA, Stokes T, McKendry J, Currier BS, Phillips SM. Disuse-induced skeletal muscle atrophy in disease and nondisease states in humans: mechanisms, prevention, and recovery strategies. Am J Physiol Cell Physiol. 2022;322(6):C1068–C84. doi: 10.1152/ajpcell.00425.2021 [DOI] [PubMed] [Google Scholar]
4.Srikanthan P, Karlamangla AS. Muscle mass index as a predictor of longevity in older adults. Am J Med. 2014;127(6):547–53. doi: 10.1016/j.amjmed.2014.02.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Holloway TM, McGlory C, McKellar S, Morgan A, Hamill M, Afeyan R, et al. A Novel Amino Acid Composition Ameliorates Short-Term Muscle Disuse Atrophy in Healthy Young Men. Front Nutr. 2019;6:105. doi: 10.3389/fnut.2019.00105 [DOI] [PMC free article] [PubMed] [Google Scholar]
6.McGlory C, Gorissen SHM, Kamal M, Bahniwal R, Hector AJ, Baker SK, et al. Omega-3 fatty acid supplementation attenuates skeletal muscle disuse atrophy during two weeks of unilateral leg immobilization in healthy young women. FASEB J. 2019;33(3):4586–97. doi: 10.1096/fj.201801857RRR [DOI] [PubMed] [Google Scholar]
7.McPherron AC, Lawler AM, Lee SJ. Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature. 1997;387(6628):83–90. doi: 10.1038/387083a0 [DOI] [PubMed] [Google Scholar]
8.Elliott B, Renshaw D, Getting S, Mackenzie R. The central role of myostatin in skeletal muscle and whole body homeostasis. Acta Physiol (Oxf). 2012;205(3):324–40. doi: 10.1111/j.1748-1716.2012.02423.x [DOI] [PubMed] [Google Scholar]
9.McCroskery S, Thomas M, Maxwell L, Sharma M, Kambadur R. Myostatin negatively regulates satellite cell activation and self-renewal. J Cell Biol. 2003;162(6):1135–47. doi: 10.1083/jcb.200207056 [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Dirks ML, Wall BT, Snijders T, Ottenbros CL, Verdijk LB, van Loon LJ. Neuromuscular electrical stimulation prevents muscle disuse atrophy during leg immobilization in humans. Acta Physiol (Oxf). 2014;210(3):628–41. doi: 10.1111/apha.12200 [DOI] [PubMed] [Google Scholar]
11.Gustafsson T, Osterlund T, Flanagan JN, von Walden F, Trappe TA, Linnehan RM, et al. Effects of 3 days unloading on molecular regulators of muscle size in humans. J Appl Physiol (1985). 2010;109(3):721–7. doi: 10.1152/japplphysiol.00110.2009 [DOI] [PubMed] [Google Scholar]
12.Jones SW, Hill RJ, Krasney PA, O’Conner B, Peirce N, Greenhaff PL. Disuse atrophy and exercise rehabilitation in humans profoundly affects the expression of genes associated with the regulation of skeletal muscle mass. FASEB J. 2004;18(9):1025–7. doi: 10.1096/fj.03-1228fje [DOI] [PubMed] [Google Scholar]
13.Sharp MH, Lowery RP, Mobley CB, Fox CD, de Souza EO, Shields KA, et al. The Effects of Fortetropin Supplementation on Body Composition, Strength, and Power in Humans and Mechanism of Action in a Rodent Model. J Am Coll Nutr. 2016;35(8):679–91. doi: 10.1080/07315724.2016.1142403 [DOI] [PubMed] [Google Scholar]
14.Evans W, Shankaran M, Nyangau E, Field T, Mohammed H, Wolfe R, et al. Effects of Fortetropin on the Rate of Muscle Protein Synthesis in Older Men and Women: A Randomized, Double-Blinded, Placebo-Controlled Study. J Gerontol A Biol Sci Med Sci. 2021;76(1):108–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
15.White DA, Harkin KR, Roush JK, Renberg WC, Biller D. Fortetropin inhibits disuse muscle atrophy in dogs after tibial plateau leveling osteotomy. PLoS One. 2020;15(4):e0231306. doi: 10.1371/journal.pone.0231306 [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Glover EI, Phillips SM, Oates BR, Tang JE, Tarnopolsky MA, Selby A, et al. Immobilization induces anabolic resistance in human myofibrillar protein synthesis with low and high dose amino acid infusion. J Physiol. 2008;586(24):6049–61. doi: 10.1113/jphysiol.2008.160333 [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Glover EI, Yasuda N, Tarnopolsky MA, Abadi A, Phillips SM. Little change in markers of protein breakdown and oxidative stress in humans in immobilization-induced skeletal muscle atrophy. Appl Physiol Nutr Metab. 2010;35(2):125–33. doi: 10.1139/H09-137 [DOI] [PubMed] [Google Scholar]
18.Oates BR, Glover EI, West DW, Fry JL, Tarnopolsky MA, Phillips SM. Low-volume resistance exercise attenuates the decline in strength and muscle mass associated with immobilization. Muscle Nerve. 2010;42(4):539–46. Epub 2010/07/27. doi: 10.1002/mus.21721 . [DOI] [PubMed] [Google Scholar]
19.Sullivan GM, Feinn R. Using Effect Size-or Why the P Value Is Not Enough. J Grad Med Educ. 2012;4(3):279–82. doi: 10.4300/JGME-D-12-00156.1 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Stokes T, Timmons JA, Crossland H, Tripp TR, Murphy K, McGlory C, et al. Molecular Transducers of Human Skeletal Muscle Remodeling under Different Loading States. Cell Rep. 2020;32(5):107980. doi: 10.1016/j.celrep.2020.107980 [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Traylor DA, Gorissen SHM, Phillips SM. Perspective: Protein Requirements and Optimal Intakes in Aging: Are We Ready to Recommend More Than the Recommended Daily Allowance? Adv Nutr. 2018;9(3):171–82. doi: 10.1093/advances/nmy003 [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Nunes EA, Colenso-Semple L, McKellar SR, Yau T, Ali MU, Fitzpatrick-Lewis D, et al. Systematic review and meta-analysis of protein intake to support muscle mass and function in healthy adults. J Cachexia Sarcopenia Muscle. 2022;13(2):795–810. doi: 10.1002/jcsm.12922 [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Stokes T, Tripp TR, Murphy K, Morton RW, Oikawa SY, Lam Choi H, et al. Methodological considerations for and validation of the ultrasonographic determination of human skeletal muscle hypertrophy and atrophy. Physiol Rep. 2021;9(1):e14683. doi: 10.14814/phy2.14683 [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Mackey AL, Kjaer M, Charifi N, Henriksson J, Bojsen-Moller J, Holm L, et al. Assessment of satellite cell number and activity status in human skeletal muscle biopsies. Muscle Nerve. 2009;40(3):455–65. doi: 10.1002/mus.21369 [DOI] [PubMed] [Google Scholar]
