Skip to main content
NCBI home page
Veterinary World logoLink to Veterinary World
. 2023 Apr 9;16(4):711–716. doi: 10.14202/vetworld.2023.711-716

Characterization of polymorphisms in the follicle-stimulating hormone receptor and insulin-like growth factor-1 genes and their association with fertility traits in Jawa-Brebes cows

Slamet Hartanto 1,2,✉, Agung Budiyanto 1, Rini Widayanti 3, Erif Maha Nugraha Setyawan 1, Imawan Daru Prasetya 4
PMCID: PMC10206960  PMID: 37235159

Abstract

Background and Aim:

The availability of fertility markers is crucial for maintaining, protecting, and improving the genetics of Jawa-Brebes (Jabres) cows. Follicle-stimulating hormone receptor (FSHR) and insulin-like growth factor-1 (IGF-1) play critical roles in female reproductive physiology. The single-nucleotide polymorphisms (SNPs) FSHR G-278A and IGF-1 C-512T correlate with cows’ fertility traits. This study aimed to identify these SNPs and their potential associations with fertility parameters in Jabres cows.

Materials and Methods:

Samples were collected from 45 heads of multiparous Jabres cows aged 3–10 years with body condition scores of 2.5–5.0 on a 5-point scale in Brebes Regency, Java, Indonesia. These cows were assigned to fertile (n = 16) and infertile groups (n = 29). Polymerase chain reaction (PCR) was carried out for DNA amplification of FSHR G-278A and IGF-1 C-512T fragments. Restriction fragment length polymorphism-PCR with the restriction enzymes FaqI for the product of FSHR G-278A and SnaBI for the product of IGF-1 C-512T was used to identify SNPs.

Results:

The FaqI enzyme cut the 211 bp DNA fragment of FSHR G-278A in all samples into two bands of 128 bp and 83 bp (GG genotype). Meanwhile, the genotyping of amplicon products of IGF-1 C-512T generated a single 249 bp fragment (CC genotype) in both groups.

Conclusion:

The results showed that the FSHR G-278A/FaqI and IGF-1 C-512T/SnaBI loci were monomorphic in Jabres cows. Thus, neither FSHR G-278A/FaqI nor IGF-1 C-512T/SnaBI is a possible genetic marker for fertility in Jabres cows.

Keywords: fecundity, genetic marker, Indonesian cow, restriction fragment length polymorphism-polymerase chain reaction

Introduction

Jawa-Brebes (Jabres) cattle, an indigenous Indonesian breed found in Brebes Regency, Java, Indonesia, are renowned for unique reproductive characteristics, including a birth rate of 15–20 calves during the lifespan and good reproductive function when fed inadequate diets [1]. This breed is classified as having a protected and preserved livestock germplasm [2] and plays vital socioeconomic roles [3]. However, there is no effective Jabres breeding program for selecting dams, leading to low pregnancy and calving rates. This contributes to shrinking the population and threatens the survival of Jabres. Indeed, the population of Jabres decreased from 13,890 heads to 12,082 heads in 2021 [4]. There is thus an urgent need for research on genetic markers of fertility to protect, preserve, and enhance the genetics and population of Jabres cows.

Follicle-stimulating hormone (FSH) is an essential glycoprotein hormone that critically controls male and female reproductive physiology [5]. It promotes follicular growth and development and facilitates the production of related proteins in parietal granulosa cells in females [6]. Follicle-stimulating hormone exerts its physiological effects through the FSH receptor (FSHR) [7]. It is mainly found in ovarian granulosa cells in female animals [8–10].

In female livestock, single-nucleotide polymorphisms (SNPs) in the 5’-upstream region (5’-UTR) of the FSHR gene have been significantly identified as valuable fertility indicators. For example, significant associations between SNPs in the 5’-UTR of the FSHR gene and the litter size of Chinese native ewes have been identified [11, 12]. Moreover, in Chinese Holstein cows, an SNP in the 5’-UTR of the FSHR gene (FSHR G-278A) was found to correlate with the superovulation response [13]. Furthermore, the FSHR G-278A mutation was shown to influence service per conception (S/C) in Holstein dairy cows [14].

Meanwhile, insulin-like growth factor-1 (IGF-1), which is secreted by liver cells and various other cells, functions as a fundamental growth factor in numerous physiological activities, including reproduction, fetal development, and growth [15–17]. IGF-1 is crucial in female mammalian fertility because it regulates ovarian function, follicle development, oocyte maturation, and preimplantation embryos [18]. By interacting with gonadotropins, the IGF-1 gene stimulates the growth and steroidogenesis of ovarian cells, promoting ovarian function [19]. In addition, IGF-1 inhibits follicular atresia [20].

