Skip to main content
NCBI home page
Heliyon logoLink to Heliyon
. 2023 May 18;9(5):e16139. doi: 10.1016/j.heliyon.2023.e16139

Drosophila melanogaster Imd signaling interacts with insulin signaling and alters feeding rate upon parasitic nematode infection

Yaprak Ozakman a, Dhaivat Raval a, Ioannis Eleftherianos a,∗
PMCID: PMC10208921  PMID: 37251825

Abstract

Significant progress has been made in recent years on exploring immunometabolism, a field that integrates two processes essential for maintaining tissue and organismal homeostasis, immunity and metabolism. The nematode parasite Heterorhabditis gerrardi, its mutualistic bacteria Photorhabdus asymbiotica, and the fruit fly Drosophila melanogaster constitute a unique system to investigate the molecular basis of host immunometabolic response to nematode-bacterial complexes. In this study, we explored the contribution of the two major immune signaling pathways, Toll and Imd, to sugar metabolism in D. melanogaster larvae during infection with H. gerrardi nematodes. We infected Toll or Imd signaling loss-of-function mutant larvae with H. gerrardi nematodes and assessed larval survival ability, feeding rate, and sugar metabolism. We found no significant differences in the survival ability or levels of sugar metabolites in any of the mutant larvae when responding to H. gerrardi infection. However, we found that the Imd mutant larvae have higher feeding rate than controls during the early stages of infection. In addition, feeding rates are lower in Imd mutants relative to the control larvae as the infection progresses. We further showed that Dilp2 and Dilp3 gene expression increases in Imd mutants compared to controls early in the infection, but their expression levels decrease at later times. These findings indicate that Imd signaling activity regulates the feeding rate and Dilp2 and Dilp3 expression in D. melanogaster larvae infected with H. gerrardi. Results from this study facilitate our understanding of the link between host innate immunity and sugar metabolism in the context of infectious diseases caused by parasitic nematodes.

Keywords: Drosophila, Immunometabolism, Heterorhabditis, Photorhabdus, Insulin signaling

1. Introduction

In recent years, considerable amount of research has been devoted to exploring immunometabolism, a field at the interface of two distinct yet principal areas in organismal well-being, immunity and metabolism [1]. The sum of biochemical reactions in living organisms that either result in production or consumption of energy defines metabolism, which impacts all cellular functions and plays a fundamental role in biological processes. Host immune responses against harmful microorganisms play essential roles in the regulation of metabolic processes in vertebrates. In addition, the metabolic state of an organism is a critical determinant of a functional immune system [[1], [2], [3]].

The fruit fly Drosophila melanogaster has long been accepted as a suitable model host to study infection and innate immunity. Many significant advances in the field of innate immunity have been made through studies in D. melanogaster due to the remarkable evolutionary conservation of the immune signaling pathways between flies and vertebrates [4,5]. In particular, the two major immune signaling pathways in flies, the Toll and immune deficiency (Imd) share significant similarities with the mammalian Toll like receptors (TLR) and tumor necrosis factor receptor (TNF-R) signaling, respectively [[6], [7], [8]]. Induction of the Imd signaling (mainly by Gram-negative bacteria), and Toll signaling (mainly by Gram-positive bacteria and fungi), leads to the transcriptional activation of antimicrobial peptides (AMPs), which act to prevent the proliferation and dispersal of invading pathogens [[9], [10], [11]]. Infection of D. melanogaster with entomopathogenic nematodes (EPNs) is also associated with the transcriptional activation of AMPs. In particular, Heterorhabditis bacteriophora infection of D. melanogaster larvae induces the transcriptional activation of Attacin and Diptericin (Imd pathway) and Drosomycin and Metchnikowin (Toll pathway) [12]. In addition, excreted secreted products isolated from H. bacteriophora nematodes induce Diptericin expression in D. melanogaster larvae and adult flies [13].

In addition to its use in immunity research, D. melanogaster has started to emerge as a valuable experimental paradigm to dissect the molecular basis of host metabolic response during infection [[14], [15], [16], [17], [18]]. Recent work has shown that infection of D. melanogaster adult flies with Zika virus disrupts lipid homeostasis by inducing the accumulation of enlarged lipid droplets [16]. In addition, Listeria monocytogenes, Mycobacterium marinum or Photorhabdus luminescens infection results in loss of metabolic stores, such as glycogen in adult flies [[19], [20], [21]]. Infection with the entomopathogenic nematodes (EPNs) Steinernema carpocapsae, Heterorhabditis bacteriophora or H. gerrardi is also associated with metabolic shifts in D. melanogaster larvae [14,15,22]. More precisely, while S. carpocapsae infection leads to the formation of larger lipid droplets, H. gerrardi infection leads to the formation of smaller lipid droplets in larvae [15,23].