25.Nederveen JP, Ibrahim G, Fortino SA, Snijders T, Kumbhare D, Parise G. Variability in skeletal muscle fibre characteristics during repeated muscle biopsy sampling in human vastus lateralis. Appl Physiol Nutr Metab. 2020;45(4):368–75. doi: 10.1139/apnm-2019-0263 [DOI] [PubMed] [Google Scholar]
26.Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 2008;3(6):1101–8. doi: 10.1038/nprot.2008.73 [DOI] [PubMed] [Google Scholar]
27.Curran-Everett D. Explorations in statistics: the log transformation. Adv Physiol Educ. 2018;42(2):343–7. doi: 10.1152/advan.00018.2018 [DOI] [PubMed] [Google Scholar]
28.Reardon KA, Davis J, Kapsa RM, Choong P, Byrne E. Myostatin, insulin-like growth factor-1, and leukemia inhibitory factor mRNAs are upregulated in chronic human disuse muscle atrophy. Muscle Nerve. 2001;24(7):893–9. doi: 10.1002/mus.1086 [DOI] [PubMed] [Google Scholar]
29.Delfino GB, Peviani SM, Durigan JL, Russo TL, Baptista IL, Ferretti M, et al. Quadriceps muscle atrophy after anterior cruciate ligament transection involves increased mRNA levels of atrogin-1, muscle ring finger 1, and myostatin. Am J Phys Med Rehabil. 2013;92(5):411–9. doi: 10.1097/PHM.0b013e3182643f82 [DOI] [PubMed] [Google Scholar]
30.Smith RC, Lin BK. Myostatin inhibitors as therapies for muscle wasting associated with cancer and other disorders. Curr Opin Support Palliat Care. 2013;7(4):352–60. doi: 10.1097/SPC.0000000000000013 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Myostatin Dasarathy S. and beyond in cirrhosis: all roads lead to sarcopenia. J Cachexia Sarcopenia Muscle. 2017;8(6):864–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Snijders T, Wall BT, Dirks ML, Senden JM, Hartgens F, Dolmans J, et al. Muscle disuse atrophy is not accompanied by changes in skeletal muscle satellite cell content. Clin Sci (Lond). 2014;126(8):557–66. [DOI] [PubMed] [Google Scholar]
33.Bergen HR 3rd, Farr JN, Vanderboom PM, Atkinson EJ, White TA, Singh RJ, et al. Myostatin as a mediator of sarcopenia versus homeostatic regulator of muscle mass: insights using a new mass spectrometry-based assay. Skelet Muscle. 2015;5:21. doi: 10.1186/s13395-015-0047-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
34.McKay BR, Ogborn DI, Bellamy LM, Tarnopolsky MA, Parise G. Myostatin is associated with age-related human muscle stem cell dysfunction. FASEB J. 2012;26(6):2509–21. doi: 10.1096/fj.11-198663 [DOI] [PubMed] [Google Scholar]
35.van Vliet S, Shy EL, Abou Sawan S, Beals JW, West DW, Skinner SK, et al. Consumption of whole eggs promotes greater stimulation of postexercise muscle protein synthesis than consumption of isonitrogenous amounts of egg whites in young men. Am J Clin Nutr. 2017;106(6):1401–12. doi: 10.3945/ajcn.117.159855 [DOI] [PubMed] [Google Scholar]
36.Santos HO, Gomes GK, Schoenfeld BJ, de Oliveira EP. The Effect of Whole Egg Intake on Muscle Mass: Are the Yolk and Its Nutrients Important? Int J Sport Nutr Exerc Metab. 2021;31(6):514–21. doi: 10.1123/ijsnem.2021-0086 [DOI] [PubMed] [Google Scholar]
37.Suetta C, Hvid LG, Justesen L, Christensen U, Neergaard K, Simonsen L, et al. Effects of aging on human skeletal muscle after immobilization and retraining. J Appl Physiol (1985). 2009;107(4):1172–80. doi: 10.1152/japplphysiol.00290.2009 [DOI] [PubMed] [Google Scholar]
38.Gibson JN, Halliday D, Morrison WL, Stoward PJ, Hornsby GA, Watt PW, et al. Decrease in human quadriceps muscle protein turnover consequent upon leg immobilization. Clin Sci (Lond). 1987;72(4):503–9. doi: 10.1042/cs0720503 [DOI] [PubMed] [Google Scholar]
39.Deitrick JE. The effect of immobilization on metabolic and physiological functions of normal men. Bull N Y Acad Med. 1948;24(6):364–75. [PMC free article] [PubMed] [Google Scholar]
40.Reggiani C, Schiaffino S. Muscle hypertrophy and muscle strength: dependent or independent variables? A provocative review. Eur J Transl Myol. 2020;30(3):9311. doi: 10.4081/ejtm.2020.9311 [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Sarto F, Stashuk DW, Franchi MV, Monti E, Zampieri S, Valli G, et al. Effects of short-term unloading and active recovery on human motor unit properties, neuromuscular junction transmission and transcriptomic profile. J Physiol. 2022. doi: 10.1113/JP283381 [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Sale DG. Neural adaptation to resistance training. Med Sci Sports Exerc. 1988;20(5 Suppl):S135–45. doi: 10.1249/00005768-198810001-00009 [DOI] [PubMed] [Google Scholar]
43.Lala V, Zubair M, Minter DA. Liver Function Tests. StatPearls. Treasure Island (FL); 2022. [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0286222.r001

