Abstract
Background
The contributive role of the microbiome in tumor progression has been reported in multiple studies, such as the Fusobacterium nucleatum (F. nucleatum) in breast cancer (BC). This study aimed to explore the role of F. nucleatum-derived small extracellular vesicles (Fn-EVs) in BC and preliminarily uncover the mechanism.
Methods
Ten normal and 20 cancerous breast tissues were harvested to investigate the gDNA expression of F. nucleatum and its relation with the clinical characteristics of BC patients. After isolating Fn-EVs by ultracentrifugation from F. nucleatum (ATCC 25,586), both MDA-MB-231 and MCF-7 cells were treated with PBS, Fn, or Fn-EVs, followed by being subjected to CCK-8, Edu staining, wound healing, and Transwell assays to detect their cell viability, proliferation, migration, and invasion. TLR4 expression in BC cells with diverse treatments was assessed by western blot. In vivo experiments were performed to verify its role in tumor growth and liver metastasis.
Results
The F. nucleatum gDNA levels of breast tissues in BC patients were significantly higher than those in normal subjects, and positively associated with tumor size and metastasis. Fn-EVs administration significantly enhanced the cell viability, proliferation, migration, and invasion of BC cells, while knocking down TLR4 in BC cells could block these effects. Furthermore, in vivo study verified the contributive role of Fn-EVs in tumor growth and metastasis of BC, which might rely on its regulation of TLR4.
Conclusions
Collectively, our results suggest that F. nucleatum plays an important role in BC tumor growth and metastasis by regulating TLR4 through Fn-EVs. Thus, a better understanding of this process may aid in the development of novel therapeutic agents.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12885-023-10844-z.
Keywords: Fusobacterium nucleatum, Extracellular vesicles, Breast cancer, TLR4
Background
As the most commonly diagnosed cancer worldwide, breast cancer (BC) in China is accounting for 18% of the global BC cases in 2020, with approximately 0.42 million new cases [1]. However, the etiology of BC remains not completely uncovered and causal pathways are still hard to delineate. Due to increased body weight and continued decline in the fertility rate, the incidence rate of BC is increasing globally per year by an estimated 0.5% [2]. As reported, BC new cases number increased from 0.3 million in 2015 to 0.42 million in 2020 in China [1]. It is estimated that 3.2 million new cases of female BC by the year 2050 [3]. These alarming data manifest the urgent need for accurate and efficient screening and management of BC, and further advancing our knowledge of all possible factors contributing to the occurrence and progression of BC.
In the past few decades, the microbiota is considered essential for our physiology to function properly, mainly due to their production of metabolites [4]. There is a perfect balance between the microbiome and our body in a healthy state, which is known as symbiosis. When this symbiosis relationship is disrupted, microbial imbalances develop, which may lead to the development of multiple malignancies [5], including colorectal [6], lung [7], and stomach [8] cancers. Actually, accumulating studies indicated that the microbiome plays a role in more than 18% of malignancies and therapeutic resistance [9]. Previous studies have revealed that an overabundance of Escherichia coli could be observed in CRC tumorous biopsies in stage I to IV patients [10], while Fusobacterium nucleatum (F. nucleatum) was only observed in stage IV cancers [11]. Besides, the infection of both Helicobacter pylori [12] and Mycobacterium tuberculosis [13] have been implicated in the occurrence and progression of lung cancer.
For BC, multiple reports have provided evidence that breast tissue has its unique microbiome, which reflects its involvement in BC occurrence and progression [14]. Research by Hieken et al. uncovered the significantly different microbiota composition in the breast tissue between women with benign and malignant tumors [15]. Several microorganisms have been identified as the “tumor promoter” in BC. For instance, the tumoral overabundance of Staphylococcus and Brevundimonas has been found in primary breast tumors from patients with distant metastasis, which suggested that these microorganisms might be involved in the modulation of BC metastasis [16]. F. nucleatum has been considered the risk factor for various malignancies [17], including BC. A recent study demonstrated that F. nucleatum is capable of facilitating tumor growth and metastasis of BC, which could be a promising target for BC treatment [18]. However, its carcinogenesis mechanisms in BC have yet to be fully explored.
It’s widely accepted that the continuous growing, spreading, and metastasis of tumor cells depend on intercellular communication within cells, which could be mediated by the secretion of small extracellular vesicles (EVs) within a microenvironment [19]. EVs are nanosized membrane-encapsulated cell fragments shed from different domains of life, including bacteria, which have been proven to regulate diverse biological processes [20, 21]. As mentioned earlier, bacterial EVs involve interactions between bacteria and host cells [22]. For example, Akkermansia muciniphila-derived EVs suppress the production of IL-6 during colitis [23]. The administration of bacterial EVs derived from S. enterica, S. aureus, and L. acidophilus lead to the activation of anti-tumor immune responses and up-regulation of tumor-suppressor genes in tumor tissues [24]. Given that EVs produced by diverse cells or microorganisms have been reported to participate in the development of different types of tumors [25, 26], we wondered whether F. nucleatum-derived EVs (Fn-EVs) could facilitate the malignant behaviors of BC. Hence, the present study aimed to explore the role of Fn-EVs in BC and preliminarily uncover the mechanism.