Although several studies have illustrated the metabolic changes that take place in D. melanogaster during infection with viral, bacterial pathogens or nematode parasites, whether and how immune signaling pathway activity interacts with the metabolic response upon infection has yet to be elucidated [[14], [15], [16],21,22]. To this end, we characterized the interactions between Toll and Imd signaling activity and sugar metabolism particularly against infection with parasitic nematodes. For this, we used D. melanogaster larvae loss-of-function mutations in the transcription factors of the Toll (Dif) or Imd (Relish) signaling pathways and infected the mutant larvae with H. gerrardi nematodes containing mutualistic Photorhabdus asymbiotica bacteria [24]. Following infection with the nematode-bacteria pairs, we assessed the changes in larval survival ability, feeding rate, and sugar levels, and also determined the transcript levels of genes involved in insulin signaling.

Our results reveal that Toll and Imd signaling activities are not required for the survival response of D. melanogaster larvae to H. gerrardi infection. We also show that Imd signaling activity is associated with reduced feeding rate in larvae following H. gerrardi infection. We further find no interaction between D. melanogaster Toll and Imd signaling activity and the accumulation of trehalose, glucose or glycogen in the context of H. gerrardi nematode infection. However, our results indicate an association between the Imd and insulin signaling in D. melanogaster larval anti-nematode response through changes in the transcript levels of Drosophila insulin-like peptides 2 (Dilp2) and (Dilp3). These results provide important insight into the interactions between host immunity and metabolism for fighting infections with parasitic nematodes and thus may lead to the identification of new strategies for treating infectious diseases.

2. Materials and methods

2.1. Fly and nematode stocks

All Drosophila melanogaster flies were raised on Drosophila medium (Lab Express) with a few granules (approximately 0.003 g) baker's yeast (Carolina Biological Supply, Burlington, NC, USA) at 25 °C, and a 12:12-h light:dark photoperiodic cycle. Fly lines Dif1 and Rele20 were obtained from Dr. Jean-Marc Reichhart's lab (National Center for Scientific Research, Strasbourg, France) [25]. Fly line w1118 (strain 3605, Bloomington, IL, USA) was used as background control for Rele20 and fly line cn bw (gifted from Dr. Louisa Wu's lab, University of Maryland, College Park, USA) was used as background control for Dif1. Late second to early third instar larvae were used in the experiments except for the feeding assay where late second instar larvae only were used. Production of Heterorhabditis gerrardi nematodes in the larvae of the wax moth Galleria mellonella was described previously [14,26]. All nematodes were used within one to five weeks after collection.

2.2. Larval infection

Microtiter 96-well plates were used to infect D. melanogaster larvae with H. gerrardi infective juveniles (IJs). Each plate was prepared by adding 100 μL of 1.25% agarose in each well. Nematode suspension of 10 μL containing 100 IJs was added to each well along with a single larva. Sterile distilled water of 10 μL served as the uninfected control. Wells were then sealed with a transparent film (USA Scientific, Ocala, FL, USA) and two holes were pierced for aeration. Plates were stored in the dark at 25 °C for 12 or 36 h before processing the larvae for further experiments. Each infection experiment was repeated three times with new batches of larvae and nematodes.

2.3. Survival response

To assess the survival response of D. melanogaster larvae to H. gerrardi infection, 24 larvae of each line were infected with nematodes or treated with sterile water as negative control. Survival was monitored at 12 h intervals and up to 72 h after infection. Larvae that failed to respond to stimulation with a pipette tip were scored as dead. Three independent survival experiments were performed.

2.4. Gene transcript level analysis

To quantify the expression levels of candidate genes, total RNA was extracted from four to seven D. melanogaster larvae using the TRIzol™ reagent according to the manufacturer's instructions. Reverse transcription was carried out using an Applied Biosystems High-Capacity cDNA Reverse Transcription Kit according to manufacturer's instructions. Quantitative RT-PCR (qRT-PCR) experiments were performed in a CFX96 Real-Time System, C1000 Thermal Cycler (Bio-Rad) as previously described [14]. The list of gene specific primers used in this study can be found in Table 1. The amount of mRNA in each sample was normalized to mRNA values of the housekeeping gene RpL32 and presented as a ratio of the value for infected larvae to that of the uninfected controls. Each experiment was run in technical triplicates and repeated three times.

Table 1.

Primers and their sequences used in quantitative RT-PCR experiments.

Gene Accession No Primer (5′-3′) Sequence Tm (oC)
RpL32 CG7939 Forward
Reverse		 GATGACCATCCGCCCAGCA
CGGACCGACAGCTGCTTGGC		 60
Dilp2 CG8167 Forward
Reverse		 TCCACAGTGAAGTTGGCCC
AGATAATCGCGTCGACCAGG		 57
Dilp3 CG14167 Forward
Reverse		 AGAGAACTTTGGACCCCGTGAA
TGAACCGAACTATCACTCAACAGTCT		 59
Dilp5 CG33273 Forward
Reverse		 AGTTCTCCTGTTCCTGATCC
CAGTGAGTTCATGTGGTGAG		 57
Dilp6 CG14049 Forward
Reverse		 ATATGCGTAAGCGGAACGGT
GCAAGAGCTCCCTGTAGGTG		 57
fOXO CG3143 Forward
Reverse		 AGGCGCAGCCGATAGACGAATTTA
TGCTGTTGACCAGGTTCGTGTTGA		 60
Open in a new tab