Decision Letter 0

Krzysztof Durkalec-Michalski

22 Feb 2023

PONE-D-22-33716Fortetropin® supplementation prevents the rise in circulating myostatin but not disuse-induced muscle atrophy in young men during immobilization: a randomized controlled trialPLOS ONE

Dear Dr. Phillips,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Apr 08 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Krzysztof Durkalec-Michalski, Ph.D

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Thank you for stating the following in the Competing Interests section:

“I have read the journal's policy and the authors of this manuscript have the following competing interests: SMP reports grants or research contracts from the US National Dairy Council, Canadian Institutes for Health Research, Dairy Farmers of Canada, Roquette Freres, Ontario Centre of Innovation, Nestle Health Sciences, Myos, National Science and Engineering Research Council and the US NIH during the conduct of the study; personal fees from Nestle Health Sciences, non-financial support from Enhanced Recovery, outside the submitted work. SMP has patents licensed to Exerkine but reports no financial gains from any patent or related work. Other authors have declared that no competing interests exist.”

Please confirm that this does not alter your adherence to all PLOS ONE policies on sharing data and materials, by including the following statement: "This does not alter our adherence to PLOS ONE policies on sharing data and materials.” (as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests). If there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared.

Please include your updated Competing Interests statement in your cover letter; we will change the online submission form on your behalf.

3. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.

Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.

Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.

We will update your Data Availability statement to reflect the information you provide in your cover letter.

4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: No

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: This study aimed to investigate the impact of Fortetropin® (FOR) supplementation on immobilization-induced muscle atrophy and weakness. The research question is relevant due to the increasing interest in the scientific literature on disuse countermeasures and the promising findings of FOR supplementation in previous training studies. The authors employed an appropriate disuse model (2-week knee brace immobilization) with subsequent recovery, controlled for/assessed potential confounding factors (diet and physical activity levels) and evaluated alterations in molecular markers involved in muscle atrophy. Overall, the manuscript is clear and easy to follow. However, there are some crucial matters to consider regarding plasma myostatin concentration evaluation.

First, blood samples were collected only on day 1 (onset of the run-in phase) and day 42 (end of the recovery). Due to this limitation in study design, the authors cannot determine with certainty whether the increased myostatin concentration occurred during the immobilization phase or the recovery phase, or both. This is particularly relevant in light of a recent 10-day bed rest study that found an unexpected increase in circulating myostatin after two days of recovery, but not during the unloading period (Oranger et al., 2022). Why did the authors decide to not collect blood samples on day 14 (onset of the immobilization phase) and day 28 (end of the immobilization phase)? Blood sampling is a relatively fast procedure and less invasive compared to muscle biopsies that were obtained also at these two additional time points.

Second, caution is needed in the interpretation of findings exclusively drawn from circulating biomarkers when employing “local” disuse models, such as knee brace immobilization. Indeed, disuse effects are expected mostly at a local muscle level and results obtained from systemic biomarkers may be affected by the relatively low muscle mass undergoing unloading/immobilization (one leg only).

To overcome these issues, have the authors considered evaluating myostatin transcript and protein levels from muscle biopsies? I strongly recommend performing these additional analyses, if possible.

Other comments:

L1: In the title, the authors suggest that the rise in myostatin occurred during the immobilization phase. However, since blood samples were not collected on days 14 and 28 the authors cannot be completely sure of this (see my main comment).

L28: If word count allows it, I suggest the authors specify that the recovery phase in this study consisted just of the resumption of habitual physical activities.

L34-39: The authors reported just one percentage of reduction and p-value for each muscle force and mass parameter. To which group are they referred (FOR-SUPP or PLA-SUPP)? Or is it an average?

L39-40: As for the title, I believe the authors cannot affirm that the rise in myostatin is due to the immobilization period.

L59: I feel some background on the role of myostatin in disuse atrophy is needed here in the introduction. Is increased myostatin an established finding with muscle disuse/immobilization? To the best of my knowledge, there is conflicting evidence on the effect of human limb disuse/immobilization on myostatin levels. Previous studies employing cast immobilization found unchanged (Jones et al., 2004; Chen et al., 2007) or increased (Dirks et al., 2014) MSNT expression, or even decreased myostatin protein content (Snijders et al., 2014). Increased myostatin gene and protein levels were observed in response to 3 days of unilateral lower limb suspension (ULLS) (Gustafsson et al., 2010), but no changes were found in a longer 14-day ULLS (de Boer et al., 2007). Finally, 25 days (Zachwieja et al., 1999), but not 10 days (Oranger et al., 2022) of bed rest increased circulating myostatin levels. Results in animal disuse studies seem also ambiguous (Carlson et al., 1999; Wehling et al., 2000; Allen et al., 2009). I believe the authors should cite and discuss at least part of this previous literature in the manuscript to give to the reader a broader background.

L82: Authors should add DXA procedures to the Methods section or at least refer the reader to previous studies using the same procedures.

L145: How was the amount of daily FOR supplementation (19.8g/d) determined?

L168: Were the subjects asked to refrain from intense physical activity during the whole protocol (run-in + immobilization + recovery) or just during the immobilization phase?

L180-181: Are the ultrasound-derived CSA values presented in the article the average of these 7-9 images? Why did you choose to collect the images at 2cm intervals, instead of capturing different muscle regions (e.g. 70%, 60%, 50%, 40% 30%, 20% of femur length) to take into account potential regional differences?

L210: Could you please provide more information regarding muscle biopsies exact location and precautions to avoid the effects of pre-sampling?

L313: How was participants’ compliance evaluated?

L332: Have the authors collected any functional or morphological data on the control leg? I think it would be a nice addition to the manuscript.

L364: I suggest the authors state here that no differences were observed in absolute CSA values of Type I fibres, as reported in Figure 3A.

L454: The authors are invited to report also in the main text that WB was performed only on a subgroup of participants (N=9 for FOR-SUPP and n=6 for PLA-SUPP) due to shortage of muscle tissue.

L455: Add “(data not shown)” after “E3 ubiquitin ligases”, as this result is not reported in any figures or tables.

L480: Did E3 ubiquitin ligases change their expression with immobilization? In the results section (L455), the authors reported only that no interactions between group and time for E3 ubiquitin ligases were found, but here in the discussion, the authors suggest that is one of the proved molecular mechanisms involved in muscle atrophy with disuse.

L486: I suggest the authors discuss here that the literature however is not always in agreement and different studies found unchanged or decreased myostatin levels in disuse scenarios (Jones et al., 2004; de Boer et al., 2007; Snijders et al., 2014; Oranger et al., 2022).

L507: While MuRF1 and Atrogin-1 expressions did not differ between conditions, they were also unaltered by immobilization, thus I am not sure these results are in line with the reduced muscle size and LM observed.

L510-511: Did the authors expect this increase in myostatin-positive SC with immobilization? I believe this novel finding should be further discussed.