Methods
Clinical samples collection
The study protocols were approved by the Ethics Committees of Huazhong University of Science and Technology Union Shenzhen Hospital and the Affiliated Shenzhen Sixth Hospital of Shenzhen University and performed in line with the provisions of the Helsinki Declaration of 1975. After being obtained written informed consent from the patients according to institutional guidelines, a total of 30 fresh breast tissues from 20 patients with BC and 10 patients with hyperplasia of the mammary glands were harvested during breast surgery. None of the subjects had received probiotic or antibiotic administration for at least three months before the sample collection.
F. nucleatum detection
To assess the amounts of F. nucleatum, gDNA extracted from breast tissues of patients with BC or hyperplasia of the mammary glands was subjected to qPCR to test the Bacterial 16 S rRNA genes by using PGT as a reference gene [27]. The primers sequences used to detect F. nucleatum and PGT were listed as followed: forward F. nucleatum, CAACCATTACTTTAACTCTACCATGTTCA, reverse F. nucleatum, GTTGACTTTACAGAAGGAGATTATGTAAAAATC; forward PGT, ATCCCCAAAGCACCTGGTTT, reverse PGT, AGAGGCCAAGATAGTCCTGGTAA. F. nucleatum abundance in tumor versus normal breast tissue was calculated based on the 2−ΔΔCt method [28]. Reaction conditions of amplification and detection were referred to in a previous study described by Castellarin, Warren, Freeman, Dreolini, Krzywinski, Strauss, Barnes, Watson, Allen-Vercoe, Moore and Holt [27].
F. nucleatum culture and conditioned media collection
F. nucleatum strain ATCC 25,586 was grown in BD™ Columbia agar containing defibrinated sheep blood (5%) and cultured in an anaerobic chamber at 37 °C.
F. nucleatum conditioned media were collected once in two days, followed by sterile filtration using a 0.22-µm syringe filter. The filtered media was stored at -80 °C before EVs isolation.
EVs isolation and characterization
EVs isolation was performed as an ultracentrifugation protocol reported in a recent study [29]. In brief, to obtain the F. nucleatum-derived EVs (Fn-EVs), the collected F. nucleatum-conditioned media were ultracentrifuged at 200,000× g for 60 min. Next, the obtained pellets were subjected to resuspension with PBS and filtered by a 0.22-µm syringe filter to finally obtain pure Fn-EVs.
The characterization of Fn-EVs, which included their morphology, number, size distribution, and protein concentration was performed using a transmission electron microscope (TEM), nanoparticle tracking analysis (NTA) with Nano-ZS 90 dynamic light scattering, and bicinchoninic acid (BCA) assay.
Cell culture and treatment
Two BC cell lines (MDA-MB-231 and MCF-7) supplied by ATCC were grown in DMEM media with 10% FBS at 37 °C. To investigate the effect of Fn-EVs on BC cells, cells were divided into three groups: control, Fn, and Fn-EVs groups. After cell confluence reached approximately 85%, cells were given diverse treatments according to different groups (control: PBS; Fn: F. nucleatum suspension (1⋅109 CFU/mL); Fn-EVs: 10 µg Fn-EVs.) and further incubated for a certain time.
CCK-8
The cell viability was detected by CCK-8 assay. In brief, after BC cell incubating with diverse treatments for 24, 48, and 72 h, cells seeded in 96-well plates were added with 10% CCK-8 reagent (Dojindo) and cultivated for another 2 h, followed by being subjected to detecting the optical density (OD) of each well at 450 nm with a microplate reader (Bio-Rad, Hercules, CA, USA).
Edu staining
According to protocols provided by the manufacturer, EdU Staining Proliferation Kit was utilized to assess the proliferation of cells after finishing different treatments. By using a BX51 microscope, images were obtained to observe and calculate EdU-positive cells.
Wound healing
To evaluate the cell migration, a density of 2 × 105 cells/well was seeded into six-well plates. The 200-µL pipette tip was utilized to create a similar size of scratches after a monolayer of cells had formed. Then, scratched cells were removed by three gentle rinses of PBS; the remaining cells were given diverse treatments and cultured in DMEM without FBS for 24 h. A BX51 microscope was utilized to photograph the same position of scratches at 0 and 24 h after scratching.
Transwell
The invasive ability of BC cells was also evaluated by using Transwell chambers pre-coated with Matrigel. Briefly, BC cells were seeded into the upper chambers containing 200 µL DMEM with or without F. nucleatum or Fn-EVs. Simultaneously, 700 µL DMEM with serum was added to the lower chamber. After 24 h cultivation, cells still in the upper chamber were removed, while cells traversing the membranes to the lower chamber were fixed in 4% PFA and stained with 0.1% crystal violet for 15 min. Under a BX51 microscope, the stained cells were photographed and counted in six random visual fields.
Western blot
BC cells from different groups were lysed with RIPA Buffer on ice to obtain the total protein. After determining the concentration of total protein by the BCA method, the quantitated protein was separated on SDS-PAGE gels and subsequently transferred onto PVDF membranes. Membranes were blocked with skimmed milk, followed by incubation with anti-TLR4 or anti-GAPDH antibodies. Next, the membranes were rinsed thrice with TBST prior to incubation with the secondary antibody. Finally, by using an ECL kit, the protein bands were visualized, of which intensities were measured by Image J. The antibodies information was presented in Supplementary Table S1.
RT-qPCR
By using Rneasy reagents (Qiagen), total RNA was prepared from tissues or cells. After the quantification and integrity analysis of total RNA, 1 µg total RNA was subjected to reverse transcription using a Reverse Transcription System Kit (Promega) to obtain cDNA. Using an SYBR Premix EX Taq™ II kit (Takara), qRT-PCR was carried out on a Bio-Rad system to detect the expression of TLR4. The relative expression of TLR4 was calculated with GAPDH as the internal control based on the 2−ΔΔCT method [28]. Primer sequences were presented in Supplementary Table S2.
