Protocol to evaluate the impact of murine MCT1-deficient CD8⁺ T cells on adipogenesis

Summary

The infiltration of activated T cells, such as CD8⁺ effector, in metabolic tissues plays a crucial role for the initiation and propagation of obesity-induced inflammation. Given the pivotal role of lactate transporter monocarboxylate transporter 1 (MCT1) in immune cell activation, we present a protocol for the isolation and activation of CD8⁺ T lymphocytes selectively lacking MCT1. We describe steps for the induction of adipocyte differentiation, CD8⁺ T isolation and activation, and adipocyte-CD8⁺ T cell co-culture. We then detail qPCR analysis on differentiated adipocytes.

For complete details on the use and execution of this protocol, please refer to Macchi et al.¹

Graphical abstract

Highlights

• •Protocol to co-culture murine NIH-3T3 adipocytes and CD8⁺ T cells
• •Steps for isolation of CD8⁺ T lymphocytes from lymph nodes and spleen of mice
• •Investigating the impact of MCT1 deficiency in CD8⁺ T cells on adipogenesis

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

The infiltration of activated T cells, such as CD8⁺ effector, in metabolic tissues plays a crucial role for the initiation and propagation of obesity-induced inflammation. Given the pivotal role of lactate transporter monocarboxylate transporter 1 (MCT1) in immune cell activation, we present a protocol for the isolation and activation of CD8⁺ T lymphocytes selectively lacking MCT1. We describe steps for the induction of adipocyte differentiation, CD8⁺ T isolation and activation, and adipocyte-CD8⁺ T cell co-culture. We then detail qPCR analysis on differentiated adipocytes.

Before you begin

The protocol below primarily focuses on an in vitro co-culture between CD8⁺ T cells, specifically lacking monocarboxylate transporter 1 (MCT1), and murine adipocytes (NIH-3T3 cells).

• 1.Prepare all the buffers required for the protocol: RPMI-10, MACS buffer, complete DMEM for culturing NIH-3T3 pre-adipocytes and maintain them sterile at 4°C.
• 2.Generation of the animal model (http://www.informatics.jax.org/reference/J:328998).

Breed mice carrying floxed alleles of Slc16a1 (termed Slc16a1^f/f) on the C57BL/6 genetic background with CD4^cre+ mice (kindly given by Prof. Marelli-Berg, Queen Mary University of London, UK) for specific deletion of Slc16a1 in both CD4⁺ and CD8⁺ T lymphocytes.

• 3.Since the aim of this protocol is to assess late stages of adipogenesis, it is necessary that the preadipocytes are already in an advanced phase of the differentiation process when the lymphocytes are ready for the co-cultured.
  Differentiation of NIH-3T3 pre-adipocytes in mature adipocytes² (Figure 1A).

  • a.
    Seed 6-well plates with NIH-3T3 preadipocytes at 100,000 cells per well. Use Dulbecco’s Modified Eagle’s Medium (DMEM) – high glucose supplemented with 10% FBS, 1% L-glutamine and 1% Penicillin-Streptomycin (10,000 U/mL) (complete DMEM). Use 2 mL of medium for each well.
  • b.
    Let cells to grow at 37°C with 5% of CO₂ until they reach confluence.
  • c.
    Leave NIH-3T3 preadipocytes to grow for further 2 days (T0), after which the differentiation into mature adipocytes can be induced.
  • d.
    Replace the cell growth medium with a differentiation cocktail composed of complete DMEM (high glucose) containing insulin (10 μg/mL), dexamethasone (1μM), 3-isobutyl-1- methylxanthine - IBMX - 0.5 mM) for further 2 days (T2).

    • i.
      Prepare insulin by a stock solution of 5 mg/mL in HCl 0.1M; dexamethasone by a stock solution of 5mM in EtOH 100%; IBMX by a stock solution of 250 mM in KOH 0.35M.
  • e.
    Replace the differentiation medium with the differentiation-maintenance one, consisting of complete DMEM (high glucose) containing insulin (10 μg/mL).