L543: The authors forgot to add “complexity” after “motor unit potential”. In addition, I suggest specifying that the retraining period of the cited study was based on resistance training, differently from the present manuscript.

L614: please fix reference number 12, probably an error with the reference manager occurred.

References:

- Allen DL, Bandstra ER, Harrison BC, Thorng S, Stodieck LS, Kostenuik PJ, Morony S, Lacey DL, Hammond TG, Leinwand LL, Argraves WS, Bateman TA & Barth JL (2009). Effects of spaceflight on murine skeletal muscle gene expression. J Appl Physiol 106, 582–592.

- de Boer MD, Selby A, Atherton P, Smith K, Seynnes OR, Maganaris CN, Maffulli N, Movin T, Narici M V. & Rennie MJ (2007). The temporal responses of protein synthesis, gene expression and cell signalling in human quadriceps muscle and patellar tendon to disuse. J Physiol 585, 241–251.

- Carlson CJ, Booth FW & Gordon SE (1999). Skeletal muscle myostatin mRNA expression is fiber-type specific and increases during hindlimb unloading. Am J Physiol - Regul Integr Comp Physiol 277, 601–606.

- Chen YW, Gregory CM, Scarborough MT, Shi R, Walter GA & Vandenborne K (2007). Transcriptional pathways associated with skeletal muscle disuse atrophy in humans. Physiol Genomics 31, 510–520.

- Dirks ML, Wall BT, Snijders T, Ottenbros CLP, Verdijk LB & Van Loon LJC (2014). Neuromuscular electrical stimulation prevents muscle disuse atrophy during leg immobilization in humans. Acta Physiol 210, 628–641.

- Gustafsson T, Osterlund T, Flanagan JN, Von Waldén F, Trappe TA, Linnehan RM & Tesch PA (2010). Effects of 3 days unloading on molecular regulators of muscle size in humans. J Appl Physiol 109, 721–727.

- Jones SW, Hill RJ, Krasney PA, O’Conner B, Peirce N & Greenhaff PL (2004). Regulation of skeletal muscle mass and adipose tissue mass by follistatin and follistatin-related gene (FLRG) and development of novel polypeptides as medical drugs. FASEB J; DOI: 10.1096/fj.03-1228fje.

- Oranger A, Storlino G, Dicarlo M, Zerlotin R, Pignataro P, Sanesi L, Narici M, Pišot R, Simunič B, Colaianni G, Grano M & Colucci S (2022). Impact of 10-day bed rest on serum levels of irisin and markers of musculoskeletal metabolism. FASEB J 37, e22668.

- Snijders T, Wall BT, Dirks ML, Senden JMG, Hartgens F, Dolmans J, Losen M, Verdijk LB & Van Loon LJC (2014). Muscle disuse atrophy is not accompanied by changes in skeletal muscle satellite cell content. Clin Sci 126, 557–566.

- Wehling M, Cai B & TidballL J (2000). Modulation of myostatin expression during modified muscle use. FASEB J 14, 103–110.

- Zachwieja JJ, Smith SR, Sinha-Hikim I, Gonzalez-Cadavid N & Bhasin S (1999). Plasma myostatin-immunoreactive protein is increased after prolonged bed rest with low-dose T3 administration. J Gravitational Physiol.

Reviewer #2: Major revisions

1. Sample size determination:

a) Line 104: please provide the references for the effect size interpretation;

b) Line 105: it is indicated that total calculated sample size is 24 (12 participants per each group). While, the final statistical analysis covered 11 participants is FOR-SUPP group and 9 participants in PLA-SUPP groups. In this circumferences, what were the actual effect size, alpha and power? Was the final sample size sufficient? Why Authors did not accounted for possible drop outs at the stage of a priori sample size determination? Western blot analysis was performed for even lower number of participants.

2. What was the reason for performing blood evaluations ‘solely’ at days 1 and 42? Why were they not performed at days 14 and 28?

3. Lines 143-145: how was the nutritional value of Fortetropin supplement evaluated? Please provide methodology and/or relevant references.

4. Line 161: With respect to protein intake during the immobilization phase (1.2 g protein per kg of body mass), Authors are referring to the paper published in 2022 (doi: 10.1002/jcsm.12922), while the study on Fortetropin supplementation started in 2020. Please provide the references/guidelines that actually were implemented when establishing protein intake during immobilization phase.

5. It was mentioned that energy requirements during immobilization phase were calculated by multiplying basal metabolic rate (as calculated with Harris-Benedict equation) by physical activity level. Further Authors indicated that energy expenditures were monitored using Actigraph wGT2X-BT activity monitor. Thus, is it possible to compare the calculated/pre-assumed energy expenditures and the actual/established with Actigraph energy expenditures? What was the actual energy balance in participants during immobilization phase?

6. Lines 337-352: It is not clear to which group (FOR-SUPP or PLA-SUPP) the provided results (CSA, LM, and changes in these indices) refer to? It must be clarified and specified. Are the values means or medians?

7. Lines 362-374: It is not clear to which group (FOR-SUPP or PLA-SUPP) the provided results (muscle fiber CSA) refer to? It must be clarified and specified. Although, there were no significant differences between groups, still it is impossible that the results are exactly the same in both groups. Maybe be it would be reasonable to decline from providing the exact mean results/values in the text (leave ‘P’ values only) – while the exact results are provided in the corresponding figures. The figures are very clear and highly-informative.

8. Please refer point 7 to results on isometric knee-extensor torque.

Minor revisions

1. Initial concentrations of plasma myostatin were 5487 ± 489 pg/mL in FOR-SUPP group and 4221 ± 541 pg/mL in PLA-SUPP group. Thus, was there a significant difference in baseline plasma myostation between groups? Please correct decimal places in lines 409-410 (results section)

2. Please standardize the way of recording of ‘Fortetropin’ name throughout the manuscript – standardize to use or not to use ‘®’ sign.

3. Line 40: the following sing ‘-‘ is lacking the writing of ‘2-wk’.

4. Please standardize using or not to using spaces between special signs such as ‘=/±/>/5. Please standardize the way of recording of ‘vs.’ or ‘vs’ throughout the manuscript.

6. Line 108-111: In general, this part of the text is unclear and needs to be reworded.

7. Line 119, 471: Consider not using first person expressions.

8. Line 126: Precise the writing of the hours of arriving to the laboratory.

9. Line 166: Correct the writing of word ‘exercise’.

10. Standardize the writing of the names of study phases throughout the manuscript – sometimes capitals are used as a first letter of the name of the phases, and in the other parts of the manuscript lowercase is used.