Cell transfection
Short hairpin (sh) RNA against TLR4 (sh-TLR4#1, sh-TLR4#2, and sh-TLR4#3:) and the scrambled negative control (sh-NC) were purchased from Genepharma (China). The shRNA sequences were presented in Supplementary Table S2. When cell confluency was about 60%, MDA-MB-231 cells were transfected with sh-TLR4#1/2/3 or sh-NC for 48 h using Lipofectamine 2000 (Invitrogen). After transfection finished, cells were harvested and transfection efficiency was analyzed.
Animal experiments
All procedures regarding animals in this study were approved by the Institutional Animal Care and Use Committee of Huazhong University of Science and Technology Union Shenzhen Hospital and the Affiliated Shenzhen Sixth Hospital of Shenzhen University. All methods were carried out in accordance with relevant guidelines and regulations and ARRIVE guidelines (https://arriveguidelines.org) for the reporting of animal experiments. Before the beginning of in vivo study, thirty-six BALB/c nude mice (female, 6–8 weeks, 18-22 g) purchased from Guangdong medical laboratory animal center were subjected to one-week acclimation. MDA-MB-231 cells were stably transfected with either sh-NC or sh-TLR4 lentivirus before being subcutaneously injected into nude mice.
In brief, mice were randomly divided into three groups (n = 6/group): LV-sh-NC + PBS, LV-sh-NC + Fn-EVs, and LV-sh-TLR4 + Fn-EVs groups. On day one, 1 × 106 sh-NC transfected MDA-MB-231 cells (the former two groups) or TLR4-silencing MDA-MB-231 cells were subcutaneously injected into the inguinal mammary fat pads of mice. One week later, mice were given intratumorally PBS or Fn-EVs (100 µg/mL) for two weeks. Tumor formation was monitored beginning at day 7 every three days, and the growth curve of tumors (volume = (L × W2)/2, where W represents the width, and L represents the length) was plotted. One day 28, mice were sacrificed by cervical dislocation, and tumors were therefore harvested and weighed.
For the study of BC metastasis to the liver, the groups defined as above-mentioned, MDA-MB-231 cells were injected into the portal vein of the liver of mice on day one. One week later, mice were given PBS or Fn-EVs (100 µg) via the tail vein for two weeks. After finishing the treatment (day 28), liver tissues were dissected and subjected to H&E staining to investigate liver metastasis.
Statistics
Pearson’s chi-squared test was applied to analyze the associations between F. nucleatum abundance and patient clinical characteristics. Data were represented as the mean ± SD and analyzed using the student t-test or one-way analysis of variance followed by Tukey’s post hoc test on GraphPad Prism software. P < 0.05 means that the difference is significant.
Results
F. nucleatum was overabundant in BC
Initially, our study observed whether F. nucleatum occurred in BC, and if so, whether its presence correlates with the clinical characteristics of BC patients. Compared with normal breast tissues, F. nucleatum was overabundant in BC tissues (Fig. 1A and B). However, there was no significant difference in the F. nucleatum levels of different subtypes of BC patients (Fig. 1C). More importantly, our results showed that F. nucleatum gDNA expression levels were significantly correlated with both tumor size (P = 0.0029322) and metastasis (P = 0.0403909) (Table 1), which let us suppose that F. nucleatum maybe contribute to the tumor growth and metastasis in BC.
Fig. 1.
F. nucleatum is overabundant in BC. A. The Northern blot of F. nucleatum in normal (n = 8) and cancerous (n = 12) breast tissues B. The expression levels of F. nucleatum in normal (n = 10) and cancerous (n = 20) breast tissues were detected by RT-qPCR. C. The expression levels of F. nucleatum in cancerous breast tissues from luminal A (n = 5), luminal B (n = 5), HER2-positive (n = 5), and triple-negative (n = 5) BC patients. Data were analyzed using the student t-test or one-way analysis of variance followed by Tukey’s post hoc test; **p < 0.01
Table 1.
Association between F. nucleatum gDNA expression and clinical characteristics
| All patients | F. nucleatum gDNA level | p-value* | ||
|---|---|---|---|---|
| Low expression | High expression | |||
| Total number | 20 | 8 | 12 | |
| Age (years) | 0.8521789 | |||
| < 60 | 12 | 5 | 7 | |
| ≥ 60 | 8 | 3 | 5 | |
| Median (range) | 57 (37–77) | |||
| Tumor size (cm3) | 0.0029322 | |||
| < 5 | 14 | 7 | 7 | |
| ≥ 5 | 6 | 1 | 5 | |
| Pathological grade | 0.2918405 | |||
| I–II | 15 | 5 | 10 | |
| III-IV | 5 | 3 | 2 | |
| Metastasis | 0.0403909 | |||
| Yes | 8 | 1 | 7 | |
| No | 12 | 7 | 5 | |
Fn-EVs enhanced BC cell proliferation, migration, and invasion
To study the role of Fn-EVs in the malignant phenotypes of BC, Fn-EVs were isolated from the culture supernatants of F. nucleatum (ATCC 25,586) via a centrifugal ultrafiltration-based method. TEM was exploited to observe the morphology of the isolated Fn-EVs, which showed Fn-EVs with a round or oval membrane (Fig. 2A). Additionally, NTA revealed that the diameter of the Fn-EVs ranged from 20 to 190 nm of which peak diameters were approximately 100 nm (Fig. B). These results collectively suggested the successful isolation of Fn-EVs.