    • i.
      Let the cells grow in this medium until day 6 (T6).
  • f.
    At day 6 co-culture adipocytes with CD8⁺ T cells.

    Note: This step (f) will last until day 9 (T9) which corresponds to the end of the differentiation protocol.

Figure 1.

Step-by-step description of adipogenesis analysis in adipocytes co-cultured with activated CD8⁺ T cells

(A) Schematic representation of the co-culture timeline between activated CD8⁺ T cells and NIH-3T3 differentiated murine adipocytes. T0 represents the timepoint the differentiation of NIH-3T3 into mature adipocytes is induced.

(B) Example of results obtained by co-culturing activated CD8⁺ T lymphocytes with NIH-3T3 differentiated murine adipocytes. CD8⁺ T lymphocytes were isolated from Slc16a1^f/fTcell^cre mice selectively lacking MCT1 in CD8⁺T cells and their counterpart Slc16a1^f/f mice. After activation, CD8⁺T cells were co-cultured with mature adipocytes. The gene expression of the adipogenic genes, Lpl and Glut 4 is reported.¹ n= 5 per group. Glut4, glucose transporter type 4; Lpl, lipoprotein lipase; Slc16a1, solute carrier family 16 member 1 (monocarboxylic transporter 1). ∗p< 0.05 and ∗∗∗p< 0.001 (as assessed by Student's t-test).

Institutional permissions

All animal procedures were performed in accordance with the guidelines from directive 2010/63/EU of the European Parliament on the protection of animals used for scientific purposes and were approved by the Ethical Committee (Authorization 780/2016 to MR).