Based on reported studies, the IGF-1 gene is a strong putative genetic marker for the reproductive traits of female animals. Insulin-like growth factor-1 polymorphisms have been reported to be correlated with the litter size of Gulin Ma goat and Small Han Tail sheep [21, 22]. In addition, SNPs in the IGF-1 gene have been shown to influence the fertility rate of Sarda ewes [23]. Mutation of T to C at position 512 in the regulatory region of the IGF-1 gene (IGF-1 C-512T) is the most studied SNP in the IGF-1 gene associated with fertility traits in cows. This SNP influences the length of the period from calving to commencement of luteal activity (CLA) postpartum, whereby CLA is essential for subsequent pregnancy after calving [24]. The IGF-1 C-512T mutation has also been reported to influence calving-first service interval in primiparous Holstein cows [25]. Moreover, several reproductive traits of Holstein cows, such as postpartum estrus and days open, are affected by the SNP IGF-1 C-512T [26].

Restriction fragment length polymorphism-polymerase chain reaction (RFLP-PCR) methods with the FaqI restriction enzyme for the FSHR gene and the SnaBI restriction enzyme for the IGF-1 gene have been developed to detect fertility markers for dairy cows [13, 14, 24–26].

However, to the best of our knowledge, no study of these has been conducted on Jabres cows. This study aimed to identify FSHR G-278A and IGF-1 C-512T SNPs and investigate their possible associations with fertility traits, including postpartum estrus, days open, and calving interval (CI), in Jabres cows.

Materials and Methods

Ethical approval and Informed consent

All experimental procedures were approved by the Research Ethics Committee of the Faculty of Veterinary Medicine, Universitas Gadjah Mada, Indonesia (00143/EC-FKH/Int./2021). In addition, this research was conducted with the verbal consent of farmers as the cows’ owners.

Study period and location

The study was carried out from November 2021 to March 2022 on smallholder farmers in the sub-district of Bantar Kawung, Brebes Regency, Central Java Province, Indonesia, and Biochemistry Department, Gadjah Mada University, Yogyakarta, Indonesia.

Animals

The animals included in this study were multiparous Jabres cows aged 3–10 years with body condition scores of 2.5–5.0 on a 5-point scale. The cows were observed in the sub-district of Bantar Kawung, Brebes Regency, Central Java Province, Indonesia, where the breed originated. The reproductive characteristics recorded and used were postpartum estrus (PPE), days not pregnant (DNP), and CI. The Jabres cows were allocated to two groups: (a) Fertile, defined as PPE of <90 days, DNP of <120 days, and CI of <390 days; and (b) Infertile, defined as EPP of more than 90, DNP of more than 120 days, and CI of more than 390 days. There were 19 Jabres cows in the Fertile group and 26 in the Infertile group. The cows were reared under conditions with management by farmers. Specifically, all cows in this study were raised semi-intensively by smallholder farmers under similar conditions. All cows grazed on native pastures in the morning and were fed rice and corn straw in the afternoon. Water was provided before and after grazing.

Sample collection and DNA extraction

Blood samples (750 μL) were drawn from the jugular vein of each animal through a 5 mL sterile syringe and put into a 1.5 mL microtube containing 750 μL of absolute ethanol. Blood samples in microtubes were aerated at room temperature (25°C) for 1 d before DNA extraction. Each sample (200 μL) was used for DNA extraction using the gSYNC™ DNA Mini Extraction Kit (Geneaid Biotech Ltd., Taipei, Taiwan), in accordance with the manufacturer’s protocol. Then, DNA samples were kept at −20°C until further molecular analysis.

Primers

The primers used for FSHR G-278A and IGF-1 C-512T are shown in Table-1 [14, 24]. Primer synthesis was performed by the Genetika Science Company in Indonesia.

Table-1.

Primers used for RFLP-PCR of FSHR and IGF-1 gene fragments.

Gene and region SNP (Genbank accession) Fragment length Primers (5’–3’) Reference
FSHR 5’- UTR region G-278A (GU253337) 211 bp F – TCCCTGCCCTTCAGTGACGAAC
R – AGATACGCCGTCCCCTTTACCT		 [14]
IGF-1 Regulatory region C-512T (AF017143) 249 bp F – ATTACAAAGCTGCCTGCCCC
R – ACCTTACCCGTATGAAAGGAATATACGT		 [24]
Open in a new tab

RFLP-PCR=Restriction fragment length polymorphism-polymerase chain reaction, FSHR=Follicle-stimulating hormone receptor, IGF-1=Insulin-like growth factor-1, SNP=Single-nucleotide polymorphisms

Polymerase chain reaction reactions

The PCR reaction to amplify FSHR G-278A and IGF-1 C-512T DNA for all samples comprised a total volume of 50 μL featuring 25 μL of master mix (Bioline My Taq HS Red Mix, 1st Base, Meridian Life Science Inc., London, UK), 20 μL of distilled water, 3 μL of DNA template, and 1 μL (10 pmol) of each primer. The PCR reaction was performed using the Infinigen PCR machine (Biotech Infinigen, CA, USA) with initial denaturation at 94°C for 5 min, followed by 35 cycles at 94°C for 45 s, 55°C for 30 s, and 72°C for 45 s, with final extension at 72°C for 5 min. PCR products were electrophoresed on 1% agarose gel with a 1000 bp DNA ladder (Genaid, Taiwan).