Fig. 2.
F. nucleatum -derived EVs enhanced BC cell viability and proliferation A. Morphology of the isolated F. nucleatum-derived EVs was observed under TEM. (Scalebar, 100 nm) B. Size distribution of Fn-EVs was analyzed by NTA. MDA-MB-231 and MCF-7cells were treated with PBS, F. nucleatum, or Fn-EVs (n = 3 per group) C. The cell viability was detected by CCK-8 after diverse treatments for 24, 48, and 72 h D. The cell proliferation was detected by Edu staining after 24 h (Scalebar, 100 μm). Data were analyzed using the one-way analysis of variance followed by Tukey’s post hoc test; **p < 0.01, ***p < 0.001
Next, two BC cell lines (MDA-MB-231 and MCF-7) were respectively incubated with F. nucleatum (defined as the Fn group) and Fn-EVs to investigate how EVs released by F. nucleatum influence various cancer hallmarks of recipient cells. After diverse treatments for 24, 48, and 72 h, the cell viability of both the Fn and Fn-EVs groups was significantly higher than that of the control group (cells treated with PBS) (Fig. 2C). Edu staining revealed that exposing BC cells to F. nucleatum or Fn-EVs led to a significant increase in their proliferative ability (Fig. 2D). Besides, both the migration and invasion of BC cells were also markedly increased after the administration of F. nucleatum or Fn-EVs (Fig. 3A and B). The effects of Fn-EVs on BC cell migration and invasion were slightly stronger than those of F. nucleatum, but there was no significance (Fig. 3A and B). Collectively, Fn-EVs could strengthen the malignant behaviors of BC cells, which included proliferation, migration, and invasion.
Fig. 3.
F. nucleatum-derived EVs facilitated the migration and invasion of BC cells. MDA-MB-231 and MCF-7cells were treated with PBS, F. nucleatum, or Fn-EVs for 24 h (n = 3 per group) A. The cell migration was detected by wound healing assay (Scalebar, 100 μm) B. The cell invasion was observed by Transwell assay (Scalebar, 100 μm). Data were analyzed using the one-way analysis of variance followed by Tukey’s post hoc test; **p < 0.01, ***p < 0.001
Fn-EVs contribute to BC cell proliferation, migration, and invasion via activation of TLR4
Given that F. nucleatum has been reported to promote tumorigenesis through TLR4 signaling, we wonder whether Fn-EVs facilitate the malignant phenotypes of BC cells via TLR4 as well. As expected, the treatment of both F. nucleatum and Fn-EVs could increase TLR4 protein expression of BC cells (Fig. 4A). Notably, Fn-EVs caused an obvious elevation in TLR4 levels. To verify whether the effects of Fn-EVs on BC cells rely on TLR4 activation, we further explore the role of Fn-EVs in MDA-MB-231 cells after knocking down TLR4. RT-qPCR and western blot confirmed that the transfections of sh-TLR4#1, #2, and #3, all could effectively silence TLR4 expression in MDA-MB-231 cells, while sh-TLR4#2 exhibited the strongest efficacy (Fig. 4B). Hence, sh-TLR4#2 was chosen for the following experiments. Our results showed that Fn-EVs-induced promotion in the proliferation, migration, and invasion of MDA-MB-231 cells was abolished by the transfection of sh-TLR4 (Fig. 4C-F). Thus, the promotive effects of Fn-EVs on the proliferation, migration, and invasion of BC cells may be attributed to the activation of the TLR4 pathway by Fn-EVs.
Fig. 4.
F. nucleatum-derived EVs contribute to BC cell proliferation, migration, and invasion via activation of TLR4 A. The expression of TLR4 protein in BC cells with different treatments was examined by western blot (n = 3 per group) B. The transfection efficiency of sh-TLR4#1, #2, and #3 was determined by (top) RT-qPCR and (bottom) western blot (n = 3 per group). MDA-MB-231 cells were treated with PBS, Fn-EVs, or sh-TLR4 transfection combined with Fn-EVs (n = 3 per group) C. The cell viability was detected by CCK-8 after diverse treatments for 24, 48, and 72 h D. The cell proliferation was detected by Edu staining after 24 h (Scalebar, 100 μm) E. The cell migration was detected by wound healing assay after 24 h (Scalebar, 100 μm) F. The cell invasion was observed by Transwell assay after 24 h (Scalebar, 100 μm). Data were analyzed using the one-way analysis of variance followed by Tukey’s post hoc test; *p < 0.05, **p < 0.01, ***p < 0.001
Fn-EVs enhanced tumor growth and metastasis via activation of TLR4 in BC
Finally, BALB/c nude mice xenograft model was established to support the in vitro studies. The animal experimental design was described as Fig. 5A. The tumor growth curve showed that the tumor growth of nude mice treated with Fn-EVs was significantly faster than those treated with PBS (Fig. 5B). The tumor images and tumor weight on day 28 further indicated that Fn-EVs exerted a significant promotion effect on the growth of subcutaneous tumors (Fig. 5C and D). Next, MDA-MB-231 cell suspension was injected into the portal vein of the liver of mice to evaluate the function of Fn-EVs on BC liver metastasis. H&E staining results showed that liver sections in the Fn-Ex group exhibit the highest number and largest area of cancerous nests in the lung (Fig. 5E). To confirm that Fn-EVs promotes BC progression through TLR4, the xenograft model established by TLR4-silencing MDA-MB-231 cells inoculation. Notably, Fn-EVs-enhanced tumor growth and liver metastasis were rescued by TLR4 silence (Fig. 5B-E). Collectively, coincident with the results of in vitro experiments, Fn-EVs significantly facilitate tumor growth and metastasis through the TLR4 pathway in BC.