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Purified anti-mouse CD3 antibody	BioLegend	Cat: 102102; RRID: AB_312659
Purified anti-mouse CD28 antibody	BioLegend	Cat: 102102; RRID: AB_312867
Anti-mouse CD69 APC-Cy7 antibody	BD Pharmingen	Cat: 561240 RRID: AB_10611852
Chemicals, peptides, and recombinant proteins
3-isobutyl-1-methylxanthine (IBMX)	Merck (Sigma-Aldrich)	Cat: I5869
Dexamethasone	Merck (Sigma-Aldrich)	Cat: D1756
Insulin	Merck (Sigma-Aldrich)	Cat: I6634
eBioscience™ 1X RBC Lysis Buffer	Thermo Fisher Scientific	Cat: 00-4333-57
Human recombinant IL-2	PeproTech	Cat: #GMP200-02
Critical commercial assays
EasySep™ mouse CD8+ T cell isolation kit	STEMCELL	Cat: #19853
RNeasy Mini Kit (50)	Qiagen	Cat: 74104
Experimental models: Cell lines
Mouse: NIH-3T3-L1	ATCC	CL-173
Experimental models: Organisms/strains
Mouse: Slc16a1flox/flox For breeding; -Age: 7 weeks -Sex: male and female	Sonveaux Pierre	N/A
Mouse: CD4cre+ For breeding; -Age: 7 weeks -Sex: male and female	Marelli-Berg Federica	N/A
Mouse: Slc16a1flox/flox selectively lacking MCT1 in CD8+T cells For CD8+T lymphocytes isolation: -Age: 28 weeks -Sex: male	N/A	N/A
Oligonucleotides
Primers: Cebpα Fw: GAACAGCTGAGCCGTGAACT Rev: TAGAGATCCAGCGACCCGAA	Metabion	https://wop.metabion.com
Primers: Cebpδ Fw: GAACCCGCGGCCTTCTAC Rev: GAAGAGTTCGTCGTGGCACA	Metabion	https://wop.metabion.com
Primers: Cidea Fw: CACGCATTTCATGATCTTGG Rev: CCTGTATAGGTCGAAGGTGA	Metabion	https://wop.metabion.com
Primers: Glut4 Fw: GCTCTGACGATGGGGAACC Rev: GCCACGTTGCATTGTAGCTC	Metabion	https://wop.metabion.com
Primers: Lep Fw: CAAGCAGTGCCTATCCAGA Rev: AAGCCCAGGAATGAAGTCCA	Metabion	https://wop.metabion.com
Primers: Lpl Fw: TCGGGCCCAGCAACATTATC Rev: TGGTCAGACTTCCTGCTACG	Metabion	https://wop.metabion.com
Primers: Pparδ Fw: TCTCCCAGAATTCCTCCCCT Rev: GAGCTTCATGCGGATTGTCC	Metabion	https://wop.metabion.com
Primers: Pparγ Fw: TGTGAGACCAACAGCCTGAC Rev: AAGTTGGTGGGCCAGAATGG	Metabion	https://wop.metabion.com
Primers: Ppargc1α Fw: CATTTGATGCACTGACAGATGGA Rev: GTCAGGCATGGAGGAAGGAC	Metabion	https://wop.metabion.com
Primers: Rpl13a Fw:GCGCCTCAAGTGGTGTTGGAT Rev: GAGCAGCAGGGACCACCAT	Metabion	https://wop.metabion.com
Software and algorithms
GraphPad-Prism8	GraphPad	https://www.graphpad.com/scientific-software/prism
Novoexpress	Agilent	https://www.agilent.com/en/product/research-flow-cytometry/flow-cytometry-software/novocyte-novoexpress-software-1320805
Bio-Rad CFX Manager	Bio-Rad	https://www.bio-rad.com/it-it/sku/1845000-cfx-manager-software?ID=1845000
Other
Counting chamber, Fast Read® 102	VWR	Cat: 630-1893
Costar® 6-well cell culture plates (Product number: 3516)	Merck (Sigma-Aldrich)	Cat: 3516
Costar® 24 mm Transwell® with 0.4 μm Pore Polycarbonate Membrane Insert, Sterile	Corning	Cat: 3412
Maxima First Strand cDNA Synthesis Kit for RT-qPCR	Thermo Fisher	Cat: K1642
Maxima SYBR Green/Fluorescein qPCR Master Mix (2X)	Thermo Fisher	Cat: K0242
EasySep Magnet	STEMCELL	Cat: #18000

Materials and equipment

PCR cycling conditions are showed in Figure 2.

Alternatives: For the real time PCR procedure, we use the instrument CFX Connect Real-Time System (Bio-Rad) although a different real-time PCR detection system can be used.

Alternatives: To determine CD8⁺ T cells activation we use the Novocyte 3000 cytofluorimeter but any other cytofluorimeter can be used as long as it has the laser to read the fluorophore used for the staining. We use CD69 APC-Cy7 which requires the 640 nm laser for excitation and has an emission peak of 799 nm, but it is possible to change the antibody used with another one with proper characteristics readable by the instrument.

RPMI-10

Reagent	Final concentration	Amount
RPMI 1640	N/A	429.5 mL
FBS (fetal bovine serum)	10%	50 mL
Sodium pyruvate (100mM)	1 mM	5 mL
HEPES (1M)	10 mM	5 mL
β-Mercaptoethanol (50mM)	50 μM	500 μL
Penicillin/Streptomycin	1%	5 mL
Glutamine (200mM)	2 mM	5 mL
Total	N/A	500 mL

Store at 4°C. Heat to 37°C before use.

MACS buffer:

Reagent	Final concentration	Amount
PBS	N/A	488 mL
FBS (fetal bovine serum)	2%	10 mL
EDTA (0.5M)	2 mM	2 mL
Total	N/A	500 mL

Store at 4°C for at maximum 30 days

Note: Check before use if the buffer has floating particles. To overcome this issue, it is mandatory to filter the buffer with a sterile filter under the hood to be sure to use only sterile buffer.

Complete DMEM for culturing NIH-3T3 pre-adipocytes:

Reagent	Final concentration	Amount
Dulbecco’s Modified Eagle’s Medium (DMEM) – high glucose	N/A	440 mL
FBS (fetal bovine serum)	10%	50 mL
L-glutamine	1%	5 mL
Penicillin-Streptomycin (10,000 U/mL)	1%	5 mL
Total	N/A	500 mL

Store the medium at 4°C for at maximum 30 days. Heat to 37°C before use.

Figure 2.

PCR cycling conditions

Initial denaturation (95°C for 10 min). Repeat 40 cycles of denaturation (95°C for 15 seconds) and annealing (60°C for 1 min).

Step-by-step method details

CD8⁺ T lymphocytes isolation from lymph nodes and spleen

Timing: 2.5 h

This section describes how to collect mice lymph nodes and spleen and how to process these tissues to obtain a uniform cell suspension for the isolation of CD8⁺ T cells to be used for the co-culture with mouse adipocytes NIH-3T3 cells.

• 1.
  Collect the lymph nodes and spleen.

  • a.
    Euthanize mouse with isoflurane (2%) or other approved methods.
  • b.
    Open the abdomen of the mice by using surgical scissors and tweezers. It is important to lift the skin without opening the peritoneum.

    • i.
      Collect the two inguinal lymph nodes located in the subcutaneous adipose tissue of the inguinal left and right regions.
    • ii.
      Collect brachial and axillary lymph nodes located in the axillary left and right regions.
    • iii.
      Ensure to eliminate the surrounding adipose tissue.
    • iv.
      Place the organs collected in a 48-well plate containing 500μL of MACS buffer (PBS/2% FBS/2 μM EDTA) each well.³
  • c.
    Open the peritoneal cavity and collect the spleen which is located inside the rib cage on the left, above the stomach. Place the organ in the 48-well plate containing 500 μL of MACS buffer previously used also for lymph nodes.
• 2.
  Prepare a uniform cell suspension of primary lymphocytes from the lymph nodes and spleen.

  • a.
    In a sterile biosafety cabinet, place a 70 μm cell strainer on top of a 50 mL tube.
  • b.
    Mash the lymph nodes and spleen, through the strainer by using a 1mL syringe plunger and 10 mL MACS buffer.

    Note: the percentage of CD8⁺ T cells obtained from the cell suspension (derived both from lymph nodes and spleen) is less than 10%.

  • c.
    Centrifuge the cells at 500 g for 5 min, aspirate the supernatant with the vacuum and resuspend the pellet in 1 mL of eBioscience™ 1X RBC Lysis Buffer. RBC or red blood lysis buffer is used for the lysis of erythrocytes in single-cell suspension. Leave the suspension at 4°C for 5 min.
  • d.
    Bring up the suspension to a volume of 10 mL by using MACS buffer. This step allows us to wash the cells. Centrifuge the suspension for 5 min at 500 g.

    Note: If there is a need to pool out lymph nodes and spleen collected from more than one mouse, then increase the volume of lysis buffer, and wash the cells with at least 3 times the volume of the lysis buffer used.

  • e.
    Aspirate the supernatant and resuspend the cells in 10 mL of MACS buffer.
  • f.
    Count the cells in the counting chamber by using a 1:20 dilution in Trypan blue.

    Note: Whether the number of cells is too high to be counted in the squares of the chamber, it is necessary to increase the dilution to limit count errors.

• 3.
  Isolate CD8⁺ T lymphocytes with negative selection beads present in the EasySep™ mouse CD8⁺ T cell isolation kit.

  • a.
    Centrifuge cells at 500 g for 5 min.
  • b.
    Resuspend the cells in MACS buffer in order to achieve a concentration of 1×10⁸ cells per mL and then transfer samples in a 5 mL sterile polystyrene round bottom tube.

    Note: For the isolation protocol, we usually use the EasySep™ magnet with which the isolation can be performed with 2 mL as a maximum volume of cells. If you have more than 2×10⁸, divide the sample for two isolations, in two different tubes.

  • c.
    Add rat serum 50 μL/mL and 50 μL/mL of isolation cocktail supplied with the kit. This cocktail is done by biotinylated monoclonal antibodies against non-CD8⁺ T cells dissolved in PBS and 0.1% BSA. Mix briefly and incubate 10 min at 22°C.
  • d.
    Vortex the beads vial present in the kit for 10 s and add a concentration of 125 μL/mL to each sample.
  • e.
    Vortex rapidly and leave the tubes for 5 min at 22°C.
  • f.
    Fill in the tube with MACS buffer until reaching a volume of 2.5 mL.
  • g.
    Place the tube into the magnet and incubate for 2.5 min.
  • h.
    Pour the enriched cells by inverting the magnet and collect the CD8⁺ T cells in a new 15 mL tube.
  • i.
    Count the enriched cells with Trypan Blue with a 1:10 dilution.
  • j.
    Resuspend the cells in RPMI-10 medium in order to achieve a cell concentration of 2×10⁶ cells/mL.
  • k.
    CD8⁺ T cells are ready for cells activation.

    Note: To assess CD8⁺ T cell activation, save an aliquot of your cells (2×10⁵ cells are sufficient) to perform the cytometry staining the same day of the isolation (flow cytometry staining and evaluation of activation is described in the next paragraph 2 “Activation assessment”).

CD8⁺ T lymphocyte activation

Timing: 25 h

This section explains in detail how to activate CD8⁺ T lymphocytes in vitro and how to assess their activation through flow cytometry.

• 4.
  In vitro activation.

  • a.
    Coat a 12-well plate with 500 μL per well anti-CD3 (0.5 μg/mL) and CD28 (2.5 μg/mL) diluted in PBS, for 1 h at 37°C.⁴

    CRITICAL: The coating must be performed in PBS and not in MACS buffer because the presence of fetal bovine serum (FBS) can reduce the efficiency of anti-CD3 and anti-CD28 coating.

  • b.
    Aspirate the coating and plate 2×10⁶ of isolated CD8⁺ T lymphocytes in each well ensuring to reach a final volume of 2.5 mL of complete RPMI medium (R10; RPMI plus 10% FBS, glutamine, HEPES, 2-ME, sodium pyruvate and antibiotics) preheated at 37°C.
  • c.
    Add interleukin (IL)-2 at a concentration of 25 U/mL and leave the cells to be activated for 24 h at 37°C in the presence of 5% CO₂.
• 5.
  Harvesting of CD8⁺ T cells.

  • a.
    After 24h of incubation, collect CD8⁺ T cells from the 12-well plate into a 15 mL tube. Use a 1 mL pipette.

    Note: if you have many wells to collect, use a 50 mL tube.

  • b.
    Add 1 mL of MACS buffer to the well and pipette again to be sure to collect all the cells.

    Note: to ensure that all cells are collected before throwing away the plate, add 1 mL of PBS to the well and check at the microscope to see if the plate is free of cells. Otherwise pipette again and add the solution to the previous collected cells.

  • c.
    Centrifuge the 15 mL tube containing the cells at 500 g for 5 min.
  • d.
    Aspirate the supernatant and resuspend the pellet with MACS buffer to allow the cells to be counted. Use Trypan Blue, as described above.
  • e.
    Centrifuge the 15 mL tube containing the cells at 500 g for 5 min.
  • f.
    Resuspend the counted cells in R10 complete medium to achieve a 2×10⁶ cells every 1.5 mL.
  • g.
    CD8⁺ T cells are now ready to be co-cultured with adipocytes.
• 6.
  Activation assessment: the staining with anti-CD69 APC-Cy7, an early activation marker, allows us to evaluate changes in cell physical parameters.

  Note: If you want to evaluate the activation of the CD8⁺ T cells, you must compare the cells before the induction of activation with the activated ones, and you need to perform the same staining for not activated cells the day of the isolation and 24 h post activation (2×10⁵ cells are sufficient for the staining).

  • a.
    Transfer 2×10⁵ cells in a 96 well plate (V-bottom).
  • b.
    Centrifuge the plate at 800 g for 5 min.
  • c.
    Discard the supernatant and resuspend the pellet with 50 μL MACS buffer containing 0.5 μL of anti-CD69 antibody per well.
  • d.
    Incubate for 30 min at 4°C in the dark.
  • e.
    Add 150 μL of MACS buffer to each well to wash the cells.
  • f.
    Centrifuge 5 min at 800 g.
  • g.
    Repeat steps “e” and “f” once more.
  • h.
    Resuspend each well with 100 μL of MACS buffer and transfer cells to a 5 mL tube.
  • i.
    Bring each sample to a final volume of 250 μL with MACS buffer.
  • j.
    Acquire the samples with the cytofluorimeter: compare median of the forward scatter, the side scatter and CD69 fluorescence intensity between basal and activated cells (Figure 3).

    Note: During the activation process, the dimension (cell size) and complexity (cell granularity) of CD8⁺ T cells are raised. These features translate into a shift in the median fluorescence intensity read in the forward scatter (a physical parameter that refers to the cell size) and the side scatter (an index of cell granularity or complexity). The expression of cluster of differentiation (CD)69, a marker of early activation, increases rapidly after activation leading to a higher fluorescence that is detected in cytofluorimetric analysis if compared to a CD8⁺ T cell not stimulated.

Figure 3.

Flow cytometry analysis of activated CD8⁺ T cells

The Left panel shows the comparison of forward scatter median fluorescence intensity between basal and activated cells.

The central panel comparison of forward scatter median fluorescence intensity between basal and activated cells. The right panel comparison of CD69 median fluorescence intensity between basal and activated cells.

Co-culture between activated CD8⁺ T lymphocytes and murine NIH-3T3 cells

Timing: 3 days

This section describes how to co-culture differentiating NIH-3T3 cells with CD8⁺ T lymphocytes to evaluate the impact of the MCT1 expression in CD8⁺ T lymphocytes on late stages of adipogenesis.

• 7.
  Co-culture (Figure 1A).

  • a.
    At day 6 (T6) of the differentiation protocol, put a transwell insert and add on the insert 2×10⁶ activated CD8⁺ T cells, in a 1.5 mL volume, in each well of the 6-well plate.
  • b.
    Let the co-culture to growth for further three days, until the last day of the preadipocytes differentiation into mature adipocytes (T9).
  • c.
    Remove the transwell inserts and harvest cells from each well of the 6-well plate

• 8.
  RNA isolation

  • a.
    Extract RNA through a spin column isolation method.

    Note: To isolate RNA, we usually use the RNeasy Mini Kit (Qiagen), but any other kit that allows for a good yield of high-quality RNA can be used.

  • b.
    Perform a reverse transcription to synthesize cDNA.

    Note: To obtain cDNA, we usually reverse transcribe 1 μg/μL of RNA with Maxima First Strand cDNA Synthesis Kit for RT-qPCR (Thermo fisher).⁵ Any other kit which ensures a good efficiency in cDNA synthesis can be used. If the RNA yield is low, reverse transcribe 0.5 μg/μL of RNA.

  • c.
    Perform a qPCR analysis to evaluate the expression of key genes involved in the adipogenesis, e.g., Cebpα (CCAAT/enhancer binding protein), Cebpδ, Cidea (cell death inducing DFFA like effector a), Glut4 (glucose transporter type 4), Lep (leptin), Lpl (lipoprotein lipase), Ppar (peroxisome proliferator-activated receptor) δ, Pparγ, Ppargc1α (Pparg coactivator 1 alpha). RPL (ribosomal protein L) 13a can be used as a housekeeping.

    Note: To perform a qPCR analysis, we usually use Maxima SYBR Green/Fluorescein qPCR Master Mix (2X) with a final concentration of primers of 300nM allowing a good efficiency (e.g, between 90% and 110% ⁶). Any other kit ensuring a good DNA detection and analysis together with a high PCR specificity and sensitivity can be used. It is mandatory to test primer efficiencies before performing the experiments.

    Note: the in vitro adipogenesis is composed by two phases, each of which is characterized by the activation of different genes. Therefore, the day of the differentiation protocol in which to start the co-culture should depends on which stage of adipogenesis needs to be analyzed. Co-culturing activated CD8⁺ T cells at day 6 of the differentiation protocol allows to evaluate the possible effect on the second phase of adipogenesis, by studying the expression of genes such as GLUT4 and LPL (Figure 1).

Expected outcomes

The outcome of the present protocol is to give an in vitro tool to evaluate the potential crosstalk between CD8⁺ T cells, isolated from mice carrying a specific deletion of Slc16a1 in CD8⁺ T lymphocytes, and adipocytes. Indeed, the expression of cellular lactate transporter MCT1 (known as Slc16a1) increases during immune cell activation to cope with the metabolic reprogramming.⁷ During an obesogenic diet, while adipose tissue expands via adipocyte hypertrophy or via the formation of new adipocytes through differentiation of resident precursors,⁸ the accumulation of pro-inflammatory CD8⁺ T cells in metabolic tissues seems to be crucial for the initiation of obesity-induced inflammation.⁹ The evaluation of the effects of activated CD8⁺ T cells on adipogenesis could thus simplify the in vitro study of the immune-adipose tissue axis in both health and pathological conditions, such as obesity. The expected outcome is a downregulation of adipogenic genes driven by CD8⁺ T lymphocytes selectively lacking MCT1.¹

Limitations

This protocol must be interpreted within a series of limitations. We activate CD8⁺ T cells with anti-CD3 and anti-CD28 but this is not the only protocol that can be used. It is interesting to activate T lymphocytes by using PMA and ionomycin. Since this method of activation is stronger, the timing of stimulation before co-culturing CD8⁺ T cells with adipocytes has to be reduced.¹⁰ Moreover, it is important to note that besides NIH-3T3 cells, other cellular models of preadipocytes could be used, such as C3H/10T1/2. In this case, the correct differentiation protocol must be used to obtain mature adipocytes at the end of the experiment.¹¹ Lastly, the entire protocol is set up on animal in vivo and in vitro models. If the effect of human CD8⁺ T lymphocytes on human preadipocytes needs to be investigated, then several technical changes are required.

Troubleshooting

Problem 1

After lysis of erythrocytes with RBC lysis buffer the pellet after centrifugation is still red (step 2b).

Potential solution

Repeat the step. Add again 1 mL of RBC lysis buffer and leave the suspension at 4°C for 5 min. Bring up the suspension to a volume of 10 mL with MACS buffer. Centrifuge the suspension for 5 min at 500 × g and resuspend the pellet with 10 mL of MACS buffer.

Problem 2

Co-culturing NIH-3T3 cells at day 6 of the differentiation with CD8⁺ T lymphocytes does not affect adipogenesis (step 7).

Potential solution

It may be that the effect is not in the last stages of the process but in the first ones. To test whether this hypothesis is correct the co-culture could be started at day (T0) of the differentiation protocol. After 72h the RNA could be collected and the expression of adipogenic genes assessed. In this case an effect is expected on regulators of the early phase of adipogenesis, such as PPARγ.

Resource availability

Lead contact

Massimiliano Ruscica massimiliano.ruscica@unimi.it.

Materials availability

MCT1 mouse lines generated in this study have been deposited to https://www.informatics.jax.org/reference/J:328998.

Data and code availability

For complete details on data and codes, please refer to Macchi et al.¹