Genotyping

Restriction fragment length polymorphism-polymerase chain reaction for FSHR G-278A was carried out in a final volume of 8.15 μL consisting of 2.5 μL of PCR product, 4.5 μL of nuclease-free water, 0.5 μL of 10× Buffer Tango, 0.15 μL of 50× SAM, and 0.5 μL of FaqI restriction enzyme (#ER1811, Thermo Fisher Scientific Inc., MA, USA), followed by incubation at 37°C for 16 h. To detect genetic variants of specific base fragments of IGF-1 C-512T, reactions were performed using 2.5 μL of PCR product added to 4.5 μL of nuclease-free water, 0.5 μL of 10× Buffer Tango, and 0.5 μL of SnaBI restriction enzyme (#ER0401, Thermo Fisher Scientific Inc.), followed by incubation at 37°C for 4 h. The restricted fragments were confirmed by 1.5% agarose gel electrophoresis with a 100 bp DNA ladder (Genaid) and then visualized using an ultraviolet transilluminator (UVP®, Fullerton, CA, USA).

Individual genotypes were determined by analyzing the restricted fragment size reported as base pairs. The fragments identified by FaqI [GGGAC(10/14)↓] for FSHR G-278A were FaqI (GG): 128 and 83 bp; FaqI (GA): 211, 128, and 83 bp; and FaqI (AA) 211 bp (unrestricted). The genotypes identified by SnaBI (TAC↓GTA) for IGF-1 C-512T were SnaBI (TT): 223 and 26 bp; SnaBI (CT): 249, 223, and 26 bp; and SnaBI (CC): 249 bp (unrestricted). These fragments identified for the FSHR and IGF-1 genes were putative genetic markers for fertility in cows [14, 26].

Statistical analysis

Restriction fragment length polymorphism-polymerase chain reaction data were analyzed by calculating the allele and genotype frequencies as follows:

graphic file with name Vetworld-16-711-g001.jpg

Where Xi is the genotype frequency, Xii is the allele frequency, nii is the number of genotype AiAi, nij is the number of genotype AiAj, and N is the total samples.

Results

Restriction fragment length polymorphism-polymerase chain reaction on the FSHR gene

Figure-1 displays the amplification of 211 bp DNA fragments associated with FSHR G-278A of Jabres cows. Restriction fragment length polymorphism-polymerase chain reaction with the FaqI restriction enzyme was performed to cut the mutation point of the amplified DNA fragment of FSHR G-278A. The enzyme cut this fragment into two bands of 128 and 28 bp in all samples from both groups, as demonstrated in Figure-2. This confirmed that all of the studied samples were monomorphic and genotyped as GG genotypes (Table-2).

Figure-1.

Figure-1

Open in a new tab

The electrophoresed polymerase chain reaction products of the FSHR gene in the Jabres cows. Lane M: Marker. Lanes 1–8: the electrophoresis results of the amplified FSHR gene in the infertile group of Jabres cows with a length of 211 bp. Lanes 9–15: the electrophoresis results of the amplified FSHR gene in the fertile group of Jabres cows with a length of 211 bp. FSHR=Follicle-stimulating hormone receptor.

Figure-2.

Figure-2

Open in a new tab

The electrophoresis showing FSHR gene products restricted with FaqI enzyme in the Jabres cows. Lane M: Marker. Lanes C: PCR products of FSHR gene (211 bp) as controls. Lanes 1–6: RFLP-PCR products of FSHR gene restricted with FaqI (128 bp and 83 bp) in the infertile group of Jabres cows. Lanes 7–12: RFLP-PCR products of FSHR gene restricted with FaqI (128 bp and 83 bp) in the fertile group of Jabres cows. FSHR=Follicle-stimulating hormone receptor, PCR=Polymerase chain reaction, RFLP-PCR=Restriction fragment length polymorphism-polymerase chain reaction.

Table-2.

Genotype and allele frequencies of FSHR gene in Jabres cows.

