Genome transfer technique for bovine embryo production using the metaphase plate and polar body

Abstract

Despite many studies in humans and mice using genome transfer (GT), there are few reports using this technique in oocytes of wild or domestic animals. Therefore, we aimed to establish a GT technique in bovine oocytes using the metaphase plate (MP) and polar body (PB) as the sources of genetic material. In the first experiment, GT was established using MP (GT-MP), and a sperm concentration of 1 × 10⁶ or 0.5 × 10⁶ spermatozoa/ml gave similar fertilization rates. The cleavage rate (50%) and blastocyst rate (13.6%) in the GT-MP group was lower than that of the in vitro production control group (80.2% and 32.6%, respectively). The second experiment evaluated the same parameters using PB instead of MP; the GT-PB group had lower fertilization (82.3% vs. 96.2%) and blastocyst (7.7% vs. 36.8%) rates than the control group. No differences in the amount of mitochondrial DNA (mtDNA) were observed between groups. Finally, GT-MP was performed using vitrified oocytes (GT-MPV) as a source of genetic material. The cleavage rate of the GT-MPV group (68.4%) was similar to that of the vitrified oocytes (VIT) control group (70.0%) and to that of the control IVP group (81.25%, P < 0.05). The blastocyst rate of GT-MPV (15.7) did not differ neither from the VIT control group (5.0%) nor from the IVP control group (35.7%). The results suggested that the structures reconstructed by the GT-MPV and GT-PB technique develop in embryos even if vitrified oocytes are used.

Supplementary Information

The online version contains supplementary material available at 10.1007/s10815-023-02758-3.

Introduction

Female gamete cryopreservation is one of the most powerful strategies for preserving the genetic material of domestic and wild animals. It provides long-term gamete storage for genetic banking and ensures their availability for assisted reproductive technologies. In addition, oocyte cryopreservation plays important roles in basic research and the application of models for genetic preservation and in clinical situations. However, oocytes have very poor cryopreservation success rates which is a major challenge for cryobiology researchers [1–3].

Several oocyte cryopreservation methods have been tested; however, vitrification using the Cryotop technique is the most commonly used method [4–7]. Although this technique produces good results in human and mouse oocytes [3–5], the results remain unsatisfactory in many domestic and wild animals that have a high cytoplasmic lipid content [1, 8–10]. Oocyte cryopreservation is difficult in these species due to its unique characteristics such as the relatively large size, high cytoplasmic water volume, complex and delicate cytoskeleton organization, and abundant cytoplasmic lipid droplets [11]. Several different approaches were attempted to overcome the high sensitivity of oocytes to cryopreservation [12–14]; however, no significant improvement was accomplished. Studies from our laboratory also tried different strategies to improve bovine oocyte cryoresistance. We analyzed the use of methyl-β-cyclodextrin (MβCD) in an attempt to change oocyte plasma membrane composition [15] and used better quality matured in vivo oocytes [16]; however, no improvement was observed in the vitrification response. In addition, oocyte vitrification at different stages of meiosis [8] or exposing oocytes to anti-oxidants and to lipid modulators agents [1, 17] did not improve oocyte cryoresistance. Therefore, new strategies are required to counteract the negative effects of oocyte cryopreservation to guarantee genetic material conservation and subsequent use. The major damages observed in bovine oocytes after vitrification are located at the cytoplasmic level [8]; therefore, one possibility involves nuclear genome removal of a cryopreserved oocyte and transfers to a fresh cytoplasm. This procedure is called genome transfer (GT) and is already being used in humans, rats, monkeys, cats, and cattle [18–26]. The main purpose for using this technology in humans is to prevent the spread of some diseases caused by mitochondrial DNA (mtDNA) mutation or to enable aged or infertile women (for example, due to chemotherapy treatments) to have children [18, 20–22, 24, 27–30].