2.5. Feeding rate estimation

To measure the feeding rate, six late second instar D. melanogaster larvae from each line were infected with H. gerrardi IJs or treated with sterile distilled water and then collected at 12 or 36 h post-infection. Larvae were fed on dyed food containing 2.5% yeast extract (Sigma), 2.5% d-sucrose (Fisher Scientific), 1% FD&C Blue No1 Dye (Spectrum), and 1% Agar (Fisher Scientific) for 20 min, and rinsed in deionized water. Larvae were then homogenized in 250 μL of sterile deionized water and homogenates were centrifuged for 10 min following aspiration of the supernatants into a fresh set of tubes containing 50 μL of absolute ethanol. The tubes with the supernatants were vortexed for 30 s and centrifuged again for 10 min. Absorbance of the dye was detected as previously described [27]. Samples were loaded onto a 96-well micro plate and absorbance was measured at 633 nm using a plate reader (BioTek). The experiment was performed three times.

2.6. Measurement of trehalose, glucose, and glycogen levels

To determine the sugar content in D. melanogaster larvae, six individuals were collected at the 12- or 36-h time point following each treatment. To quantify glucose or glycogen levels, larvae were homogenized with a pellet pestle on ice in 100 μL of 1 × PBS. To quantify trehalose levels, larvae was homogenized with a pellet pestle on ice in 100 μL Trehalase buffer (TB; 5 mM Tris pH 6.6, 137 mM NaCl, 2.7 mM KCl) [22]. Following, homogenization, protein concentrations were measured using the Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific; 23227, Waltham, MA, USA).

2.7. Trehalose levels

Following the estimation of protein concentration, to measure the levels of trehalose, the samples were initially diluted 1:3 in TB, and then further diluted 1:1 in either TB or Trehalase Stock (TS; 3 μL of porcine trehalase in 1 mL of TB). Diluted samples were incubated at 37 °C for 24 h in a clear 96-well plate before 100 μL of hexokinase reagent (Glucose Assay Reagent, Sigma-Aldrich; G3293, St. Louis, MO, USA) were added to each well. Absorbance was measured at 340 nm using a plate reader (BioTek). To calculate trehalose levels, the amount of free glucose was subtracted from samples digested in TS.

2.8. Glucose and glycogen levels

Following protein quantification, to measure the levels of glucose and glycogen, the samples were first diluted 1:3 in PBS and then further diluted again 1:1 in either amyloglucosidase stock solution (1.5 μL of amyloglucosidase in 1 mL of PBS, Sigma-Aldrich) or PBS. Samples (30 μL) were subsequently incubated at 37 °C for 60 min in a clear 96-well plate and hexokinase reagent (100 μL) was added to each well. Following an additional incubation at room temperature for 15 min, absorbance was measured at 340 nm using a plate reader (BioTek). Glucose levels were calculated by a glucose standard curve. For glycogen, the absorbance of glucose was subtracted from the absorbance of samples diluted with amyloglucosidase stock.

The levels of trehalose, glucose, and glycogen were determined relative to the protein content in each sample. All experiments were repeated three times.

2.9. Statistical analysis

Data plotting and statistics were performed using the GraphPad Prism8 software. Statistical analysis of the data from the survival experiments was conducted using a log-rank (Mantel-Cox). Data from the rest of the experiments were statistically analyzed using one-way analysis of variance (ANOVA) with a Bonferroni correction.

3. Results

Toll and Imd signaling activities are not essential for the survival response of D. melanogaster larvae to H. gerrardi infection.

Inactivation of Toll and Imd signaling renders D. melanogaster adult flies more susceptible to infection with bacterial pathogens [28,29]. In addition, infection of D. melanogaster Dif1, Rele20 single mutants and Dif1;Rele20 double mutant adult flies with H. gerrardi or H. bacteriophora parasitic nematodes leads to higher mortality rates [30]. However, it is not known if Toll and Imd signaling activity contributes to the survival ability of D. melanogaster larvae upon parasitic nematode infection. To this end, we assessed the survival rate of Dif1 and Rele20 mutant larvae following infection with the nematode parasite H. gerrardi (Fig. 1A–B). Contrary to the findings in adult flies, we did not observe any significant changes in the survival of any of the mutant larvae compared to their background controls upon nematode infection. These findings show that inactivating Toll or Imd signaling activity does not affect the survival phenotype of larvae when responding to H. gerrardi nematode infection.

Fig. 1.

Fig. 1

Open in a new tab

Survival of Drosophila melanogaster Dif1 (A) and Rele20 (B) mutant larvae following Heterorhabditis gerrardi nematode infection. Cn bw is the background control line for Dif1mutants, while w1118 is the background control line for Rele20 mutants. Treatment with water only served as the uninfected control. Larval survival was counted every 12 h and up to 72 h following infection. Significance differences in survival between the experimental treatments were assessed using Log-rank (Mantel-Cox) test and survival data are shown as Kaplan-Meier survival curves. (A) Cn bw and Dif1 infected with H. gerarrdi nematodes p = 0.8493 (B) w1118 and Rele20 infected with H. gerarrdi nematodes p = 0.1534. Survival experiments were repeated three times and each experiment included biological duplicates for each fly line and treatment.

Imd signaling activity reduces feeding rate in D. melanogaster larvae following H. gerrardi infection.