Group N (heads) Genotype frequency Allele frequency
GG GA AA G A
Fertile 19 01.00 00.00 00.00 01.00 00.00
Infertile 26 01.00 00.00 00.00 01.00 00.00
Open in a new tab

GG and AA=Homozygous genotypes, GA=Heterozygous genotypes, G and A=Alleles, FSHR=Follicle-stimulating hormone receptor

Restriction fragment length polymorphism-polymerase chain reaction on the IGF-1 gene

This study showed that the PCR amplification of IGF-1 C-512T produced a 249 bp DNA fragment, as displayed in Figure-3. The SnaBI restriction enzyme was used for genotyping amplicon products. However, the specific DNA-cutting sites of IGF-1 C-512T were left uncut by the SnaBI enzyme in all Jabres cows of both groups. Therefore, the genotyping of amplicon products of IGF-1 C-512T in Jabres cows generated a single 249 bp fragment, as shown in Figure-4. This indicated that all of these Jabres cows possessed the same genotype, namely, the CC genotype (Table-3).

Figure-3.

Figure-3

Open in a new tab

The electrophoresis figure displaying PCR product (249 bp) of IGF-1 in the Jabres cows. Lane M: Marker. Lanes 1–8: 249 bp PCR product of IGF-1 gene in the infertile group of Jabres cows. Lanes 9–15: 249 bp PCR product of IGF-1 gene in the fertile group of Jabres cows. PCR=Polymerase chain reaction, IGF-1=Insulin-like growth factor-1.

Figure-4.

Figure-4

Open in a new tab

Gel electrophoresis displaying the IGF-1 gene products restricted with SnaBI enzyme in the Jabres cows. Lane M: Marker. Lanes C: PCR products of IGF-1 gene (249 bp) as controls. Lanes 1–6: 249 bp RFLP-PCR products of IGF-1 gene restricted with SnaBI enzyme in the infertile group of Jabres cows. Lanes 7–12: 249 bp RFLP-PCR products of IGF-1 gene restricted with SnaBI enzyme in the fertile group of Jabres cows. IGF-1=Insulin-like growth factor-1, PCR=Polymerase chain reaction, RFLP-PCR=Restriction fragment length polymorphism-polymerase chain reaction.

Table-3.

Genotype and allele frequencies of IGF-1 gene in Jabres cows.

Group N (heads) Genotype frequency Allele frequency
CC CT TT C T
Fertile 19 01.00 00.00 00.00 01.00 00.00
Infertile 26 01.00 00.00 00.00 01.00 00.00
Open in a new tab

CC and TT=Homozygous genotypes, CT=Heterozygous genotypes, C and T=Alleles, IGF-1=Insulin-like growth factor-1

Discussion

Follicle-stimulating hormone receptor is necessary for ovarian follicle development and ovulation [27]. Several signaling pathways that promote follicle development and estrogen synthesis are activated by FSHR [28]. Numerous studies have shown that FSHR mutations are indicators of fertility and infertility during female reproduction. In addition, the SNP FSHR rs6166 is a genetic indicator of premature ovarian insufficiency (POI) in Asian women [29]. Folliculogenesis failure caused by the mutation of the FSHR gene led to premature ovarian insufficiency in women [30]. Moreover, Lindgren et al. [31] discovered that the FSHR variant N680S is an excellent predictor of pregnancy probability in female patients undergoing in vitro fertilization.

Single-nucleotide polymorphisms in the FSHR gene are also significantly associated with ovarian activity in cows. For example, Yang et al. [13] reported that an SNP in the 5’-UTR region of FSHR (FSHR G-278A) is correlated with superovulation response, including the total number of ova and the number of transferable embryos, in Chinese Holstein cows. Single-nucleotide polymorphisms in the coding region (c.337C>G, c.871A>G and c.1973C>G) of the FSHR gene also influence the numbers of embryos yielded and unfertilized oocytes in Holstein cows [32]. Furthermore, Hirayama et al. [33] demonstrated that the FSHR SNP c.337C>G affected the number of embryos produced by superovulation in Japanese Black cattle. This variant was also shown to affect the ovulation rates in beef heifers [34].

Although the FSHR gene is crucial in reproduction and fertility traits, we discovered that the studied locus of FSHR G-278A in the 5’-UTR in the fertile and infertile Jabres groups was monomorphic. No variation in the FSHR G-278A/SnaBI locus was found in any Jabres cows. Follicle-stimulating hormone receptor G-278A appears to be highly conserved within the investigated Jabres cow groups. This may be due to the high inbreeding coefficient of the investigated population or the presence of a connection between the sampled animals. It has been reported that uncontrolled mating resulted in highly inbred Jabres cattle [35]. Thus, the FSHR G-278A/SnaBI locus does not affect fertility traits in Jabres cows.