Genome transfer can be performed by nuclear transfer (NT) techniques using the germinal vesicle (GV), metaphase plate (MP), and polar body (PB) from unfertilized oocytes and the pronucleus (PN) from the zygote [31]. Despite many studies in humans and mice, there are few reports using GT in oocytes of wild or domestic animals. Transfer of the GV from cat oocytes to a fresh cytoplasm matured in vitro resulted in the majority of the reconstructed oocytes resuming meiosis and over 20% completing maturation [19]. These results suggest that it is possible to associate genetic material preservation with the oocyte reconstruction technique. Genome transfer using GV in bovine oocytes has a reduced ability to complete maturation and to develop into embryos [32, 33]. Meanwhile, transfer of the metaphase II plate (including the spindle and chromosomes) of a matured oocyte into the cytoplasm of another enucleated oocyte results in embryos, pregnancies, and birth [25]. However, studies using this technique in domestic animals are very scarce, and using the PB and/or vitrified oocytes are inexistent. Therefore, more research is required to confirm the viability and the safety of the procedure. We aimed to evaluate the use of PBs and metaphase II plates for GT using bovine oocytes as a model and to evaluate the viability of its use in oocytes submitted to cryopreservation. The establishment of GT is an alternative to the use of cryopreserved oocytes from genetically valuable animals or animals at risk of extinction and provides an option for conservation programs.

Materials and methods

Chemicals

All reagents were purchased from Sigma-Aldrich Co. (St Louis, MO, USA); unless, otherwise stated.

Experimental design

Experiment 1: embryo production using oocytes reconstructed by metaphase plate transfer (GT-MP)

We aimed to evaluate if a GT-MP-reconstructed structure develops into embryos. Cumulus oocyte complexes (COCs) were initially matured in vitro, then divided into 3 groups: (1) GT-MP: previously enucleated in vitro matured oocytes reconstructed with the metaphase plate of another oocyte and submitted to parthenogenetic activation (PA); (2) PA control: in vitro matured oocytes submitted to PA; and (3) IVP control: in vitro matured oocytes submitted to in vitro fertilization (IVF). After PA and/or IVP, all the structures were cultured in vitro up to day 7. Cleavage and blastocyst rates were evaluated on day 2 and day 7 of culture, respectively.

After confirming that reconstructed oocytes developed to the blastocyst stage, we evaluated their fertilization by sperm and development after in vitro fertilization (IVF).

The micromanipulated oocyte had a perforated zona pellucida; therefore, we evaluated if sperm concentration affects IVF outcome. Reconstructed oocytes (GT) were divided into 3 groups: (1) GT-MP 1.0: IVF with 1 × 10⁶ spermatozoa (sptz)/ml; (2) GT-MP 0.5: IVF with 0.5 × 10⁶ sptz/ml; (3) IVP control: IVF with 1 × 10⁶ sptz/ml, which is the concentration used in the IVF system in our lab. The structures were fixed for fertilization rate assessment after 18 h of co-incubation with spermatozoa for all groups.

Finally, we evaluated if the reconstructed structures using GT-MP developed into embryos by IVF using 1 × 10⁶ sptz/ml sperm concentration since this sperm concentration did not affect embryo results. Embryo development was compared for the reconstructed oocytes and the control oocytes. Cleavage and blastocyst rates were assessed at day 2 and day 7 of culture, respectively. Approximately 10 blastocysts were stored and sent to a commercial laboratory for paternity testing on day 7 to confirm whether they were produced by IVF or by parthenogenesis due to activation by electrofusion.

Experiment 2: embryo production using oocytes reconstructed by polar body transfer (GT-PB)

This experiment aimed to assess if oocytes submitted to GT were fertilized and develop to the blastocyst stage using the PB as the genetic material. COCs were matured for 21 h, denuded, and selected for the presence of PB. The polar body from a previously matured oocyte was transferred to the cytoplasm of a previously enucleated oocyte. The reconstructed and the non-reconstructed oocytes (control) were fertilized with 1 × 10⁶ sptz/ml for 18 h. The structures were fixed, stained, and assessed for fertilization and polyspermy rates. The two groups were evaluated for embryo development after IVF. Cleavage and blastocyst rates were assessed at day 2 and day 7 of culture, respectively. Approximately 10 embryos were stored and sent to a commercial laboratory for paternity testing on day 7.