  • •

    The feeding rate can impact the survival ability of mammalian hosts at various levels and this effect can vary with the type of host and pathogen infection [31]. For instance in mice, high feeding rate accelerates the mortality rate against Listeria monocytogenes infection but promotes survival against influenza virus infection [32]. For this reason, we wanted to determine whether lack of mortality in D. melanogaster Toll and Imd signaling mutants after H. gerrardi infection is associated with changes in food consumption. To test this, we measured the feeding rate of Dif1, and Rele20 mutant larvae and their background controls at 12 and 36 h post-infection (Fig. 2A–C). We selected 12 h as a relatively early time point based on the survival rates of the mutant larvae and 36 h as a later time point when nematode infection was established. We found that in the absence of infection, Dif1 mutants have increased feeding rate compared to their background controls. However, we did not observe any significant differences in the feeding rate between Dif1 mutants and Cn bw control larvae at either time point post nematode infection (Fig. 2A). Conversely, we found that Rele20 mutant larvae have increased feeding rate compared to controls at 12 h post H. gerrardi infection (Fig. 2B). Visual representation of these results can also be seen in Fig. 2C. Interestingly, the feeding rates significantly decreased in Rele20 mutants relative to their background controls at 36 h following infection. These results suggest that Imd but not Toll signaling activity regulates food consumption in D. melanogaster larvae during parasitic nematode infection, which is expressed as initial reduction during the early stages of infection followed by increase in feeding rate when the infection has progressed.

Fig. 2.

Fig. 2

Open in a new tab

Quantification of the feeding rate in Drosophila melanogaster immune mutant larvae at 12 and 36 h post Heterorhabditis gerrardi nematode infection. Cn bw is the background control line for Dif1 mutant larvae, while w1118 is the background control line for Rele20 mutants. (A) Dif1 36 h ****p < 0.0001; (B) Rele20 12 h ****p < 0.0001, **p = 0.0025 and 36 h ***p = 0.0002, **p = 0.0020; (C) Feeding rate of Rele20 mutant larvae at the 12-h time-point post H. gerrardi infection. Treatment with water only served as the uninfected control. Significance levels were assessed using one-way analysis of variance (ANOVA). The experiment was repeated three times with biological duplicates. Data represent means with standard deviation.

Toll and Imd signaling activity do not affect the levels of circulating or stored sugars in D. melanogaster larvae responding to H. gerrardi infection.

The Imd signaling pathway is a critical regulator of D. melanogaster sugar metabolism particularly in response to infection or inflammation [31]. For instance, in the absence of infection, reduced Imd signaling activity in glia leads to changes in the metabolic profile of adult flies, which include elevated levels of glucose and trehalose [33]. Ubiquitous inactivation of Imd signaling in D. melanogaster adults is also associated with impaired glucose tolerance in the absence of infection [18]. However, whether Toll or Imd signaling activity regulate the levels of circulating or stored sugars in D. melanogaster larvae during parasitic nematode infection remains unknown. To this end, we measured the levels of trehalose, glucose, and glycogen in Dif1 and Rele20 mutant larvae at 12 and 36 h post-infection with H. gerrardi nematodes (Fig. 3A–B, Fig. 4A–B, Fig. 5A–B). We have not found any significant differences in trehalose levels between the Dif1 and Rele20 mutant larvae and their corresponding background controls at either the 12 or 36 h time points post H. gerrardi infection (Fig. 3A–B). However, we observed a decrease in glucose levels in Dif1 mutant larvae (Fig. 4A) as the infection progressed. It is possible that persistent inflammation is causing the observed shifts in glucose stores over time. It is important to note that these results reflect the total levels of sugars in D. melanogaster and not the levels of glucose or trehalose in the hemolymph. Taken together, our results show that Toll and Imd signaling activities do not affect the levels of sugars in D. melanogaster larvae in the context of parasitic nematode challenge.

Fig. 3.

Fig. 3

Open in a new tab

Trehalose levels (μg/ml) in Drosophila melanogaster Dif1 (A) and Rele20 (B) mutant larvae at 12 and 36 h after Heterorhabditis gerrardi nematode infection. Cn bw is the background control line for Dif1 mutant larvae, while w1118 is the background control line for Rele20 mutants. Treatment with water only served as the uninfected control. Significance levels were assessed using one-way analysis of variance (ANOVA). The experiment was repeated three times with biological duplicates. Data represent means with standard deviation.

Fig. 4.

Fig. 4

Open in a new tab

Glucose levels (μg/ml) in Drosophila melanogaster Dif1 (A) and Rele20 (B) mutant larvae at 12 and 36 h post Heterorhabditis gerrardi nematode infection. Cn bw is the background control line for Dif1 mutant larvae, while w1118 is the background control line for Rele20 mutants. (A) *p = 0.0342. Treatment with water only served as the uninfected control. Significance levels were assessed using one-way analysis of variance (ANOVA). The experiment was repeated three times with biological duplicates. Data represent means with standard deviation.

Fig. 5.