Fig. 5.
F. nucleatum-derived EVs enhanced tumor growth and liver metastasis via activation of TLR4 in BC A. Experimental design of in vivo study
BALB/c nude mice were randomly divided into three groups (n = 6/group): LV-sh-NC + PBS, LV-sh-NC + Fn-EVs, and LV-sh-TLR4 + Fn-EVs groups. One-week later cell inoculation, mice were given intratumorally or intravenously PBS or Fn-EVs (100 µg/mL) for two weeks B. Tumor growth curve C. The tumor harvested from each group on day 28 D. Weight of the harvested tumor E. H&E staining for the liver tissues from the metastatic murine model (Scalebar, 100 μm). Data were analyzed using the one-way analysis of variance followed by Tukey’s post hoc test; ***p < 0.001
Discussion
As a community of microorganisms, the microbiota exhibits homeostatic properties and can modulate immunity [30], which is found in all multicellular organisms, including humans. In the past few decades, the importance of microbiota in human health and disease, such as cancer, has been increasingly emphasized as its involvement in regulating physiological processes [31]. A growing number of studies revealed that an elevated or reduced risk of certain cancers is attributed to colonization with various micro-organisms [18, 32]. Hence, identifying the specific oncogenic micro-organisms involved and the mechanism of their effect could be beneficial in the management of the onset and development of tumors. A recent study demonstrated that different tumor types, such as glioma, pancreatic cancer, and BC, have distinct microbial compositions [33]. Notably, among multiple cancers, a particularly rich and diverse microbiome has been observed in BC [33]. Wilkie et al. revealed that BC commensal microbiota is distinctly composed of Gram-negative bacteria and highlighted the role of bacterial components in BC development [34]. As one of the recently identified BC-related microbes, F. nucleatum has gained the most attention. The responsibility of F. nucleatum in BC development and metastatic progression was identified [18]. Besides, it has been reported that F. nucleatum might accelerate cell growth and treatment resistance in BC by activating autophagy and immune evasion by suppressing the immune system [35]. Consistent with the previous publication, our research showed that the F. nucleatum is overabundant in BC tissues. The high F. nucleatum levels were positively correlated with the tumor size and whether the metastasis occurred, suggesting that F. nucleatum maybe contribute to the worse clinical outcomes.
To date, multiple research projects have supported the causal role of EVs in cancer progression [36]. However, almost all of these reports have focused on the EVs isolated from various types of cells, but few have focused on the bacterial EVs. In recent years, EVs derived from bacteria have been proven to play important roles in bacteria–host interactions during disease progression [37]. In the present study, our study reveals that F. nucleatum-derived EVs play a newly identified role in promoting tumor development. For the in vitro experiments on two BC cell lines, we found that F. nucleatum-derived EVs exhibited a similar effect to F. nucleatum on BC cell viability and proliferation, revealing the promotion effect of F. nucleatum-derived EVs on tumor growth in BC, which was corroborated by the further in vivo study. Metastasis leads to more than 90% of cancer-associated mortality in general, and is mainly responsible for the death of BC. The 5-year survival rate of patients with localized BC is almost 98%, while that of patients with metastatic BC drops to 26% [38]. Interestingly, the analyses of cell migration and invasion also exhibited a similar tendency to those of cell proliferation. In addition, the analysis of a murine model of liver metastasis indicated a potent function of F. nucleatum-derived EVs on BC liver metastasis.
Several groups have previously characterized mechanisms underlying the promotive effect of F. nucleatum in colorectal cancer (CRC) progression [39]. The function of F. nucleatum on the chemoresistance of CRC is associated with its modulation of autophagy [40]. Another study reported that F. nucleatum suppresses adaptive immunity mediated by antitumor T-cells in CRC by regulating the expression of microRNA [41]. More importantly, increasing studies demonstrated that F. nucleatum contributes to the change of tumor microenvironment and the progression of CRC via a TLR4-dependent mechanism [11, 42, 43]. Significance regarding TLR4 activation in BC progression has been reported in a large number of studies [44, 45]. For example, a previous study demonstrated that pharmacologic TLR4 inhibition could suppress the tumor growth of TP53 mutant BC [46]. Hence, we speculated that F. nucleatum and its derived EVs might facilitate BC progression through similar mechanisms. Our data indicated that both F. nucleatum and F. nucleatum-derived EVs resulted in a significant increase in the TLR4 expression, while F. nucleatum-derived EVs exerted a stronger effect. Importantly, in vitro and in vivo studies collectively confirmed that F. nucleatum-derived EVs contribute to tumor growth and liver metastasis in BC through a TLR4-dependent mechanism since the knocking down of TLR4 in BC cells effectively counteracted the effect of F. nucleatum-derived EVs. In summary, the current study first revealed the role of F. nucleatum-derived EVs in BC progression and demonstrated the mechanism is related to TLR4 activation.