11. Lines 168-169: Correct and standardize the writing of units (i.e., ‘steps/d-1; energy expenditure, kcal/d; metabolic equivalents of task [METs/d-1]’). It also refers to Table 2.

12. Line 194: Maybe it is better to write ‘3 trials’ if you are using the numbers in the earlier part of the paragraph (i.e., 4 repetitions).

13. Lines 204-205: What is the rational to use capitals for ‘Creatinine’, ‘Glucose’ etc.?

14. Line 306-307: Part of results are expressed as median and percentile ranges.

15. The references list it messy. It must be corrected according to PLoS One guidelines.

16. Please consider emergence ‘Conclusions’ from ‘Discussion section’.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Fabio Sarto

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2023 May 23;18(5):e0286222. doi: 10.1371/journal.pone.0286222.r002

Author response to Decision Letter 0

14 Mar 2023

We have uploaded it as a separate file labeled 'Response to Reviewers'.

Attachment

Submitted filename: PONE-D-22-33716_Responses to Reviewers_R1.docx

Click here for additional data file.^{(39.5KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0286222.r003

Decision Letter 1

Krzysztof Durkalec-Michalski

26 Apr 2023

PONE-D-22-33716R1Fortetropin® supplementation prevents the rise in circulating myostatin but not disuse-induced muscle atrophy in young men with limb immobilization: a randomized controlled trialPLOS ONE

Dear Dr. Phillips,

Thank you for submitting your manuscript to PLOS ONE.After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Jun 10 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Krzysztof Durkalec-Michalski, Ph.D

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: (No Response)

Reviewer #2: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Reviewer #1: The authors addressed most of my concerns.

In my opinion, the collection of blood samples only on days 14 and 28 should be clearly stated as a limitation of the manuscript.

Other minors comments:

L62: it's "Jones et al"

L537: add please the reference

Reviewer #2: Minor revisions

1. The reference list is still in mess. It must be improved.

2. The writing of values and units still require correction within the whole manuscript. Apart from ‘%’, Authors should use put space between the value and the unit. Unify the way of writing of units within the whole manuscript and in the figures/tables.

3. Line 62: Put ‘.’ after ‘et al.’.

4. What is the rational to use capitals for ‘Creatinine’, ‘Glucose’ etc.? – it should be corrected within the whole manuscript.

5. Lines 140-141: ‘All data were stored in a locked filing cabinet and a computer protected 141 by a password’ the sentence seems to be not necessary. It can be removed.

6. Line 163: Replace ‘consumed’ with ‘intake’.

7. Line 225: Replace ‘tissues’ with ‘samples’.

8. Replace ‘minutes’ with ‘min’ within the whole manuscript.

9. Lines 300 – 301: The space between these lines is wider compared to other lines.

10. Lines 333 and Table 2: I suggest replacing ‘activity’ with ‘energy expenditure related to/arising from physical activity’ or with similar expression. The expression ‘activity’ is misleading.

11. Line 355: ‘The value of immobilized leg LM showed a similar trend as vastus lateralis’ the sentence needs to be reformulated and improved. In the current version it is not clear.

12. Line 387: Pleas put the word ‘between’ before ‘groups’.

13. Regarding the remark from the first round of the review:

“Lines 337-352: It is not clear to which group (FOR-SUPP or PLA-SUPP) the provided results (CSA, LM, and changes in these indices) refer to? It must be clarified and specified. Are the values means or medians? Thank you. Because there was no time-by-group interaction, we described the data of the main effect for time using the values combined in both groups, with the saying ‘no difference between groups.’ We have revised the sentences to make them clearer for readers on lines 350-362. All data are presented as mean +/- SD.”

Please provide the information that you used mean value from both groups at the beginning of each paragraph within which the procedure was implemented.

14. Please verify if all the units provided in the Table 3 are correct.

15. Line 505: Remove ‘There were” from the beginning of the sentence.

16. Lines 541, 544: Authors can use ‘MPS’ instead of ‘muscle protein synthesis’.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Fabio Sarto

Reviewer #2: No

**********

PLoS One. 2023 May 23;18(5):e0286222. doi: 10.1371/journal.pone.0286222.r004

Author response to Decision Letter 1

28 Apr 2023

Thank you for the reviews. We have made revisions to our paper and offer the following respnoses to the reviewers’ points.

Reviewer #1: The authors addressed most of my concerns.

In my opinion, the collection of blood samples only on days 14 and 28 should be clearly stated as a limitation of the manuscript.

We have clearly stated that we did not collect blood samples on days 14 and 28 on lines 587-588.

Other minors comments:

L62: it's "Jones et al"

Thank you. We have corrected ‘Jone’ to “Jones” on line 62.

L537: add please the reference

We have cited the reference on line 540.

Reviewer #2: Minor revisions

1. The reference list is still in mess. It must be improved.

All references are inserted using EndNote software and all are corrected at the typsetting stage of manuscript preparation (by the publisher). Nonetheless, we have corrected the format of reference list according to the PLOS ONE guidelines.

We have corrected this throughout the manuscript and in the figures 2, 3, 4, 5, and 6.

3. Line 62: Put ‘.’ after ‘et al.’.

We have put ‘.’ after et al on line 62.

4. What is the rational to use capitals for ‘Creatinine’, ‘Glucose’ etc.? – it should be corrected within the whole manuscript.

Thanks for highlighting this. We have corrected the capitals to lower case throughout the manuscript.

5. Lines 140-141: ‘All data were stored in a locked filing cabinet and a computer protected 141 by a password’ the sentence seems to be not necessary. It can be removed.

We have removed the sentence on line 140.

6. Line 163: Replace ‘consumed’ with ‘intake’.

We have replaced ‘consumed’ with ‘intake’ on line 163.

7. Line 225: Replace ‘tissues’ with ‘samples’.

We have replaced ‘tissues’ with ‘samples’ on line 226.

8. Replace ‘minutes’ with ‘min’ within the whole manuscript.

We have replaced ‘minutes’ with ‘min’ throughout the manuscript.

9. Lines 300 – 301: The space between these lines is wider compared to other lines.

We have corrected the space to be same as others by changing the symbol, � on line 302.

We have changed ‘activity’ with ‘energy expenditure by physical activity’ in Table 2 and on lines 335-340.

11. Line 355: ‘The value of immobilized leg LM showed a similar trend as vastus lateralis’ the sentence needs to be reformulated and improved. In the current version it is not clear.