Fig. 5

Open in a new tab

Glycogen levels (μg/ml) in Drosophila melanogaster Dif1 (A) and Rele20 (B) mutant larvae at 12 and 36 h upon Heterorhabditis gerrardi nematode infection. Cn bw is the background control line for Dif1 mutant larvae, while w1118 is the background control line for Rele20 mutants. Treatment with water only served as the uninfected control. Significance levels were assessed using one-way analysis of variance (ANOVA). The experiment was repeated three times with biological duplicates. Data represent means with standard deviation.

Imd signaling interacts with the insulin signaling via Dilp2 and Dilp3 expression in H. gerrardi infected D. melanogaster larvae.

In D. melanogaster, the insulin signaling is involved in a variety of processes from development and reproduction to metabolism and stress resistance [34,35]. Previous work has shown that insulin signaling is also involved in inflammation and antibacterial immunity in D. melanogaster through its interactions with the Imd signaling pathway [18,36]. For instance, constitutive activation of Imd signaling leads to reduced expression of the insulin signaling regulators, Dilp3 and Dilp6 in D. melanogaster larvae [18]. In addition, when the transcription factor of the insulin signaling, fOXO, is persistently activated in adult flies, expression of the peptidoglycan recognition protein SC2 (PGRP-SC2), negative regulator of the Imd signaling, is reduced [36]. To determine whether Toll and Imd signaling activity interacts with the insulin signaling in D. melanogaster larvae in the context of parasitic nematode infection, we quantified the transcript levels of genes regulated by the insulin signaling, including Dilp2, Dilp3, Dilp5, Dilp6, and fOXO, in Dif1 and Rele20 mutant larvae at 12 and 36 h post-infection with H. gerrardi nematodes (Fig. 6). We have not observed significant differences in Dilp gene expression between Dif1 mutants and their background controls upon H. gerrardi infection (Fig. 6A). However, we found that Dilp2 and Dilp3 transcript levels were significantly higher in Rele20 mutants compared to the w1118 background controls at 12 h post-infection. Interestingly, the transcript levels of Dilp2 and Dilp3 were lower in Rele20 mutants at 36 h post-infection relative to the 12-h time point (Fig. 6B). These results indicate that the Imd signaling interacts with the insulin signaling through decreasing the expression of Dilp2 and Dilp3 at the early stage of nematode infection. However, as the infection progresses, Imd signaling activity increases the expression of Dilp2 and Dilp3. It is likely that Toll signaling does not interact with the insulin signaling in the context of parasitic nematode infection in D. melanogaster larvae.

Fig. 6.

Fig. 6

Open in a new tab

Transcriptional expression insulin signaling genes Dilp2, Dilp3, Dilp5, Dilp6, and fOXO in Drosophila melanogaster Dif1 (A) and Rele20 (B) mutant larvae at 12 and 36 h upon Heterorhabditis gerrardi nematode infection. Cn bw is the background control line for Dif1 mutant larvae, while w1118 is the background control line for Rele20 mutants. (A) **p = 0.0015; (B)****p < 0.0001. Treatment with water only served as the uninfected control. Significance levels were assessed using one-way analysis of variance (ANOVA). The experiment was repeated three times with biological duplicates. Data represent means with standard deviation.

4. Discussion

In this study we have explored the contribution of the two Toll and Imd immune signaling pathways to regulating the survival ability, feeding rate, levels of sugar metabolites, and insulin signaling activity in D. melanogaster larvae upon infection with the parasitic nematode H. gerrardi. Our findings demonstrate that the D. melanogaster larval survival ability and levels of glucose, trehalose, and glycogen are not affected by Toll or Imd signaling activity upon H. gerrardi infection. However, we found that Imd signaling activity results in reduced feeding rate as well as changes in the transcript levels of insulin signaling components, Dilp2 and Dilp3 following H. gerrardi nematode infection (Fig. 7).

  • •

    Abnormal feeding rate is an indicator of sickness behavior and is conserved between vertebrates and invertebrates [32,37,38]. Infection induced changes in food consumption can regulate the D. melanogaster ability to combat infections. For instance, adult flies that become anorexic have increased tolerance against Salmonella typhimurium and decreased resistance against L. monocytogenes infection [38]. In addition, flies with reduced appetite show changes in AMP expression, such as decreased expression of the AMP genes Drosomycin and Drosocin and increased Attacin levels in response to L. monocytogenes infection [38]. Here, we show that following infection with the parasitic nematode H. gerrardi, Imd (Rele20) mutant larvae have increased feeding rate compared to their background controls. Furthermore, feeding rates decrease significantly in Rele20 mutants as the infection progresses. These results show that feeding rate is modulated by Imd signaling activity in D. melanogaster larvae responding to H. gerrardi infection. In contrast to Imd signaling mutants, there are no significant differences in feeding rate between Dif1 mutants and background control larvae following H. gerrardi infection. This indicates that Toll signaling activity is not involved in regulation of feeding rate to parasitic nematode infection. However, in the absence of infection Dif1 mutant larvae demonstrate an increased feeding rate compared to their background controls suggesting an interaction between Dif mediated Toll signaling and feeding capacity. In depth investigation of this potential interaction could be an interesting area for future studies.

Fig. 7.