However, there are several limitations in the present study. First, the main gap is whether Fn-EVs can induce normal breast cells to become malignant remains unclear, and the normal breast cell lines would be used to validate our findings in subsequent experiments. In addition, the mechanism exploration in this study is rudimentary, how TLR4 was activated by F. nucleatum-derived EVs should also be further researched. Lastly, the lack of an orthotopic tumor model for in vivo experiments minimizes the reliability of our findings; therefore, the role and the specific mechanism of F. nucleatum-derived EVs in BC growth and metastasis should be further verified in an orthotopic tumor model in the future.
Conclusions
In conclusion, our present study authenticated that the F. nucleatum-derived EVs manifested a promotive function on tumor growth and metastasis of BC, which might be associated with its role in TLR4 activation. This finding provides a novel insight into the role of bacterial EVs in cancer development and some scientific information on the interaction between microbiome and tumor.
Electronic supplementary material
Below is the link to the electronic supplementary material.
Acknowledgements
None.
List of Abbreviations
- F. Nucleatum
Fusobacterium nucleatum
- BC
Breast cancer
- CRC
Colorectal cancer
- Fn-EVs
Fusobacterium nucleatum-derived small extracellular vesicles
- NTA
Nanoparticle tracking analysis
- OD
Optical density
- TEM
Transmission electron microscope
- TLR4
Toll-like receptor 4
Author Contribution
GQL, YS, HG and DXL conceived the study and designed the experiments. YS and YH contributed to the data collection. JL and SYW performed the data analysis and interpreted the results. GQL and YS wrote the manuscript. HG and DXL contributed to the critical revision of article. All authors read and approved the final manuscript.
Funding
This work was supported by the Natural Science Foundation of Guangdong Province (No. 2020A1515011303) and Shenzhen Nanshan Science and Technology Research Funds (No. NS2022018).
Data Availability
The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.
Declarations
Ethics approval and consent to participate
The study protocols were approved by the Ethics Committees of Huazhong University of Science and Technology Union Shenzhen Hospital and the Affiliated Shenzhen Sixth Hospital of Shenzhen University and performed in line with the provisions of the Helsinki Declaration of 1975. Written informed consent was obtained from the patients. All procedures regarding animals in this study were approved by the Institutional Animal Care and Use Committee of Huazhong University of Science and Technology Union Shenzhen Hospital and the Affiliated Shenzhen Sixth Hospital of Shenzhen University. All methods were carried out in accordance with relevant guidelines and regulations and ARRIVE guidelines (https://arriveguidelines.org) for the reporting of animal experiments.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Guiqiu Li and Yan Sun contributed equally to this work and should be considered as equal first coauthors.
Contributor Information
Guiqiu Li, Email: lgq7566@126.com.
Yan Sun, Email: sunyanshenzhen@126.com.
Yu Huang, Email: 294546829@qq.com.
Jie Lian, Email: Lianjie_pp@163.com.
Shaoyuan Wu, Email: 630955751@qq.com.
Dixian Luo, Email: luodixian_2@163.com.
Hui Gong, Email: gonghui2008ok@163.com.
References
- 1.Cao W, Chen HD, Yu YW, Li N, Chen WQ. Changing profiles of cancer burden worldwide and in China: a secondary analysis of the global cancer statistics 2020. Chin Med J (Engl) 2021;134:783–91. doi: 10.1097/CM9.0000000000001474. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global Cancer Statistics 2020: GLOBOCAN estimates of incidence and Mortality Worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021;71:209–49. doi: 10.3322/caac.21660. [DOI] [PubMed] [Google Scholar]
- 3.Tao Z, Shi A, Lu C, Song T, Zhang Z, Zhao J. Breast Cancer: epidemiology and etiology. Cell Biochem Biophys. 2015;72:333–8. doi: 10.1007/s12013-014-0459-6. [DOI] [PubMed] [Google Scholar]
- 4.Turnbaugh PJ, Ley RE, Hamady M, Fraser-Liggett CM, Knight R, Gordon JI. The human microbiome project. Nature. 2007;449:804–10. doi: 10.1038/nature06244. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Toumazi D, Constantinou C. A fragile balance: the important role of the intestinal microbiota in the Prevention and Management of Colorectal Cancer. Oncology. 2020;98:593–602. doi: 10.1159/000507959. [DOI] [PubMed] [Google Scholar]
- 6.Flemer B, Lynch DB, Brown JM, Jeffery IB, Ryan FJ, Claesson MJ, et al. Tumour-associated and non-tumour-associated microbiota in colorectal cancer. Gut. 2017;66:633–43. doi: 10.1136/gutjnl-2015-309595. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Jin C, Lagoudas GK, Zhao C, Bullman S, Bhutkar A, Hu B, et al. Commensal microbiota promote Lung Cancer Development via γδ T cells. Cell. 2019;176:998–1013e16. doi: 10.1016/j.cell.2018.12.040. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Stewart OA, Wu F, Chen Y. The role of gastric microbiota in gastric cancer. Gut Microbes. 2020;11:1220–30. doi: 10.1080/19490976.2020.1762520. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Doocey CM, Finn K, Murphy C, Guinane CM. The impact of the human microbiome in tumorigenesis, cancer progression, and biotherapeutic development. BMC Microbiol. 2022;22:53. doi: 10.1186/s12866-022-02465-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Bonnet M, Buc E, Sauvanet P, Darcha C, Dubois D, Pereira B, et al. Colonization of the human gut by E. coli and colorectal cancer risk. Clin Cancer Res. 2014;20:859–67. doi: 10.1158/1078-0432.CCR-13-1343. [DOI] [PubMed] [Google Scholar]
- 11.Yang Y, Weng W, Peng J, Hong L, Yang L, Toiyama Y et al. Fusobacterium nucleatum Increases Proliferation of Colorectal Cancer Cells and Tumor Development in Mice by Activating Toll-Like Receptor 4 Signaling to Nuclear Factor-κB, and Up-regulating Expression of MicroRNA-21.Gastroenterology. 2017;152:851 – 66.e24. [DOI] [PMC free article] [PubMed]
- 12.Deng B, Li Y, Zhang Y, Bai L, Yang P. Helicobacter pylori infection and lung cancer: a review of an emerging hypothesis. Carcinogenesis. 2013;34:1189–95. doi: 10.1093/carcin/bgt114. [DOI] [PubMed] [Google Scholar]
- 13.Park SK, Cho LY, Yang JJ, Park B, Chang SH, Lee KS, et al. Lung cancer risk and cigarette smoking, lung tuberculosis according to histologic type and gender in a population based case-control study. Lung Cancer. 2010;68:20–6. doi: 10.1016/j.lungcan.2009.05.017. [DOI] [PubMed] [Google Scholar]
- 14.Fernández MF, Reina-Pérez I, Astorga JM, Rodríguez-Carrillo A, Plaza-Díaz J, Fontana L. Breast Cancer and its relationship with the Microbiota. Int J Environ Res Public Health. 2018;15:1747. doi: 10.3390/ijerph15081747. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Hieken TJ, Chen J, Hoskin TL, Walther-Antonio M, Johnson S, Ramaker S, et al. The Microbiome of aseptically collected human breast tissue in Benign and Malignant Disease. Sci Rep. 2016;6:30751. doi: 10.1038/srep30751. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Chiba A, Bawaneh A, Velazquez C, Clear KYJ, Wilson AS, Howard-McNatt M, et al. Neoadjuvant chemotherapy shifts breast tumor microbiota populations to Regulate Drug Responsiveness and the development of Metastasis. Mol Cancer Res. 2020;18:130–9. doi: 10.1158/1541-7786.MCR-19-0451. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Gholizadeh P, Eslami H, Kafil HS. Carcinogenesis mechanisms of Fusobacterium nucleatum. Biomed Pharmacother. 2017;89:918–25. doi: 10.1016/j.biopha.2017.02.102. [DOI] [PubMed] [Google Scholar]
- 18.Parhi L, Alon-Maimon T, Sol A, Nejman D, Shhadeh A, Fainsod-Levi T, et al. Breast cancer colonization by Fusobacterium nucleatum accelerates tumor growth and metastatic progression. Nat Commun. 2020;11:3259. doi: 10.1038/s41467-020-16967-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Rezaie J, Ahmadi M, Ravanbakhsh R, Mojarad B, Mahbubfam S, Shaban SA, et al. Tumor-derived extracellular vesicles: the metastatic organotropism drivers. Life Sci. 2022;289:120216. doi: 10.1016/j.lfs.2021.120216. [DOI] [PubMed] [Google Scholar]
- 20.Woith E, Fuhrmann G, Melzig MF. Extracellular vesicles-connecting kingdoms. Int J Mol Sci. 2019;20:5695. doi: 10.3390/ijms20225695. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Feghhi M, Rezaie J, Akbari A, Jabbari N, Jafari H, Seidi F, et al. Effect of multi-functional polyhydroxylated polyhedral oligomeric silsesquioxane (POSS) nanoparticles on the angiogenesis and exosome biogenesis in human umbilical vein endothelial cells (HUVECs) Mater Design. 2021;197:109227. doi: 10.1016/j.matdes.2020.109227. [DOI] [Google Scholar]
- 22.Tarashi S, Zamani MS, Omrani MD, Fateh A, Moshiri A, Saedisomeolia A, et al. Commensal and pathogenic bacterial-derived extracellular vesicles in host-bacterial and interbacterial dialogues: two sides of the same Coin. J Immunol Res. 2022;2022:8092170. doi: 10.1155/2022/8092170. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Kang CS, Ban M, Choi EJ, Moon HG, Jeon JS, Kim DK, et al. Extracellular vesicles derived from gut microbiota, especially Akkermansia muciniphila, protect the progression of dextran sulfate sodium-induced colitis. PLoS ONE. 2013;8:e76520. doi: 10.1371/journal.pone.0076520. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Kim OY, Dinh NT, Park HT, Choi SJ, Hong K, Gho YS. Bacterial protoplast-derived nanovesicles for tumor targeted delivery of chemotherapeutics. Biomaterials. 2017;113:68–79. doi: 10.1016/j.biomaterials.2016.10.037. [DOI] [PubMed] [Google Scholar]
- 25.Möller A, Lobb RJ. The evolving translational potential of small extracellular vesicles in cancer. Nat Rev Cancer. 2020;20:697–709. doi: 10.1038/s41568-020-00299-w. [DOI] [PubMed] [Google Scholar]
- 26.Fuentes P, Sesé M, Guijarro PJ, Emperador M, Sánchez-Redondo S, Peinado H, et al. ITGB3-mediated uptake of small extracellular vesicles facilitates intercellular communication in breast cancer cells. Nat Commun. 2020;11:4261. doi: 10.1038/s41467-020-18081-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Castellarin M, Warren RL, Freeman JD, Dreolini L, Krzywinski M, Strauss J, et al. Fusobacterium nucleatum infection is prevalent in human colorectal carcinoma. Genome Res. 2012;22:299–306. doi: 10.1101/gr.126516.111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25:402–8. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- 29.Lin LT, Shi YC, Choong CY, Tai CJ. The fruits of Paris polyphylla inhibit Colorectal Cancer Cell Migration Induced by Fusobacterium nucleatum-Derived Extracellular vesicles. Molecules. 2021;26:4081. doi: 10.3390/molecules26134081. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Belkaid Y, Hand TW. Role of the microbiota in immunity and inflammation. Cell. 2014;157:121–41. doi: 10.1016/j.cell.2014.03.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Sadrekarimi H, Gardanova ZR, Bakhshesh M, Ebrahimzadeh F, Yaseri AF, Thangavelu L, et al. Emerging role of human microbiome in cancer development and response to therapy: special focus on intestinal microflora. J Transl Med. 2022;20:301. doi: 10.1186/s12967-022-03492-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Sepich-Poore GD, Zitvogel L, Straussman R, Hasty J, Wargo JA, Knight R. The microbiome and human cancer. Science. 2021;371:eabc4552. doi: 10.1126/science.abc4552. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Nejman D, Livyatan I, Fuks G, Gavert N, Zwang Y, Geller LT, et al. The human tumor microbiome is composed of tumor type-specific intracellular bacteria. Science. 2020;368:973–80. doi: 10.1126/science.aay9189. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Wilkie T, Verma AK, Zhao H, Charan M, Ahirwar DK, Kant S, et al. Lipopolysaccharide from the commensal microbiota of the breast enhances cancer growth: role of S100A7 and TLR4. Mol Oncol. 2022;16:1508–22. doi: 10.1002/1878-0261.12975. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Van der Merwe M, Van Niekerk G, Botha A, Engelbrecht AM. The onco-immunological implications of Fusobacterium nucleatum in breast cancer. Immunol Lett. 2021;232:60–6. doi: 10.1016/j.imlet.2021.02.007. [DOI] [PubMed] [Google Scholar]
- 36.Han L, Lam EW, Sun Y. Extracellular vesicles in the tumor microenvironment: old stories, but new tales. Mol Cancer. 2019;18:59. doi: 10.1186/s12943-019-0980-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Xie J, Li Q, Haesebrouck F, Van Hoecke L, Vandenbroucke RE. The tremendous biomedical potential of bacterial extracellular vesicles. Trends Biotechnol. 2022;40:1173–94. doi: 10.1016/j.tibtech.2022.03.005. [DOI] [PubMed] [Google Scholar]
- 38.Siegel RL, Miller KD, Jemal A. Cancer statistics, 2016. CA Cancer J Clin. 2016;66:7–30. doi: 10.3322/caac.21332. [DOI] [PubMed] [Google Scholar]
- 39.Hashemi Goradel N, Heidarzadeh S, Jahangiri S, Farhood B, Mortezaee K, Khanlarkhani N, et al. Fusobacterium nucleatum and colorectal cancer: a mechanistic overview. J Cell Physiol. 2019;234:2337–44. doi: 10.1002/jcp.27250. [DOI] [PubMed] [Google Scholar]
- 40.Yu T, Guo F, Yu Y, Sun T, Ma D, Han J, et al. Fusobacterium nucleatum promotes Chemoresistance to Colorectal Cancer by modulating Autophagy. Cell. 2017;170:548–63e16. doi: 10.1016/j.cell.2017.07.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Nosho K, Sukawa Y, Adachi Y, Ito M, Mitsuhashi K, Kurihara H, et al. Association of Fusobacterium nucleatum with immunity and molecular alterations in colorectal cancer. World J Gastroenterol. 2016;22:557–66. doi: 10.3748/wjg.v22.i2.557. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Kong C, Yan X, Zhu Y, Zhu H, Luo Y, Liu P, et al. Fusobacterium Nucleatum promotes the development of Colorectal Cancer by activating a cytochrome P450/Epoxyoctadecenoic Acid Axis via TLR4/Keap1/NRF2 signaling. Cancer Res. 2021;81:4485–98. doi: 10.1158/0008-5472.CAN-21-0453. [DOI] [PubMed] [Google Scholar]
- 43.Hu L, Liu Y, Kong X, Wu R, Peng Q, Zhang Y, et al. Fusobacterium nucleatum facilitates M2 macrophage polarization and colorectal carcinoma progression by activating TLR4/NF-κB/S100A9 Cascade. Front Immunol. 2021;12:658681. doi: 10.3389/fimmu.2021.658681. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Rajput S, Volk-Draper LD, Ran S. TLR4 is a novel determinant of the response to paclitaxel in breast cancer. Mol Cancer Ther. 2013;12:1676–87. doi: 10.1158/1535-7163.MCT-12-1019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Lv W, Chen N, Lin Y, Ma H, Ruan Y, Li Z, et al. Macrophage migration inhibitory factor promotes breast cancer metastasis via activation of HMGB1/TLR4/NF kappa B axis. Cancer Lett. 2016;375:245–55. doi: 10.1016/j.canlet.2016.02.005. [DOI] [PubMed] [Google Scholar]
- 46.Haricharan S, Brown P. TLR4 has a TP53-dependent dual role in regulating breast cancer cell growth. Proc Natl Acad Sci U S A. 2015;112:E3216–25. doi: 10.1073/pnas.1420811112. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.