We have removed the sentence to avoid any confusion caused by it on line 359.

12. Line 387: Pleas put the word ‘between’ before ‘groups’.

We have added ‘between’ before ‘groups’ on line 391.

13. Regarding the remark from the first round of the review:

Please provide the information that you used mean value from both groups at the beginning of each paragraph within which the procedure was implemented.

We have clearly stated that it’s the mean value of the absolute CSA and immobilization leg LM on lines 353 and 363.

14. Please verify if all the units provided in the Table 3 are correct.

Thanks for highlighting this. We have corrected IU/L to U/L throughout the manuscript.

15. Line 505: Remove ‘There were” from the beginning of the sentence.

Thanks for highlighting this. We have removed ‘There were’ on line 509.

16. Lines 541, 544: Authors can use ‘MPS’ instead of ‘muscle protein synthesis’.

We have revised ‘muscle protein synthesis’ to ‘MPS’ on line 545 and 548.

Attachment

Submitted filename: PONE-D-22-33716_Responses to Reviewers_R2.pdf

Click here for additional data file.^{(61.1KB, pdf)}

PLoS One. doi: 10.1371/journal.pone.0286222.r005

Decision Letter 2

Krzysztof Durkalec-Michalski

11 May 2023

Fortetropin® supplementation prevents the rise in circulating myostatin but not disuse-induced muscle atrophy in young men with limb immobilization: a randomized controlled trial

PONE-D-22-33716R2

Dear Prof. Philips,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Krzysztof Durkalec-Michalski, Ph.D

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Reviewer #1: The authors addressed my all of my concerns and added the limitation requested.

I have no further comments.

Reviewer #2: (No Response)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Fabio Sarto

Reviewer #2: No

**********

PLoS One. doi: 10.1371/journal.pone.0286222.r006

Acceptance letter

Krzysztof Durkalec-Michalski

15 May 2023

PONE-D-22-33716R2

Fortetropin supplementation prevents the rise in circulating myostatin but not disuse-induced muscle atrophy in young men with limb immobilization: a randomized controlled trial

Dear Dr. Phillips:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Krzysztof Durkalec-Michalski

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. A representative image of vastus lateralis CSA obtained by ultrasonography.

VL, vastus lateralis; VI, vastus intermedius, RF, rectus femoris.

(TIF)

Click here for additional data file.^{(5.6MB, tif)}

S2 Fig. Representative images of skeletal muscle fiber type.

(A) merge of all the panels; (B) Type I fibers, purple; (C) Type II fibers, green; (D) Laminin, blue.

(TIF)

Click here for additional data file.^{(4.1MB, tif)}

S1 File. Consolidated standards of Reporting Trials flow diagram.

FOR-SUPP, Fortetropin® supplement; PLA-SUPP, placebo supplement.

(DOC)

Click here for additional data file.^{(56KB, doc)}

S2 File. Consolidated standards of reporting trials chart.

(DOC)

Click here for additional data file.^{(219.5KB, doc)}

S3 File. Minimal dataset.

(XLSX)

Click here for additional data file.^{(26.2KB, xlsx)}

S4 File. Western blot raw images.

(PDF)

Click here for additional data file.^{(11.1MB, pdf)}

Attachment

Submitted filename: PONE-D-22-33716_Responses to Reviewers_R1.docx

Click here for additional data file.^{(39.5KB, docx)}

Attachment

Submitted filename: PONE-D-22-33716_Responses to Reviewers_R2.pdf

Click here for additional data file.^{(61.1KB, pdf)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting information files.

[pone.0286222.ref001] 1.Lim C, Nunes EA, Currier BS, McLeod JC, Thomas ACQ, Phillips SM. An Evidence-Based Narrative Review of Mechanisms of Resistance Exercise-Induced Human Skeletal Muscle Hypertrophy. Med Sci Sports Exerc. 2022;54(9):1546–59. doi: 10.1249/MSS.0000000000002929 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0286222.ref002] 2.English KL, Paddon-Jones D. Protecting muscle mass and function in older adults during bed rest. Curr Opin Clin Nutr Metab Care. 2010;13(1):34–9. doi: 10.1097/MCO.0b013e328333aa66 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0286222.ref003] 3.Nunes EA, Stokes T, McKendry J, Currier BS, Phillips SM. Disuse-induced skeletal muscle atrophy in disease and nondisease states in humans: mechanisms, prevention, and recovery strategies. Am J Physiol Cell Physiol. 2022;322(6):C1068–C84. doi: 10.1152/ajpcell.00425.2021 [DOI] [PubMed] [Google Scholar]

[pone.0286222.ref004] 4.Srikanthan P, Karlamangla AS. Muscle mass index as a predictor of longevity in older adults. Am J Med. 2014;127(6):547–53. doi: 10.1016/j.amjmed.2014.02.007 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0286222.ref005] 5.Holloway TM, McGlory C, McKellar S, Morgan A, Hamill M, Afeyan R, et al. A Novel Amino Acid Composition Ameliorates Short-Term Muscle Disuse Atrophy in Healthy Young Men. Front Nutr. 2019;6:105. doi: 10.3389/fnut.2019.00105 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0286222.ref006] 6.McGlory C, Gorissen SHM, Kamal M, Bahniwal R, Hector AJ, Baker SK, et al. Omega-3 fatty acid supplementation attenuates skeletal muscle disuse atrophy during two weeks of unilateral leg immobilization in healthy young women. FASEB J. 2019;33(3):4586–97. doi: 10.1096/fj.201801857RRR [DOI] [PubMed] [Google Scholar]

[pone.0286222.ref007] 7.McPherron AC, Lawler AM, Lee SJ. Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature. 1997;387(6628):83–90. doi: 10.1038/387083a0 [DOI] [PubMed] [Google Scholar]

[pone.0286222.ref008] 8.Elliott B, Renshaw D, Getting S, Mackenzie R. The central role of myostatin in skeletal muscle and whole body homeostasis. Acta Physiol (Oxf). 2012;205(3):324–40. doi: 10.1111/j.1748-1716.2012.02423.x [DOI] [PubMed] [Google Scholar]

[pone.0286222.ref009] 9.McCroskery S, Thomas M, Maxwell L, Sharma M, Kambadur R. Myostatin negatively regulates satellite cell activation and self-renewal. J Cell Biol. 2003;162(6):1135–47. doi: 10.1083/jcb.200207056 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0286222.ref010] 10.Dirks ML, Wall BT, Snijders T, Ottenbros CL, Verdijk LB, van Loon LJ. Neuromuscular electrical stimulation prevents muscle disuse atrophy during leg immobilization in humans. Acta Physiol (Oxf). 2014;210(3):628–41. doi: 10.1111/apha.12200 [DOI] [PubMed] [Google Scholar]