Experiment 3: effect of GT micromanipulation on mitochondrial DNA (mtDNA)

This experiment evaluated if GT micromanipulation disturbs the mtDNA copy number. Four groups were used: (1) control: intact oocyte; (2) GT-MP: oocytes submitted to GT with MP; (3) GT-PB: oocytes submitted to GT with PB; and (4) enucleated: oocytes previously enucleated.

To quantify mtDNA copy number by real time PCR, individual micromanipulated oocytes (20 oocytes/group) were stored at −20 °C.

A standard curve was generated for each run using 5 points in 10-fold serial dilutions of the external standard. This allowed the determination of the starting copy number of mtDNA in each sample.

Experiment 4: oocyte embryo development reconstructed by GT-MP using MP of cryopreserved oocyte

The objective of this experiment was to evaluate if the MP of cryopreserved oocytes produce embryos by GT. MII oocytes were vitrified by the Cryotop method and used as the MP donor to obtain GT-MP with fresh cytoplasm. Both groups, (1) GT-MP (reconstructed oocyte), (2) VIT-control: vitrified/warmed MII oocytes, and (3) IVP control, were submitted to fertilization with 1 × 10⁶ sptz/ml. Cleavage and blastocyst rates were assessed at day 2 and day 7 of culture, respectively.

Oocyte recovery, selection, and in vitro maturation (IVM)

Ovaries from crossbred cows (Bos taurus indicus × Bos taurus taurus) were collected at a local slaughterhouse and transported to the laboratory in 0.9% saline (NaCl) solution supplemented with streptomycin sulfate (100 μg/ml) and penicillin G (100 IU/ml) at 35–36 °C. COCs were aspirated from 3 to 8 mm diameter follicles and only COCs with four or more layers of cumulus cells (CC), and homogeneous cytoplasm were used on the experiment. Selected COCs were washed and transferred (30 to 35) to a 200-μl drop of maturation medium covered with silicone oil (Medical Fluid 360 DOW CORNINGR©350 CST-, New York, Canton, USA). The IVM medium consisted of TCM-199 Earl’s salts (Gibco©, Dublin, Leinster, Ireland) supplemented with 10% fetal bovine serum ((FBS) Gibco), 0.01 IU/ml of follicle stimulating hormone (FSH), 0.1 mg/ml L-glutamine, 0.075 mg/ml amikacin, 0.1 M/ml cysteamine, and 0.2 mM sodium pyruvate. The IVM was performed for 18 to 21 h at 38.5 °C and 5% CO₂ in air.

Oocyte preparation for micromanipulation

After maturation, COCs were removed from IVM medium and transferred to tubes containing 1 ml of 0.2% hyaluronidase solution in TCM199 Hank’s salts (Gibco). The COCs were incubated for 5 min at 38.5 °C and 5% CO₂ in air and were vortexed for 3 min for complete removal of the CC. Oocytes were then selected for the presence of PBs and homogeneity of the cytoplasm. Approximately 100 selected oocytes were transferred to a 100-μl drop of IVM medium containing cytochalasin D (2.5 mg/ml) and Hoechst 33342 (1 mg/ml) where they were kept for 30 min at 38.5 °C in 5% CO₂ in air. Then, the oocytes were transferred in groups of five to 30 μl drops of wash medium (LAV) consisting of TCM-199 with Hank’s salts (Gibco) supplemented with 10% FBS, 0.075 mg/mL amikacin, and covered with mineral oil previously prepared for micromanipulation.