Our result is similar to the finding of Abeygunawardana et al. [36], who reported that the FSHR G-278A/SnaBI locus had no association with fertility traits in crossbred multiparous dairy cows (Bos indicus × Bos taurus). Moreover, because no variation was found, it was reported that the FSHR gene was not correlated with reproductive parameters, including ovarian hypofunction in Madrasin cattle [37]. However, these findings contrast with the results of Sharifiyazdi et al. [14], who found that the FSHR G-278A/SnaBI locus affected the reproductive traits of Holstein dairy cows, such as S/C. An FSHR SNP at A-320T/TaqI of the 5’-UTR region was also reported to be associated with S/C in Antioquia Holstein cattle [38].

IGF-1 is a central regulator of many intraovarian activities during follicular development [39]. It promotes follicular development by regulating the proliferation and differentiation of granulosa cells, steroid synthesis, and gonadotropin stimulation [40]. Moreover, granulosa cells regulate oocyte development in ovarian follicles by synthesizing steroids and growth factors [41]. SNPs in IGF-1 have been reported to be closely associated with fertility in female livestock [21–23, 42].

In our investigation, genotyping of IGF-1 C-512T with the SnaBI enzyme generated a single CC genotype with a DNA fragment of 249 bp in all Jabres cows. Consequently, only the C allele was discovered and no T allele was detected. Although our study included few samples, this work indicated no association between the SNP IGF-1 C-512T and reproductive traits in Jabres cows. Anggraeni et al. [43] also discovered no correlation between intron 1 of the IGF-1/SnaBI locus and fertility traits in Peranakan Ongole cows. The genotype of IGF-1 C-512T/SnaBI was also reported not to affect the fertility of Holstein cows reared semi-intensively or intensively [44]. However, Silveira et al. [26] found that the SNP IGF-1 C-512T/SnaBI correlated with fertility parameters of Holstein cows, including postpartum estrus and days open. Moreover, the SNP IGF-1 C-512T/SnaBI was found to influence CLA as a crucial factor for the following pregnancy after calving [24] and the calving-first service interval in Holstein cows [25].

Conclusion

Neither FSHR G-278A/FaqI nor IGF-1 C-512T/SnaBI is a possible genetic marker for fertility in Jabres cows. Due to the crucial roles of the FSHR and IGF-1 genes, further study is needed to search for other loci within these essential genes in Jabres cows. A study with a larger sample size is also necessary to confirm the effect of specific SNPs of the FSHR and IGF-1 genes on the reproductive characteristics of Jabres cows.

Authors’ Contributions

SH and AB: Designed the study and wrote, edited, and revised the manuscript. SH and RW: Conducted study in the laboratory. SH, AB, and RW: Analyzed and interpreted the data. AB, RW, and EMNS: Supervised the study and reviewed the manuscript. SH and IDP: Collected the data and blood samples. All authors have read, reviewed, and approved the final manuscripts.

Acknowledgments

This study was funded by Penelitian Disertasi Doktor grant of Gadjah Mada University, Indonesia, with reference number 089/E5/PG.02.00.PT/2022;1882/UN1/DITLIT/Dit-Lit/PT.01.03/2022. The authors are thankful to Tri Budi Wibowo for his assistance in collection of the blood samples. The authors are also thankful to Ismu Subroto as head of the Livestock and Animal Health Office of Brebes Regency and Jabres Farmers for their cooperation.

Competing Interests

The authors declare that they have no competing interests.

Publisher’s Note

Veterinary World remains neutral with regard to jurisdictional claims in published institutional affiliation.

References

  • 1.Panjono P, Haq M.S, Hanim C, Andarwati S, Maharani D, Widayati D.T, Budisatria I.G.S. Reproductive performance of Jabres cow at Brebes, Central Java Province, Indonesia. In: Isnansetyo A, Nuringtyas T.R, editors. Proceeding of the 1st International Conference on Tropical Agriculture. Cham, Switzerland: Springer International Publishing; 2017. pp. 421–423. [Google Scholar]
  • 2.Kementerian Pertanian. Keputusan Nomor 2842/KPTS/LB.430/8/2012 Tentang Penetapan Rumpun Sapi Jawa-Brebes. Kementerian Pertanian, Jakarta, Indonesia. 2012 [Google Scholar]
  • 3.Haq M.S, Budisatria I.G.S, Panjono P, Maharani D. Measuring the social economic benefits of Jabres cattle keeping in Bantarkawung sub-district, Brebes, Central Java, Indonesia. J. Indones. Trop. Anim. Agric. 2019;44(2):220–227. [Google Scholar]
  • 4.Badan Pusat Statistik. Populasi Ternak Menurut Kecamatan dan Jenis Ternak di kabupaten Brebes (Ekor), 2020 and 2021. Badan Pusat Statistik, Brebes, Indonesia. 2022. Available from: https://www.brebeskab.bps.go.id/statictable/2022/03/17/2042/populasi-ternak-menurut-kecamatan-dan-jenis-ternak-di-kabupaten-brebes-ekor-2020-dan-2021.html . Retrieved on 09-01-2023.
  • 5.Das N, Kumar T.R. Molecular regulation of follicle-stimulating hormone synthesis, secretion and action. J. Mol. Endocrinol. 2018;60(3):R131–R155. doi: 10.1530/JME-17-0308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Widayati D.T, Pangestu M. Effect of follicle-stimulating hormone on Bligon goat oocyte maturation and embryonic development post in vitro fertilization. Vet. World. 2020;13(11):2443–2446. doi: 10.14202/vetworld.2020.2443-2446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Casarini L, Crépieux P. Molecular mechanisms of action of FSH. Front. Endocrinol. (Lausanne) 2019;10:305. doi: 10.3389/fendo.2019.00305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Houde A, Lambert A, Saumande J, Silversides D.W, Lussier J.G. Structure of the bovine follicle-stimulating hormone receptor complementary DNA and expression in bovine tissues. Mol. Reprod. Dev. 1994;39(2):127–135. doi: 10.1002/mrd.1080390202. [DOI] [PubMed] [Google Scholar]
  • 9.Zhou N, Wang N, Qin X, Liu Q, Wang J, Dong H, Zhou J, Fang F. Expression of follicle-stimulating hormone receptor (FSHR), protein kinase B-2 (AKT2) and adapter protein with PH domain, PTB domain, and leucine zipper (APPL1) in pig ovaries. Pol. J. Vet. Sci. 2017;20(4):661–667. doi: 10.1515/pjvs-2017-0083. [DOI] [PubMed] [Google Scholar]
  • 10.Xia Y, Wang Q, He X.D, Chen Y, JiGe M.T, Zi X.D. Cloning and expression analysis of the follicle-stimulating hormone receptor (FSHR) gene in the reproductive axis of female yaks (Bos grunniens) Domest. Anim. Endocrinol. 2020;70:106383. doi: 10.1016/j.domaniend.2019.07.011. [DOI] [PubMed] [Google Scholar]
  • 11.Chu M.X, Guo X.H, Feng C.J, Li Y, Huang D.W, Feng T, Cao G.L, Fang L, Di R, Tang Q.Q, Ma Y.H, Li K. Polymorphism of 5'regulatory region of ovine FSHR gene and its association with litter size in Small Tail Han sheep. Mol. Biol. Rep. 2012;39(4):3721–3725. doi: 10.1007/s11033-011-1147-x. [DOI] [PubMed] [Google Scholar]
  • 12.Wang W, Liu S, Li F, Pan X, Li C, Zhang X, Ma Y, La Y, Xi R, Li T. Polymorphisms of the ovine BMPR-IB, BMP-15 and FSHR and their associations with litter size in two Chinese indigenous sheep breeds. Int. J. Mol. Sci. 2015;16(5):11385–11397. doi: 10.3390/ijms160511385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Yang W.C, Li S.J, Tang K.Q, Hua G.H, Zhang C.Y, Yu J.N, Han L, Yang L.G. Polymorphisms in the 5'upstream region of the FSH receptor gene, and their association with superovulation traits in Chinese Holstein cows. Anim. Reprod. Sci. 2010;119(3–4):172–177. doi: 10.1016/j.anireprosci.2010.02.004. [DOI] [PubMed] [Google Scholar]
  • 14.Sharifiyazdi H, Mirzaei A, Ghanaatian Z. Characterization of polymorphism in the FSH receptor gene and its impact on some reproductive indices in dairy cows. Anim. Reprod. Sci. 2018;188:45–50. doi: 10.1016/j.anireprosci.2017.11.006. [DOI] [PubMed] [Google Scholar]
  • 15.Agrogiannis G.D, Sifakis S, Patsouris E.S, Konstantinidou A.E. Insulin-like growth factors in embryonic and fetal growth and skeletal development (Review) Mol. Med. Rep. 2014;10(2):579–584. doi: 10.3892/mmr.2014.2258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Laron Z. Insulin-like growth factor-1 (IGF-1):A growth hormone. Mol. Pathol. 2001;54(5):311–316. doi: 10.1136/mp.54.5.311. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Neirijnck Y, Papaioannou M.D, Nef S. The insulin/IGF system in mammalian sexual development and reproduction. Int. J. Mol. Sci. 2019;20(18):4440. doi: 10.3390/ijms20184440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Qi M, Roth Z, Liu D. Insulin-like growth factor-I (IGF-I) in reproduction system of female bovine. J. Northeast Agric. Univ. (Engl. Ed.) 2011;18(4):84–87. [Google Scholar]
  • 19.Lucy M.C. Regulation of ovarian follicular growth by somatotropin and insulin-like growth factors in cattle. J. Dairy Sci. 2000;83(7):1635–1647. doi: 10.3168/jds.S0022-0302(00)75032-6. [DOI] [PubMed] [Google Scholar]
  • 20.Han Y, Wang S, Wang Y, Zeng S. IGF-1 inhibits apoptosis of porcine primary granulosa cell by targeting degradation of BimEL. Int. J. Mol. Sci. 2019;20(21):5356. doi: 10.3390/ijms20215356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.He J.N, Zhang B.Y, Chu M.X, Wang P.Q, Feng T, Cao G.L, Di R, Fang L, Huang D.W, Tang Q.Q, Li N. Polymorphism of insulin-like growth factor-1 gene and its association with litter size in Small Tail Han sheep. Mol. Biol. Rep. 2012;39(10):9801–9807. doi: 10.1007/s11033-012-1846-y. [DOI] [PubMed] [Google Scholar]
  • 22.Wang P.Q, Tan Y, Zhang B.Y, Chu M.X, Deng L.M, Fan Q, Liu C.X. DNA polymorphisms of 5'-flanking region of insulin-like growth factor-1 gene and their association with reproduction traits in goats. Agric. Sci. China. 2011;10(10):1609–1617. [Google Scholar]
  • 23.Sebastiano L, Consuelo M.M, Veronica D.S.M, Luisa P, Giovanni C, Michella N, Vincenzo C. Polymorphism of insulin-like growth factor-1 gene and its relationship with reproductive performances and milk yield in Sarda dairy sheep. Vet. Anim. Sci. 2020;9:100084. doi: 10.1016/j.vas.2019.100084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Nicolini P, Carriquiry M, Meikle A.A. Polymorphism in the insulin-like growth factor-1 gene is associated with postpartum resumption of ovarian cyclicity in Holstein-Friesian cows under grazing conditions. Acta Vet. Scand. 2013;55(1):11. doi: 10.1186/1751-0147-55-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Ruprechter G, Carriquiry M, Ramos J.M, Pereira I, Ana M. Metabolic and endocrine profiles and reproductive parameters in dairy cows under grazing conditions:Effect of polymorphisms in somatotropic axis genes. Acta Vet. Scand. 2011;53(1):35. doi: 10.1186/1751-0147-53-35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Silveira P.A.S, Butler W.R, da Silva T.C, Barros C.C, Corrêa M.N, Schneider A. Association of polymorphisms in the IGF-I, GHR and STAT5A genes with serum IGF-I concentration and reproductive performance of Holstein dairy cows. Anim. Reprod. Sci. 2019;211:106206. doi: 10.1016/j.anireprosci.2019.106206. [DOI] [PubMed] [Google Scholar]
  • 27.Shimizu K, Nakamura T, Bayasula Nakanishi N, Kasahara Y, Nagai T, Murase T, Osuka S, Goto M, Iwase A, Kikkawa F. Molecular mechanism of FSHR expression induced by BMP15 in human granulosa cells. J. Assist. Reprod. Genet. 2019;36(6):1185–1194. doi: 10.1007/s10815-019-01469-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Simoni M, Gromoll J, Nieschlag E. The follicle-stimulating hormone receptor:Biochemistry, molecular biology, physiology, and pathophysiology. Endocr. Rev. 1997;18(6):739–773. doi: 10.1210/edrv.18.6.0320. [DOI] [PubMed] [Google Scholar]
  • 29.Huang W, Cao Y, Shi L. Effects of FSHR polymorphisms on premature ovarian insufficiency in human beings:A meta-analysis. Reprod. Biol. Endocrinol. 2019;17(1):80. doi: 10.1186/s12958-019-0528-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Liu H, Xu X, Han T, Yan L, Cheng L, Qin Y, Liu W, Zhao S, Chen Z.J. A novel homozygous mutation in the FSHR gene is causative for primary ovarian insufficiency. Fertil. Steril. 2017;108(6):1050–1055.e2. doi: 10.1016/j.fertnstert.2017.09.010. [DOI] [PubMed] [Google Scholar]
  • 31.Lindgren I, Bååth M, Uvebrant K, Dejmek A, Kjaer L, Henic E, Bungum M, Bungum L, Cilio C, Leijonhufvud I, Skouby S, Andersen C.Y, Giwercman Y.L. Combined assessment of polymorphisms in the LHCGR and FSHR genes predict chance of pregnancy after in vitro fertilization. Hum. Reprod. 2016;31(3):672–683. doi: 10.1093/humrep/dev342. [DOI] [PubMed] [Google Scholar]
  • 32.Cory A.T, Price C.A, Lefebvre R, Palin M.F. Identification of single-nucleotide polymorphisms in the bovine follicle-stimulating hormone receptor and effects of genotypes on superovulatory response traits. Anim. Genet. 2013;44(2):197–201. doi: 10.1111/j.1365-2052.2012.02380.x. [DOI] [PubMed] [Google Scholar]
  • 33.Hirayama H, Naito A, Fujii T, Sugimoto M, Takedomi T, Moriyasu S, Sakai H, Kageyama S. Effects of genetic background on responses to superovulation in Japanese Black cattle. J. Vet. Med. Sci. 2019;81(3):373–378. doi: 10.1292/jvms.18-0537. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Snider A.P, Yake H.K, Granger C.D, Rosasco S.L, McDaneld T.G, Snelling W.M, Chase C.C, Jr, Miles J.R, Lents C.A, Quail L.K, Rich J.J.J, Epperson K.M, Crouse M.S, Summers A.F, Perry G.A, Bennett G.L, Cushman R.A. Polymorphism of the follicle-stimulating hormone receptor does not impact reproductive performance or in-vitro embryo production in beef heifers. Theriogenology. 2023;195:131–137. doi: 10.1016/j.theriogenology.2022.10.025. [DOI] [PubMed] [Google Scholar]
  • 35.Adinata Y, Affandhy L. Intervensi Model Perbibitan Sapi Jabres Untuk Peningkatan Sosial Ekonomi Pedesaan. In:Prosiding Seminar Nasional Sumber Daya Genetik. IAARD Press, Jakarta, Indonesia. 2017:204–227. [Google Scholar]
  • 36.Abeygunawardana D.I, Ranasinghe R.M.S, De Silva S.N.T, Deshapriya R.M.C, Gamika P.A, Rajapakse J. Effect of LHCGR and FSHR gene polymorphisms on fertility traits and milk yield of cross-bred dairy cows in Sri Lanka. Anim. Biotechnol. 2022;17:1–8. doi: 10.1080/10495398.2022.2044346. [DOI] [PubMed] [Google Scholar]
  • 37.Utomo B, Putranto E.D, Fadholly A. Profile of follicle-stimulating hormone and polymorphism of follicle-stimulating hormone receptor in Madrasin cattle with ovarian hypofunction. Vet. World. 2020;13(5):879–883. doi: 10.14202/vetworld.2020.879-883. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Gaviria S.M, Herrera A.L, Zuluaga J.J.E. Association between FSHR polymorphism with productive and reproductive traits in Antioquia Holstein cattle. Rev. Fac. Nac. Agron. 2016;69(1):7793–7801. [Google Scholar]
  • 39.Mazerbourg S, Bondy C, Zhou J, Monget P. The insulin-like growth factor system:A key determinant role in the growth and selection of ovarian follicles?A comparative species study. Reprod. Domest. Anim. 2003;38(4):247–258. doi: 10.1046/j.1439-0531.2003.00440.x. [DOI] [PubMed] [Google Scholar]
  • 40.Ipsa E, Cruzat V.F, Kagize J.N, Yovich J.L, Keane K.N. Growth hormone and insulin-like growth factor action in reproductive tissues. Front. Endocrinol. (Lausanne) 2019;10:777. doi: 10.3389/fendo.2019.00777. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Brůcková L, Soukup T, Moos J, Moosová M, Pavelková J, Rezábek K, Vísek B, Mokrý J. The cultivation of human granulosa cells. Acta Medica (Hradec Kralove) 2008;51(3):165–172. doi: 10.14712/18059694.2017.19. [DOI] [PubMed] [Google Scholar]
  • 42.Leyva-Corona J.C, Reyna-Granados J.R, Zamorano-Algandar R, Sanchez-Castro M.A, Thomas M.G, Enns R.M, Speidel S.E, Medrano J.F, Rincon G, Luna-Nevarez P. Polymorphisms within the prolactin and growth hormone/insulin-like growth factor-1 functional pathways associated with fertility traits in Holstein cows raised in a hot-humid climate. Trop. Anim. Health Prod. 2018;50(8):1913–1920. doi: 10.1007/s11250-018-1645-0. [DOI] [PubMed] [Google Scholar]
  • 43.Anggraeni A, Talib C, Asmarasari S.A, Herawati T, Andreas E. Genetic polymorphisms of IGF1, GH, and OPN genes in crosses Peranakan Ongole cattle based on birth type in Central Java. J. Illmu. Ternak Vet. 2018;22(4):165. [Google Scholar]
  • 44.Hax L.T, Schneider A, Jacometo C.B, Mattei P, da Silva T.C, Farina G, Corrêa M.N. Association between polymorphisms in somatotropic axis genes and fertility of Holstein dairy cows. Theriogenology. 2016;88:67–72. doi: 10.1016/j.theriogenology.2016.03.044. [DOI] [PubMed] [Google Scholar]

Articles from Veterinary World are provided here courtesy of Veterinary World

RESOURCES