[pone.0286222.ref011] 11.Gustafsson T, Osterlund T, Flanagan JN, von Walden F, Trappe TA, Linnehan RM, et al. Effects of 3 days unloading on molecular regulators of muscle size in humans. J Appl Physiol (1985). 2010;109(3):721–7. doi: 10.1152/japplphysiol.00110.2009 [DOI] [PubMed] [Google Scholar]

[pone.0286222.ref012] 12.Jones SW, Hill RJ, Krasney PA, O’Conner B, Peirce N, Greenhaff PL. Disuse atrophy and exercise rehabilitation in humans profoundly affects the expression of genes associated with the regulation of skeletal muscle mass. FASEB J. 2004;18(9):1025–7. doi: 10.1096/fj.03-1228fje [DOI] [PubMed] [Google Scholar]

[pone.0286222.ref013] 13.Sharp MH, Lowery RP, Mobley CB, Fox CD, de Souza EO, Shields KA, et al. The Effects of Fortetropin Supplementation on Body Composition, Strength, and Power in Humans and Mechanism of Action in a Rodent Model. J Am Coll Nutr. 2016;35(8):679–91. doi: 10.1080/07315724.2016.1142403 [DOI] [PubMed] [Google Scholar]

[pone.0286222.ref014] 14.Evans W, Shankaran M, Nyangau E, Field T, Mohammed H, Wolfe R, et al. Effects of Fortetropin on the Rate of Muscle Protein Synthesis in Older Men and Women: A Randomized, Double-Blinded, Placebo-Controlled Study. J Gerontol A Biol Sci Med Sci. 2021;76(1):108–14. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0286222.ref015] 15.White DA, Harkin KR, Roush JK, Renberg WC, Biller D. Fortetropin inhibits disuse muscle atrophy in dogs after tibial plateau leveling osteotomy. PLoS One. 2020;15(4):e0231306. doi: 10.1371/journal.pone.0231306 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0286222.ref016] 16.Glover EI, Phillips SM, Oates BR, Tang JE, Tarnopolsky MA, Selby A, et al. Immobilization induces anabolic resistance in human myofibrillar protein synthesis with low and high dose amino acid infusion. J Physiol. 2008;586(24):6049–61. doi: 10.1113/jphysiol.2008.160333 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0286222.ref017] 17.Glover EI, Yasuda N, Tarnopolsky MA, Abadi A, Phillips SM. Little change in markers of protein breakdown and oxidative stress in humans in immobilization-induced skeletal muscle atrophy. Appl Physiol Nutr Metab. 2010;35(2):125–33. doi: 10.1139/H09-137 [DOI] [PubMed] [Google Scholar]

[pone.0286222.ref018] 18.Oates BR, Glover EI, West DW, Fry JL, Tarnopolsky MA, Phillips SM. Low-volume resistance exercise attenuates the decline in strength and muscle mass associated with immobilization. Muscle Nerve. 2010;42(4):539–46. Epub 2010/07/27. doi: 10.1002/mus.21721 . [DOI] [PubMed] [Google Scholar]

[pone.0286222.ref019] 19.Sullivan GM, Feinn R. Using Effect Size-or Why the P Value Is Not Enough. J Grad Med Educ. 2012;4(3):279–82. doi: 10.4300/JGME-D-12-00156.1 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0286222.ref020] 20.Stokes T, Timmons JA, Crossland H, Tripp TR, Murphy K, McGlory C, et al. Molecular Transducers of Human Skeletal Muscle Remodeling under Different Loading States. Cell Rep. 2020;32(5):107980. doi: 10.1016/j.celrep.2020.107980 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0286222.ref021] 21.Traylor DA, Gorissen SHM, Phillips SM. Perspective: Protein Requirements and Optimal Intakes in Aging: Are We Ready to Recommend More Than the Recommended Daily Allowance? Adv Nutr. 2018;9(3):171–82. doi: 10.1093/advances/nmy003 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0286222.ref022] 22.Nunes EA, Colenso-Semple L, McKellar SR, Yau T, Ali MU, Fitzpatrick-Lewis D, et al. Systematic review and meta-analysis of protein intake to support muscle mass and function in healthy adults. J Cachexia Sarcopenia Muscle. 2022;13(2):795–810. doi: 10.1002/jcsm.12922 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0286222.ref023] 23.Stokes T, Tripp TR, Murphy K, Morton RW, Oikawa SY, Lam Choi H, et al. Methodological considerations for and validation of the ultrasonographic determination of human skeletal muscle hypertrophy and atrophy. Physiol Rep. 2021;9(1):e14683. doi: 10.14814/phy2.14683 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0286222.ref024] 24.Mackey AL, Kjaer M, Charifi N, Henriksson J, Bojsen-Moller J, Holm L, et al. Assessment of satellite cell number and activity status in human skeletal muscle biopsies. Muscle Nerve. 2009;40(3):455–65. doi: 10.1002/mus.21369 [DOI] [PubMed] [Google Scholar]

[pone.0286222.ref025] 25.Nederveen JP, Ibrahim G, Fortino SA, Snijders T, Kumbhare D, Parise G. Variability in skeletal muscle fibre characteristics during repeated muscle biopsy sampling in human vastus lateralis. Appl Physiol Nutr Metab. 2020;45(4):368–75. doi: 10.1139/apnm-2019-0263 [DOI] [PubMed] [Google Scholar]

[pone.0286222.ref026] 26.Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 2008;3(6):1101–8. doi: 10.1038/nprot.2008.73 [DOI] [PubMed] [Google Scholar]

[pone.0286222.ref027] 27.Curran-Everett D. Explorations in statistics: the log transformation. Adv Physiol Educ. 2018;42(2):343–7. doi: 10.1152/advan.00018.2018 [DOI] [PubMed] [Google Scholar]

[pone.0286222.ref028] 28.Reardon KA, Davis J, Kapsa RM, Choong P, Byrne E. Myostatin, insulin-like growth factor-1, and leukemia inhibitory factor mRNAs are upregulated in chronic human disuse muscle atrophy. Muscle Nerve. 2001;24(7):893–9. doi: 10.1002/mus.1086 [DOI] [PubMed] [Google Scholar]