Genome transfer (GT) using the metaphase plate (GT-MP) or polar body (GT-PB)

Micromanipulation involved enucleation and recovery of the MP and PB; oocytes were individually fixed to the holding pipette with the PB remaining in the 4 o’clock position. A glass pipette (15–20 μm inner diameter) was used to aspirate the first PB and a small amount of surrounding cytoplasm containing the MP. Only the MP or PB was injected into the perivitelline space of a previously enucleated recipient cytoplasm. The reconstructed structures were transferred to D-mannitol solution (0.28 M) containing 0.1 mM of MgSO₄ and were subjected to electrofusion using a BTX ECM 2001 system (Holliston, Massachusetts, USA). Electrofusion was performed in the fusion chamber by generating 2 electrical pulses of 2.1 kVA/cm and 30 μs duration, followed by oocyte recovery in IVM medium for 30 min. Reconstruction was considered when the portion of the cytoplasm containing the MP was in the recipient cytoplasm while no reconstruction was observed when the cytoplasmic vesicle containing MP remained in the perivitelline space. In the GT-PB group, the PB often ruptured during fusion and became transparent which made visualization difficult. Therefore, confirmation was performed during fertilization evaluation by observing the presence or absence of female chromatin in the stained oocyte.

Parthenogenetic activation (PA)

Activation involved incubating the constructed structures for 5 min in LAV solution containing ionomycin (5 μM) and an additional 4 h in embryo culture medium is supplemented with 2 μM of 6-DMAP (6-dimethylaminopurine). Culture medium used synthetic oviduct fluid (SOFaaci) supplemented with essential and non-essential amino acids, 0.34 mM sodium tri-citrate, 2.77 mM myo-inositol, and 5% FBS (Gibco) [34]. Twenty-thirty denuded oocytes containing a PB and a homogeneous cytoplasm (parthenogenetically activated control group) were submitted to the same activation procedures at the same time.

In vitro embryo production (IVP)

After IVM or GT, COCs were transferred to 200 μl drops of fertilization medium consisting of Tyrode’s medium with albumin lactate and pyruvate (TALP) [35] supplemented with 0.5 mM/ml of penicillamine, 0.25 mM hypotaurine, 25 mM epinephrine, and 10 mg/ml heparin. Frozen semen from the same bull previously tested for in vitro embryo production was used for all treatments and replicates. After thawing, the sperm were selected by Percoll gradient separation [36]. The pellet was resuspended and added in a final concentration of 1 × 10⁶ or 0.5×10⁶ sptz/ml. The oocytes were co-incubated with sperm for 18 h at 38.5 °C and 5% CO₂ in air. The day of insemination was considered as day 0 (D0).

Presumptive zygotes were cultured in 200 μl drops of embryo culture medium and covered with mineral oil for 7 days at 38.5 °C in 5% CO₂ in air. Embryos were assessed for cleavage on day 2 of culture (D2) and for blastocyst formation on D7.

Fertilization rates were assessed by removing presumptive zygotes from culture 18 h after insemination, followed by denuding, fixation for 48 h in ethanol and acetic acid (3:1), and staining with 45% lacmoid in glacial acetic acid according to Cunha et al. (2019). The presumptive zygotes were examined under a Nikon Eclipse E200 phase contrast microscope (×1000) and classified as follows: (a) non-fertilized: presence of female chromatin and absence of male chromatin or (b) fertilized: presence of female and male chromatin in the cytoplasm, a decondensed sperm head, pronuclei, or cleavage; (c) polyspermy: wherein the cytoplasm contains female chromatin and two or more sperm or more than two pronuclei in the fertilized group; (d) abnormal: disorganized or unidentified chromatin.

Oocyte vitrification and warming

Oocyte vitrification and warming were performed as previously described [7] with minor modifications described by Spricigo et al. (2015) [16]. After warming, oocytes were placed in culture dishes for micromanipulation or IVF.

Embryo paternity test

A sample of embryos produced in all experiments was used for a paternity test to ensure that embryos produced by this technique were the product of oocyte-sperm interactions and not the result of a parthenogenic activation process. Embryos and semen used for in vitro fertilization were sent to a commercial laboratory for paternity testing.

mtDNA copy number assays

Quantification of mtDNA copy numbers was performed by real-time PCR using an ABI 7500 HT Fast PCR system (Applied Biosystems). Primers were designed for the mtND1 gene (GenBank accession number NC_006853.1) of the bovine mitochondrial genome (Table 1). A standard curve was generated as described in the paragraph below to determine the absolute quantities of mitochondrial DNA.

Table 1.

Identification of the gene, primer sequences, size of the amplified fragment in base pairs (bp), and GenBank accession number

Gene	Primer sequence (5′–3′)	Amplicon size (bp)	Access number at “GenBank”
ND1 out	F: GGCCGTAGCATTCCTTACGTT	239	NC_006853.1
	R: GAGGATAGGGTATTGGTAGGGGA
ND1 inner	F: CGAAAAGGTCCAAATGTCGT	103	NC_006853.1
	R: CTGAAGATGTAGCGGGTCGT

F, forward; R, reverse; bp, base pair

A genomic DNA sample isolated from bovine blood was submitted to PCR amplification for the MTND1 gene, using ND1 OUT primers (Table 1). The PCR reaction was performed in a total volume of 20 μl comprising 1 × Taq buffer, 1.5 mM MgCl₂, 0.8 mM dNTPs, 1 U Platinum™ Taq polymerase (Invitrogen, CA, USA), 0.5 μM each primer (forward and reverse), and 100 ng genomic DNA. The reactions included an initial denaturation stage of 95 °C for 4 min, followed by 38 cycles at 95 °C for 30 s, 54 °C for 49 s, and 72 °C for 1 min, with a final extension stage at 72 °C for 15 min. The entire PCR reaction volume was subjected to electrophoresis on a 2% agarose gel, and the amplicons were purified from the gel using the Wizard SV Gel and PCR clean-up system (Promega Corporation, Madison, WI, USA) according to the manufacturer’s instructions. Purified amplicons were cloned using the pCR®2.1-TOPO® vector system (Invitrogen, Carlsbad, CA, USA) and transferred to DH5α cells using a heat shock protocol. Plasmid DNA was isolated using the Promega Pureyield^TM Plasmid Miniprep system, and five plasmid samples containing the insert were sequenced using BigDye® cycle sequencing chemistry and an ABI3100 automatic sequencer. After sequencing, the identity of the cloned insert was confirmed with the sequence deposited in the GenBank of the MTND1 gene (accession number AF492351.1). Sequenced plasmid DNA was quantified using the NanoDrop ND-1000 spectrophotometer and serially diluted to generate standard curves for absolute quantification of the number of mtDNA copies.

Twenty oocytes from each treatment were individually analyzed to assess the amount of mtDNA. Total DNA was isolated from each oocyte (n = 20) using the previously described lysis protocol [37]. Briefly, oocytes were lysed in 8 μl of lysis buffer (20 mM Tris, 0.4 mg.mL⁻¹ of proteinase K, 0.9% Triton X-100, and 0.9% Tween 20) at 55 °C for 30 min, followed by 95 °C for 10 min. qPCR was performed using GoTaq® DNA polymerase (Promega) with ND1 INNER primers (Table 1 and Fig. 1). The qPCR conditions involved incubating at 95 °C for 150 s, followed by 40 amplification cycles at 95 °C for 5 s (denaturation), 61 °C for 30 s (annealing), and 72 °C at 30 s (extension). Each qPCR reaction included 0.1 mM of each primer (forward and reverse), 12.5 μl GoTaq mix, and 10 μl DNA in a final volume of 25 μl. Specificity of the qPCR assays was observed by the presence of a single peak in the melting curves.

Fig. 1.

Mitochondrial DNA (mtDNA) copy number quantification using real time quantitative polymerase chain reaction (RT-qPCR) of the control group, genome transfer of the polar body (PB) group, genome transfer of the metaphase plate (MP) group, and the enucleated group. Data were analyzed by the Kruskal-Wallis test (P < 0.05) and are presented as means ± standard deviation

Statistical analysis

Data of fertilization and embryo development were analyzed by the chi-squared test (χ² test). The mtDNA data were compared by the Kruskal-Wallis test. GraphPad Prism software was used for statistical analysis with a P value < 0.05 considered statistically significant for all analyses.

Results

Experiment 1: embryo production using oocytes reconstructed by metaphase plate transfer (GT-MP)

Micromanipulated oocytes were submitted to PA to assess embryo development. The micromanipulated group presented cleavage rates (P < 0.05) and blastocyst rates (P < 0.05) lower than those submitted to PA and the IVP control groups (Table 2). The IVP groups were added as a control of the embryo production system.

Table 2.

Embryo development of oocytes reconstructed by genomic transfer of the metaphase plate (GT-MP) submitted to parthenogenetic activation (PA) and to in vitro embryo production (IVP-control)

Treatments	Oocytes n	Cleavage on D2 n (%)	Blastocyst on D7 n (%)
GT-MP (PA)	101	64 (63.4)a	19 (18.8)a
PA	141	117 (83.0)b	65 (46.1)b
IVP control	204	164 (80.4)b	79 (38.7)b

^{a, b}Different letters in the same column indicate significant difference by chi-square test (P < 0.05)

Effect of sperm concentration on embryo development of GT-MP reconstructed oocytes

Reconstructed structures showed a lower fertilization rate (P < 0.05) compared to the IVP control. Reconstructed structures showed a lower fertilization rate (P < 0.05) compared to the IVP control regardless of the sperm concentration used (Table 3). However, the sperm concentration did not affect the fertilization rate nor the polyspermy rate among all treatments (P > 0.05, Table 3). Therefore, a concentration of 1 × 10⁶ sptz/ml was chosen for all other experiments, and this concentration is routinely used in our lab.

Table 3.

Percentage of fertilized, non-fertilized, polyspermic, and abnormal oocytes submitted to genome transfer of the metaphase plate (GT-MP) inseminated with different sperm concentrations (1 × 10⁶ and 0.5 × 10⁶ sptz/ml) compared to the in vitro produced (IVP control group inseminated with 1 × 10⁶ sptz/ml)

Treatments	Oocytes n	Fertilized n (%)	Non-fertilized n (%)	*Polispermic n (%)	Abnormal n (%)
GT-MP 1 × 106	64	30 (46.9)b	32 (50)b	11 (17.2)	2 (3.1)
GT-MP 0.5 × 106	64	29 (45.3)b	32 (50)b	11 (17.5)	3 (4.7)
IVP control	93	70 (75.3)a	19 (20.4)a	17 (18.5)	4 (4.3)

^{a, b}Different letters in the same column indicate difference by chi-square test (P < 0.05)

*Polispermic oocytes were those fertilized in which the cytoplasm contained female chromatin and two or more sperm head or two or more male pronuclei

Embryo development of the micromanipulated group (GT-MP) showed that both cleavage and blastocyst rates in the GT-MP group were lower (P < 0.05) than that in the IVP control group (Table 4).

Table 4.

Embryo development of oocytes reconstructed by genomic transfer of the metaphase plate (GT-MP) submitted to in vitro production (IVP) compared to the IVP control group

Tratamento	Oocytes n	Fused n	Cleavage on D2 n (%)	Blastocyst on D7 n (%)
GT-MP	402	154 (38.3)a	77 (50)a	21 (13.6)a
IVP control	433	-	355 (82)b	151 (34.9)b

^{a, b}Different letters in the same column indicate significant difference by chi-square test (P < 0.05)

The DNA of 10 embryos send to paternity test all were a matched to the DNA of the bull used for the IVF, which confirmed that embryos were not parthenogenetics.

Experiment 2: embryo production using oocytes reconstructed by polar body transfer (GT-PB)

Reconstructed oocytes had a lower fertilization rate (P < 0.05) compared to the IVP control group; however, the rate of polyspermy and abnormal oocytes was similar among all treatments (P > 0.05, Table 5). The cleavage rate was similar between groups (P > 0.05), while the blastocyst rate in the GT-PB group was lower than that in the IVP group (P < 0.05, Table 5). Embryo development of the GT-PB group and the control group (IVP) is shown in Table 6.

Table 5.

Percentage of fertilized, non-fertilized, polyspermic, and abnormal oocytes submitted to genome transfer of polar bodies (GT-PB), compared to the in vitro produced (IVP) control group

Treatments	Oocytes n	Fertilized n (%)	Non-fertilized n (%)	*Polispermic n (%)	Abnormal n (%)
GT-PB	62	51 (82.3)b	10 (16.1)a	8 (12.9)	0 (0.0)
IVP control	132	127 (96.2)a	4 (3.1)b	16 (12.1)	1 (0.8)

^{a, b}Different letters in the same column indicate significant difference by chi-square test (P < 0.05)

*Polispermic oocytes were those fertilized in which the cytoplasm contained female chromatin and two or more sperm head or two or more male pronuclei

Table 6.

Embryo development of oocytes reconstructed by genomic transfer of the polar body (GT-PB) and those submitted to in vitro production (IVP)

Treatments	Oocytes n	Fused n	Cleavage on D2 n (%)	Blastocyst on D7 n (%)
GT-PB	59	26 (44.1)	23 (88.5)	2 (7.7)a
IVP control	95	-	81 (85.3)	35 (36.8)b

^{a, b}Different letters in the same column indicate significant difference by chi-square test (P < 0.05)

Experiment 3: effect of GT on the quantification mitochondrial DNA (mtDNA)

Mitochondrial DNA (mtDNA) copy numbers did not differ amongst the groups.

Experiment 4: embryo development of oocytes reconstructed by GT-MP using the MP of cryopreserved oocytes

The MP of vitrified oocytes (V) were used to reconstruct oocytes by GT using cytoplasm from fresh oocytes as the recipients (GT-MPV). Cleavage rates were lower in the GT-MPV group than that in the vitrified group (P < 0.05), and the percentage of those that reached the blastocyst stage was higher in the GT-MPV group than that of the vitrified control (VIT Control) (P < 0.05, Table 7).

Table 7.

Embryo development of oocytes reconstructed by transferring the metaphase plate from vitrified oocytes to fresh cytoplasm (GT-MPV) compared to embryo development of vitrified oocytes (VIT control) and fresh oocytes (IVP control)

Treatments	Oocytes n	Fused n	Cleavage on D2 n (%)	Blastocyst on D7 n (%)
GT-MPV	36	19	13 (68.4)a	3 (15.7)a, b
VIT control	20		14 (70.0)a	1 (5.0)b
IVP control	28		25 (89.3)a	10 (35.7)a

^{a, b}Different letters in the same column indicate significant difference by chi-square test (P <0.05)

Discussion

Oocytes from various mammalian species, particularly those with a high cytoplasmic lipid content, are extremely sensitive to cooling. Much effort was made to decrease cryopreservation damage using several strategies; however, no significant improvement was achieved [8, 15–17, 38–41]. Most of the damage caused by cryopreservation occurs in the cytoplasm [16]. Therefore, transferring the genome to a fresh/intact cytoplasm may overcome some of the difficulties in forming female germplasm banks. Thus, we evaluated the possibility of producing in vitro embryos using either MP and/or PB for GT.

The first experiment evaluated GT using the MP as genetic material. There are few reports using GT-MP in cattle; therefore, PA was performed to verify whether the reconstructed structures develop into embryos using our system. Reconstructed structures developed embryos albeit at lower rates of cleavage and blastocyst development compared to the control. Human and mice embryo development using oocytes reconstructed with the MP and parthenogenetically activated was similar between reconstructed and control oocytes [20, 22, 42]. Our blastocyst rate was below than that of other species; however, the rate is acceptable, especially considering that the focus is rare germplasm multiplication present in germplasm banks.

Our next step evaluated the behavior of GT-MP oocytes subjected to IVF. The intracytoplasmic sperm injection (ICSI) for fertilization in bovines differs from other mammalian species because it is not a well-established technique and has lower efficiency than those reported for IVF [43]. Then, IVF and not ICSI has to be used to produce embryos after GT. The main concern with fertilization following micromanipulation was the damage of the zona pellucida which could affect the polyspermy block. The majority of reports using GT utilize ICSI [21, 27, 30, 44], although there is no indication regarding the optimal sperm concentration. We tested two different concentrations for IVF of GT-MP: 1 × 10⁶ sptz/ml, which is routinely used in an IVF lab, and 0.5 × 10⁶ sptz/ml. The fertilization rate was lower in the reconstructed group than that of the IVP control group; however, different sperm concentrations did not affect the fertilization rate or polyspermy rate. We chose to use 1 × 10⁶ sptz/ml in the other experiments; however, the information that reduced sperm concentration can be used without affecting fertilization is very relevant when semen samples are limited or scarce. It seems that the rupture of the zona pellucida during micromanipulation does not affect polyspermy block but may affect other oocyte features that impair fertilization.

Oocyte GT-MP embryos developed to the blastocyst stage after IVF despite the lower rates of cleavage and blastocyst formation compared to the control. Similar results were reported in studies with human and primate oocytes submitted to GT-MP, which also showed reduced blastocyst formation after ICSI [21, 27]. Recently, decreased bovine embryo development was observed after GT-MP using IVF [25]. Reduced embryo production is possibly due to damage caused by micromanipulation and/or electrofusion since zona cutting reduces embryo development [25]. Paternity testing confirmed that the embryos produced by GT-MP originated from the IVP process, not parthenogenesis.

In the second experiment, PB was the source of genetic material for GT. Micromanipulation induced a reduction in the fertilization rate, but there was no change in polyspermy which was similarly to the GT-MP results. These results reinforced the idea that zona pellucida disturbance does not necessarily disrupt polyspermy block [45]. The large number of oocytes needed to perform GT-MP and GT-PB meant that the first and second experiments were carried out at different times. Despite this, lower embryo production was observed in GT groups compared to IVP control group and in GT-PB group compared with the GT-MP group. GT-PB is less aggressive, but when reconstruction, the oocyte with MP additional cytoplasm may be transferred into the receptor cytoplasm which justifies the apparently improved GT-MP result. It is possible that additional cytoplasm may replace some of the cytoplasm that was lost during enucleation.

No differences were observed in mtDNA copy numbers between the treatments. This corroborated previous literature using this technique to prevent the inheritance of mtDNA mutations by the progeny [21, 22, 24, 28–30]. The results rejected our hypothesis that the MT content of the reconstructed oocyte would differ when MP and PB were used for GT. The main basis for the hypothesis was that a portion of the cytoplasm was removed with the MP and introduced into the receptor which did not occur when the PB was used.

Finally, we evaluated the possibility of producing embryos from reconstructed oocytes using genetic material from vitrified oocytes. We chose the MP of the vitrified oocytes as the genetic material donor. Our results showed that it is possible to produce embryos by GT using the MP of vitrified oocytes. The similar blastocyst rate of the vitrified GT compared to the vitrified control does not allowed us to confirm our hypothesis that GT-MP allows the replacement of the damaged cytoplasm with fresh cytoplasm and enables zygote production with high developmental capacity. However, embryo production was also similar to the IVP control, which suggested that maybe we should not ignore it completely. It is important to point out that number of oocytes used was small, and therefore, more data are needed to confirm this finding.

Even though this study was carried out on cattle, it has a wide application for the preservation of wild or endangered animals. Although more studies are required using cryopreserved oocytes, the results offer the possibility to better utilize the genetic material already stored in the germplasm bank for the future use of female gametes. It also offers the possibility to use this technique in cattle as a study model to evaluate new biotechnologies for humans. Finally, it represents a new tool to study cytoplasm-nucleus interactions and for other basic research.

Declarations

Conflict of interest

The authors declare no competing interests.