Fig. 7

Open in a new tab

Proposed model of the interaction between immune signaling and feeding rate as well as insulin signaling in Drosophila melanogaster larvae responding to Heterorhabditis gerrardi infection. At 12-h post-nematode infection, Imd signaling activity reduces feeding rate and the expression of dilp2 and dilp3 genes, while at 36-h post-nematode infection, Imd signaling activity increases larval feeding rate. Toll signaling activity does not affect the feeding rate and the expression of dilp genes in nematode-infected larvae. The figure was created with BioRender.com.

In D. melanogaster, insulin signaling regulates a variety of processes including the metabolic response [34]. Dilps, hormones that bind to insulin receptors leading to the activation of the insulin signaling pathway, participate in the modulation of metabolic changes related to the activation of immune mechanisms [39]. In addition, Dilps orchestrate the action of metabolic organs such as fat body and gut, organs responsible for production of AMPs through the activation of Toll and Imd signaling [34,40,41]. Here we show that Dilp2 and Dilp3 transcript levels are significantly higher in loss-of-function mutants of Imd signaling mutants compared to their background controls during the early stage of H. gerrardi infection. However, as the infection progresses, the transcript levels of Dilp2 and Dilp3 decrease in Imd signaling mutants. Our findings suggest that Imd signaling activity regulates the expression of Dilp2 and Dilp3 to H. gerrardi infection. Similar to our findings at the early time point of infection with H. gerrardi nematodes, previous work has shown that constitutive activation of the Imd signaling leads to decreased levels of Dilp3 [18]. It has been previously reported that persistent activation of the Toll signaling leads to suppression of insulin signaling activity [42]. Conversely, following infection with H. gerrardi nematodes there are no significant differences in the expression of Dilps or fOXO in loss-of-function mutants of Toll signaling compared to their background controls. Even though the interplay between Toll and insulin signaling in the absence of infection is evident, interaction between the two pathways is not observed in the context of parasitic nematode infection.

Taken together, results obtained from this study provide important insight into the contribution of the innate immune signaling pathways to regulating host sugar metabolism during infection with parasitic nematodes. In searching for novel and effective treatment strategies against parasitic nematode infection in humans, D. melanogaster is a great model system to reveal the molecular and functional factors that participate in the immunometabolic response to infection. In addition, with regard to their phylogenetic relationship, it is possible to make relevant comparisons between Heterorhabditis nematodes and vertebrate parasites which will potentially offer insight on the relationship between nematode parasitism and host immunometabolism [[43], [44], [45]].

Author contribution statement

Yaprak Ozakman: designed and conducted the experiments, analyzed the data, constructed the figures, interpreted the results, and wrote drafts of the manuscript.

Dhaivat Raval: conducted parts of the experiments, analyzed the data, and contributed to a draft of the manuscript.

IOANNIS ELEFTHERIANOS: supervised the project, designed the experiments, interpreted the results, and revised the manuscript.

Funding statement

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Data availability statement

Data will be made available on request.

Additional information

No additional information is available for this paper.

Declaration of competing interest

The authors declare the following financial interests/personal relationships which may be considered as potential competing interests:

Ioannis Eleftherianos reports a relationship with The George Washington University that includes: employment.

Acknowledgments

We thank members of the Department of Biological Sciences at George Washington University for providing feedback to the project.

References

  • 1.Hotamisligil G.S. Foundations of immunometabolism and implications for metabolic health and disease. Immunity. 2017;47:406–420. doi: 10.1016/j.immuni.2017.08.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Hotamisligil G.S. Inflammation, metaflammation and immunometabolic disorders. Nature. 2017;542:177–185. doi: 10.1038/nature21363. [DOI] [PubMed] [Google Scholar]
  • 3.Lee Y.S., Wollam J., Olefsky J.M. An integrated view of immunometabolism. Cell. 2018;172:22–40. doi: 10.1016/j.cell.2017.12.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Hoffmann J.A. The immune response of Drosophila. Nature. 2003;426:33–38. doi: 10.1038/nature02021. [DOI] [PubMed] [Google Scholar]
  • 5.Ugur B., Chen K., Bellen H.J. Drosophila tools and assays for the study of human diseases. Dis. Model Mech. 2016;9:235–244. doi: 10.1242/dmm.023762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Goberdhan D.C.I., Wilson C. The functions of insulin signaling: size isn't everything, even in Drosophila. Differentiation. 2003;71:375–397. doi: 10.1046/j.1432-0436.2003.7107001.x. [DOI] [PubMed] [Google Scholar]
  • 7.Valanne S., Wang J.-H., Rämet M. The Drosophila Toll signaling pathway. J. Immunol. 2011;186:649–656. doi: 10.4049/jimmunol.1002302. [DOI] [PubMed] [Google Scholar]
  • 8.Myllymäki H., Valanne S., Rämet M. The Drosophila imd signaling pathway. J. Immunol. 2014;192:3455–3462. doi: 10.4049/jimmunol.1303309. [DOI] [PubMed] [Google Scholar]
  • 9.Michel T., Relchhart J.M., Hoffmann J.A., Royet J. Drosophila Toll is activated by Gram-positive bacteria through a circulating peptidoglycan recognition protein. Nature. 2001;414:756–759. doi: 10.1038/414756a. [DOI] [PubMed] [Google Scholar]
  • 10.Kleino A., Silverman N. The Drosophila IMD pathway in the activation of the humoral immune response. Dev. Comp. Immunol. 2014;42:25–35. doi: 10.1016/j.dci.2013.05.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Imler J.L., Bulet P. Antimicrobial peptides in Drosophila: structures, activities and gene regulation. Chem. Immunol. Allergy. 2005;86:1–21. doi: 10.1159/000086648. [DOI] [PubMed] [Google Scholar]
  • 12.Hallem E.A., Rengarajan M., Ciche T.A.A., Sternberg P.W. Nematodes, bacteria, and flies: a tripartite model for nematode parasitism. Curr. Biol. 2007;17:898–904. doi: 10.1016/j.cub.2007.04.027. [DOI] [PubMed] [Google Scholar]
  • 13.Kenney E., Hawdon J.M., O'Halloran D., Eleftherianos I. Heterorhabditis bacteriophora excreted-secreted products enable infection by Photorhabdus luminescens through suppression of the imd pathway. Front. Immunol. 2019;10:1–14. doi: 10.3389/fimmu.2019.02372. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Ozakman Y., Eleftherianos I. TGF-β signaling interferes with the Drosophila innate immune and metabolic response to parasitic nematode infection. Front. Physiol. 2019;10 doi: 10.3389/fphys.2019.00716. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Yadav S., Frazer J., Banga A., Pruitt K., Harsh S., Jaenike J., et al. Endosymbiont-based immunity in Drosophila melanogaster against parasitic nematode infection. PLoS One. 2018;13:1–20. doi: 10.1371/journal.pone.0192183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Harsh S., Ozakman Y., Kitchen S.M., Paquin-Proulx D., Nixon D.F., Eleftherianos I. Dicer-2 regulates resistance and maintains homeostasis against Zika virus infection in Drosophila. J. Immunol. 2018;201:3058–3072. doi: 10.4049/jimmunol.1800597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Ozakman Y., Eleftherianos I. Immune interactions between Drosophila and the pathogen Xenorhabdus. Microbiol. Res. 2020;240 doi: 10.1016/j.micres.2020.126568. [DOI] [PubMed] [Google Scholar]
  • 18.Davoodi S., Galenza A., Panteluk A., Deshpande R., Ferguson M., Grewal S., et al. The immune deficiency pathway regulates metabolic homeostasis in Drosophila. J. Immunol. 2019;202:2747–2759. doi: 10.4049/jimmunol.1801632. [DOI] [PubMed] [Google Scholar]
  • 19.Chambers M.C., Song K.H., Schneider D.S. Listeria monocytogenes infection causes metabolic shifts in Drosophila melanogaster. Freitag NE. PLoS One. 2012;7 doi: 10.1371/journal.pone.0050679. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Dionne M.S., Pham L.N., Shirasu-Hiza M., Schneider D.S. Akt and foxo dysregulation contribute to infection-induced wasting in Drosophila. Curr. Biol. 2006;16:1977–1985. doi: 10.1016/j.cub.2006.08.052. [DOI] [PubMed] [Google Scholar]
  • 21.Shokal U., Kopydlowski H., Harsh S., Eleftherianos I. Thioester-containing proteins 2 and 4 affect the metabolic activity and inflammation response in Drosophila. Infect. Immun. 2018;86:1–18. doi: 10.1128/IAI.00810-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Ozakman Y., Pagadala T., Raval D., Eleftherianos I. The Drosophila melanogaster metabolic response against parasitic nematode infection is mediated by TGF-β signaling. Microorganisms. 2020;8:1–13. doi: 10.3390/microorganisms8070971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Ozakman Y., Eleftherianos I. TGF-Β signaling interferes with the Drosophila innate immune and metabolic response to parasitic nematode infection. Front. Physiol. 2019;10 doi: 10.3389/fphys.2019.00716. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Plichta K.L., Joyce S.A., Clarke D., Waterfield N., Stock S.P. Heterorhabditis gerrardi n. sp. (Nematoda: Heterorhabditidae): the hidden host of Photorhabdus asymbiotica (Enterobacteriaceae: γ-Proteobacteria) J. Helminthol. 2009;83:309–320. doi: 10.1017/S0022149X09222942. [DOI] [PubMed] [Google Scholar]
  • 25.Hedengren M., Åsling B., Dushay M.S., Ando I., Ekengren S., Wihlborg M., et al. Relish, a central factor in the control of humoral but not cellular immunity in Drosophila. Mol. Cell. 1999;4:827–837. doi: 10.1016/S1097-2765(00)80392-5. [DOI] [PubMed] [Google Scholar]
  • 26.White G.F. A method for obtaining infective nematode larvae from cultures. Science. 1927;66:302–303. doi: 10.1126/science.66.1709.302-a. [DOI] [PubMed] [Google Scholar]
  • 27.Edgecomb R.S., Harth C.E., Schneiderman A.M. Regulation of feeding behavior in adult Drosophila melanogaster varies with feeding regime and nutritional state. J. Exp. Biol. 1994;197:215–235. doi: 10.1242/jeb.197.1.215. [DOI] [PubMed] [Google Scholar]
  • 28.Rutschmann S., Kilinc A. 2021. Cutting Edge: the Toll Pathway Is Required for Resistance to Gram-Positive Bacterial Infections in Drosophila. [DOI] [PubMed] [Google Scholar]
  • 29.Lemaitre B., Kromer-Metzger E., Michaut L., Nicolas E., Meister M., Georgel P., et al. A recessive mutation, immune deficiency (imd), defines two distinct control pathways in the Drosophila host defense. Proc. Natl. Acad. Sci. USA. 1995;92:9465–9469. doi: 10.1073/pnas.92.21.9465. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Patrnogic J., Heryanto C., Ozakman Y., Eleftherianos I. Transcript analysis reveals the involvement of NF-κB transcription factors for the activation of TGF-β signaling in nematode-infected Drosophila. Immunogenetics. 2019;71:501–510. doi: 10.1007/s00251-019-01119-8. [DOI] [PubMed] [Google Scholar]
  • 31.Galenza A., Foley E. Immunometabolism: insights from the Drosophila model. Dev. Comp. Immunol. 2019;94:22–34. doi: 10.1016/j.dci.2019.01.011. [DOI] [PubMed] [Google Scholar]
  • 32.Wang A, Huen SC, Luan HH, Gallezot J, Booth CJ, Medzhitov R, et al. Opposing effects of fasting metabolism on tissue tolerance in bacterial and viral inflammation article opposing effects of fasting metabolism on tissue tolerance in bacterial and viral inflammation Cell. 166: 1512-1518.e12. doi:10.1016/j.cell.2016.07.026. [DOI] [PMC free article] [PubMed]
  • 33.Kounatidis I., Chtarbanova S., Cao Y., Hayne M., Jayanth D., Ganetzky B., et al. NF-κB immunity in the brain determines fly lifespan in healthy aging and age-related neurodegeneration. Cell Rep. 2017;19:836–848. doi: 10.1016/j.celrep.2017.04.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Semaniuk U., Piskovatska V., Strilbytska O., Strutynska T., Burdyliuk N., Vaiserman A., et al. Drosophila insulin‐like peptides: from expression to functions – a review. Entomol. Exp. Appl. 2021;169:195–208. doi: 10.1111/eea.12981. [DOI] [Google Scholar]
  • 35.Teleman A.A. Molecular mechanisms of metabolic regulation by insulin in Drosophila. Biochem. J. 2010;425:13–26. doi: 10.1042/BJ20091181. [DOI] [PubMed] [Google Scholar]
  • 36.Guo L., Karpac J., Tran S.L., Jasper H. PGRP-SC2 promotes gut immune homeostasis to limit commensal dysbiosis and extend lifespan. Cell. 2014;156:109–122. doi: 10.1016/j.cell.2013.12.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Adamo S.A. Parasitic suppression of feeding in the tobacco hornworm, Manduca sexta: parallels with feeding depression after an immune challenge. Arch. Insect Biochem. Physiol. 2005;60:185–197. doi: 10.1002/arch.20068. [DOI] [PubMed] [Google Scholar]
  • 38.Ayres J.S., Schneider D.S. The role of anorexia in resistance and tolerance to infections in Drosophila. PLoS Biol. 2009;7 doi: 10.1371/journal.pbio.1000150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Dolezal T., Krejcova G., Bajgar A., Nedbalova P., Strasser P. Molecular regulations of metabolism during immune response in insects. Insect Biochem. Mol. Biol. 2019;109:31–42. doi: 10.1016/j.ibmb.2019.04.005. [DOI] [PubMed] [Google Scholar]
  • 40.Broderick N.A. Friend, foe or food? Recognition and the role of antimicrobial peptides in gut immunity and Drosophila-microbe interactions. Philos. Trans. R. Soc. B Biol. Sci. 2016;371 doi: 10.1098/rstb.2015.0295. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Buchon N., Silverman N., Cherry S. Immunity in Drosophila melanogaster–from microbial recognition to whole-organism physiology. Nat. Rev. Immunol. 2014;14:796–810. doi: 10.1038/nri3763. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.DiAngelo J.R., Bland M.L., Bambina S., Cherry S., Birnbaum M.J. The immune response attenuates growth and nutrient storage in Drosophila by reducing insulin signaling. Proc. Natl. Acad. Sci. U. S. A. 2009;106:20853–20858. doi: 10.1073/pnas.0906749106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Sommer R.J., Streit A. Comparative genetics and genomics of nematodes: genome structure, development, and lifestyle. Annu. Rev. Genet. 2011;45:1–20. doi: 10.1146/annurev-genet-110410-132417. [DOI] [PubMed] [Google Scholar]
  • 44.Bai X., Adams B.J., Ciche T.A., Clifton S., Gaugler R., Kim K., et al. A lover and a fighter: the genome sequence of an entomopathogenic nematode Heterorhabditis bacteriophora. PLoS One. 2013;8 doi: 10.1371/journal.pone.0069618. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Plotkin S., Diemert D.J., Bethony J.M., Hotez P.J. Hookworm Vaccines. Clin Infect Dis. 2008;46:282–288. doi: 10.1086/524070. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data will be made available on request.

Articles from Heliyon are provided here courtesy of Elsevier

RESOURCES