[pone.0286222.ref029] 29.Delfino GB, Peviani SM, Durigan JL, Russo TL, Baptista IL, Ferretti M, et al. Quadriceps muscle atrophy after anterior cruciate ligament transection involves increased mRNA levels of atrogin-1, muscle ring finger 1, and myostatin. Am J Phys Med Rehabil. 2013;92(5):411–9. doi: 10.1097/PHM.0b013e3182643f82 [DOI] [PubMed] [Google Scholar]

[pone.0286222.ref030] 30.Smith RC, Lin BK. Myostatin inhibitors as therapies for muscle wasting associated with cancer and other disorders. Curr Opin Support Palliat Care. 2013;7(4):352–60. doi: 10.1097/SPC.0000000000000013 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0286222.ref031] 31.Myostatin Dasarathy S. and beyond in cirrhosis: all roads lead to sarcopenia. J Cachexia Sarcopenia Muscle. 2017;8(6):864–9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0286222.ref032] 32.Snijders T, Wall BT, Dirks ML, Senden JM, Hartgens F, Dolmans J, et al. Muscle disuse atrophy is not accompanied by changes in skeletal muscle satellite cell content. Clin Sci (Lond). 2014;126(8):557–66. [DOI] [PubMed] [Google Scholar]

[pone.0286222.ref033] 33.Bergen HR 3rd, Farr JN, Vanderboom PM, Atkinson EJ, White TA, Singh RJ, et al. Myostatin as a mediator of sarcopenia versus homeostatic regulator of muscle mass: insights using a new mass spectrometry-based assay. Skelet Muscle. 2015;5:21. doi: 10.1186/s13395-015-0047-5 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0286222.ref034] 34.McKay BR, Ogborn DI, Bellamy LM, Tarnopolsky MA, Parise G. Myostatin is associated with age-related human muscle stem cell dysfunction. FASEB J. 2012;26(6):2509–21. doi: 10.1096/fj.11-198663 [DOI] [PubMed] [Google Scholar]

[pone.0286222.ref035] 35.van Vliet S, Shy EL, Abou Sawan S, Beals JW, West DW, Skinner SK, et al. Consumption of whole eggs promotes greater stimulation of postexercise muscle protein synthesis than consumption of isonitrogenous amounts of egg whites in young men. Am J Clin Nutr. 2017;106(6):1401–12. doi: 10.3945/ajcn.117.159855 [DOI] [PubMed] [Google Scholar]

[pone.0286222.ref036] 36.Santos HO, Gomes GK, Schoenfeld BJ, de Oliveira EP. The Effect of Whole Egg Intake on Muscle Mass: Are the Yolk and Its Nutrients Important? Int J Sport Nutr Exerc Metab. 2021;31(6):514–21. doi: 10.1123/ijsnem.2021-0086 [DOI] [PubMed] [Google Scholar]

[pone.0286222.ref037] 37.Suetta C, Hvid LG, Justesen L, Christensen U, Neergaard K, Simonsen L, et al. Effects of aging on human skeletal muscle after immobilization and retraining. J Appl Physiol (1985). 2009;107(4):1172–80. doi: 10.1152/japplphysiol.00290.2009 [DOI] [PubMed] [Google Scholar]

[pone.0286222.ref038] 38.Gibson JN, Halliday D, Morrison WL, Stoward PJ, Hornsby GA, Watt PW, et al. Decrease in human quadriceps muscle protein turnover consequent upon leg immobilization. Clin Sci (Lond). 1987;72(4):503–9. doi: 10.1042/cs0720503 [DOI] [PubMed] [Google Scholar]

[pone.0286222.ref039] 39.Deitrick JE. The effect of immobilization on metabolic and physiological functions of normal men. Bull N Y Acad Med. 1948;24(6):364–75. [PMC free article] [PubMed] [Google Scholar]

[pone.0286222.ref040] 40.Reggiani C, Schiaffino S. Muscle hypertrophy and muscle strength: dependent or independent variables? A provocative review. Eur J Transl Myol. 2020;30(3):9311. doi: 10.4081/ejtm.2020.9311 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0286222.ref041] 41.Sarto F, Stashuk DW, Franchi MV, Monti E, Zampieri S, Valli G, et al. Effects of short-term unloading and active recovery on human motor unit properties, neuromuscular junction transmission and transcriptomic profile. J Physiol. 2022. doi: 10.1113/JP283381 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0286222.ref042] 42.Sale DG. Neural adaptation to resistance training. Med Sci Sports Exerc. 1988;20(5 Suppl):S135–45. doi: 10.1249/00005768-198810001-00009 [DOI] [PubMed] [Google Scholar]

[pone.0286222.ref043] 43.Lala V, Zubair M, Minter DA. Liver Function Tests. StatPearls. Treasure Island (FL); 2022. [PubMed] [Google Scholar]

PERMALINK

Fortetropin supplementation prevents the rise in circulating myostatin but not disuse-induced muscle atrophy in young men with limb immobilization: A randomized controlled trial

Changhyun Lim

James McKendry

Taylor Giacomin

Jonathan C Mcleod

Sean Y Ng

Brad S Currier

Giulia Coletta

Stuart M Phillips

Roles

Abstract

Introduction

Materials and methods

Participants and ethics approval

Experimental design

Fig 1. Schematic overview of the study protocol.

Nutritional supplements

Diet and physical activity

Ultrasonography

Knee extensor isometric muscle torque

Blood measurements

Muscle biopsy

Immunohistochemistry

Western blotting

RNA isolation, reverse transcription, and real-time quantitative PCR

Statistical analysis

Results

Participant’s baseline characteristics

Table 1. Baseline characteristics of the participants.

Physical activity

Table 2. Physical activity during each phase.

Vastus lateralis CSA and LM of the immobilized leg

Fig 2.

Muscle fiber CSA

Fig 3.

Isometric knee-extensor torque

Fig 4.

Blood variables

Table 3. Blood variables at day 1 and 42.

Fig 5.

SC and myostatin-positive SC content

Fig 6.

Gene and protein expression

Fig 7.

Discussion

Conclusions

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Krzysztof Durkalec-Michalski

Roles

Author response to Decision Letter 0

Decision Letter 1

Krzysztof Durkalec-Michalski

Roles

Author response to Decision Letter 1

Decision Letter 2

Krzysztof Durkalec-Michalski

Roles

Acceptance letter

Krzysztof Durkalec-Michalski

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases