Bisphenol A induces testicular oxidative stress in mice leading to ferroptosis

Abstract

Bisphenol A is a common environmental factor and endocrine disruptor that exerts a negative impact on male reproductive ability. By exploring bisphenol A-induced testicular cell death using the Institute of Cancer Research (ICR) mouse model, we found that a ferroptosis phenomenon may exist. Mice were divided into six groups and administered different doses of bisphenol A via intragastric gavage once daily for 45 consecutive days. Serum was then collected to determine the levels of superoxide dismutase and malondialdehyde. Epididymal sperm was also collected for semen analysis, and testicular tissue was collected for ferritin content determination, electron microscope observation of mitochondrial morphology, immunohistochemistry, real-time quantitative polymerase chain reaction, and western blot analysis. Exposure to bisphenol A was found to decrease sperm quality and cause oxidative damage, iron accumulation, and mitochondrial damage in the testes of mice. In addition, bisphenol A was confirmed to affect the expression of the ferroptosis-related genes, glutathione peroxidase 4 (GPX4), ferritin heavy chain 1 (FTH1), cyclooxygenase 2 (COX2), and acyl-CoA synthetase 4 (ACSL4) in mouse testicular tissues. Accordingly, we speculate that bisphenol A induces oxidative stress, which leads to the ferroptosis of testicular cells. Overall, the inhibition of ferroptosis may be a potential strategy to reduce male reproductive toxicity caused by bisphenol A.

INTRODUCTION

Environmental factors are the main causes of annual declines in male fertility. Among these factors, bisphenol A (BPA) is the most common and main type of endocrine disruptor.1 BPA is widely used to synthesize materials such as polycarbonate and epoxy resin. As a result, BPA is ubiquitous in food containers, paper products, water pipes, toys, medical equipment, and electronic products.2 Several studies have confirmed that BPA can act on the male reproductive system, ultimately affecting reproductive ability and increasing infertility.3,4,5 BPA can cause adverse effects in testicular tissues, such as decreased testicular weight, decreased epididymal sperm concentration, decreased serum testosterone, and altered sperm morphology.6 Studies have confirmed that male reproductive toxicity caused by BPA is primarily due to a large reduction in the number of testicular cells.7,8 However, the detailed mechanism whereby BPA induces testicular cell death remains unclear.

Ferroptosis is a newly discovered form of iron-dependent cell death in mammalian cells.9 The main effect of ferroptosis is oxidative damage, which is primarily caused by mitochondrial changes due to the excessive accumulation of iron ion-dependent lipid peroxidation products.10 The morphological, biochemical, and genetic characteristics of iron-dependent cell death significantly differ from those of other classical forms of cell death, such as autophagy, necrosis, and apoptosis. Morphologically, ferroptosis is primarily associated with constricted mitochondrial membrane; increased membrane density; blurred, reduced, or disappeared mitochondrial cristae; and ruptured outer membrane.11 Biochemically, the concentration of iron ions increases, a large amount of reactive oxygen species (ROS) is produced, the activity of glutathione peroxidase 4 (GPX4) decreases, and lipid metabolites accumulate.12 Ferroptosis has recently received considerable attention as it is believed to be involved in many pathophysiological processes. Several small molecules, compounds, or drugs can induce ferroptosis in different types of cells.13 Based on increasing evidence, BPA primarily induces testicular cell death through apoptosis,14 necrosis,15 or autophagy;7 however, whether BPA can induce testicular cell death through ferroptosis remains unclear.

In this study, we aimed to determine the mechanism of testicular cell death induced by BPA using an animal model. Overall, our findings aim to provide new insights into the mechanism of BPA toxicity in male reproduction and consequently identify a potential target for the treatment or prevention of BPA-induced male reproductive toxicity.

MATERIALS AND METHODS

Experimental animal

Sixty healthy 8-week-old specific pathogen-free Institute of Cancer Research (ICR) male mice (weight: 20–25 g) were purchased from the Experimental Animal Center of Shanghai University of Traditional Chinese Medicine (Shanghai, China). Animals were provided food and water ad libitum. The conditions of ambient temperature (24°C ± 3°C) and humidity (50% ± 5%) were controlled and maintained under a 12-h light/dark cycle. All experimental procedures involving animals were performed in accordance with NIH guidelines and were approved by the Experimental Animal Ethics Committee of Shanghai University of Traditional Chinese Medicine (approval No. PZSHUTCM200814023).

Establishment of the mouse model

After adaptive rearing, ICR male mice were randomly divided into six groups: A, B, C, D, E, and F, with 10 mice in each group. Mice in groups A, B, C, D, E, and F received BPA (Sigma-Aldrich, St. Louis, MI, USA; dissolved in pure olive oil to generate six doses) at 0, 5 mg per kg body weight (mg kg⁻¹ bw), 10 mg kg⁻¹ bw, 50 mg kg⁻¹ bw, 100 mg kg⁻¹ bw, and 200 mg kg⁻¹ bw, respectively. Each group was administered their corresponding dose via intragastric gavage once daily for 45 days. Mice were euthanized after treatment with BPA. Thereafter, samples were collected according to the experimental requirements, and follow-up experiments were conducted. The body weight, testis weight, and body length of mice were measured. LEE’s index, which is an estimation of body fat in mice, was calculated using the formula body weight (g 0.33)/nasoanal length (mm).16 Relative organ weight was calculated by dividing organ weight by body weight.

Epididymal sperm analysis

The epididymal tails of mice in each group were cut into small pieces, placed in 0.5 ml G-IVF PLUS solution (Vitrolife Sweden AB, Goteborg, Sweden), and prewarmed at 37°C for 30 min. The upper suspension was used to obtain the epididymal sperm. The sperm suspension (20 μl) was added dropwise to a Makler counting plate and analyzed using a computer-assisted sperm analysis (CASA) system (Beijing Weili Co., Ltd., Beijing, China). Ten fields of view were captured for each sample to determine sperm concentration and viability. Another droplet of the diluted sperm suspension was dropped onto a glass slide and push-piece. After drying, the modified Papanicolaou staining procedure was performed, and the sperm morphology was observed using an oil microscope to determine the rate of morphological abnormalities. For the evaluation method, 200 spermatozoa were observed in continuous field of view. Thereafter, the number of abnormal spermatozoa was recorded, and the percentage was calculated.

Analysis of serum and testis tissue malondialdehyde (MDA) and superoxide dismutase (SOD) levels

Blood was centrifuged at 1000g for 10 min (Eppendorf, Hamburg, Germany) after collection from the mouse orbit. Serum was then stored in a cryogenic refrigerator for future use. Fresh testicular tissue (20 mg) was accurately weighed with an electronic balance and added to 200 μl of distilled water. The samples were then homogenized on ice and centrifuged at 200g for 10 min at 4°C. Finally, the supernatant was aspirated for use. According to the mouse MDA (Zhenke Biotechnology Co., Ltd., Shanghai, China) and SOD (Fuyuan Biotechnologies Co., Ltd., Fuzhou, China) enzyme-linked immunosorbent assay (ELISA) kit instructions, standard products were prepared, and the serum and supernatant were added to a 96-well microtiter plate. After incubation, washing, and color development, the absorbance was measured at 580 nm using a microplate instrument (Thermo Multiskan FC, Waltham, MA, USA). Finally, the concentrations of MDA and SOD in the serum and supernatant were calculated.

Determination of ferritin content in testicular tissues

Mouse testicular tissue (approximately 30 mg) was added to 300 μl of saline. The samples were then homogenized on ice and centrifuged at 200g for 10 min at 4°C. Following collection of the supernatant, standard products were prepared according to the instructions of the BSA kit (Beyotime Biotechnology Co., Ltd., Shanghai, China), and added to a 96-well microtiter plate. After incubation at 37°C for 30 min, the absorbance was measured at 562 nm to calculate the protein concentration. The cells were processed according to the operating procedure of the mouse ferritin ELISA kit (Zhenke Biotechnology Co., Ltd.). A microplate (Thermo Multiskan FC) was then used to measure the absorbance at a wavelength of 580 nm. Finally, ferritin concentration was calculated.

Immunohistochemical analysis

After fixing with neutral formalin and paraffin embedding, the testicular tissues were sectioned. Thereafter, routine dewaxing and rehydration procedures were performed. For antigen retrieval, the slides were heated in citrate buffer (pH 6.0) at 98°C for 30 min and allowed to cool naturally. After endogenous peroxidase inactivation and nonspecific antigen blocking, the sections were incubated with primary antibodies, GPX4 (1:200, Proteintech, Sanying Biotechnology Co., Ltd., Wuhan, China), cyclooxygenase 2 (COX2; 1:200, Proteintech), ferritin heavy chain 1 (FTH1; 1:200, Proteintech), and acyl-CoA synthetase 4 (ACSL4; 1:100, Santa Cruz Biotechnology Inc., Dallas, TX, USA), overnight at 4°C. The negative control sections were incubated with phosphate-buffered saline (PBS) instead of a primary antibody. The slides were rinsed with PBS and incubated with horseradish peroxidase (HRP)-labeled secondary antibody for 30 min at 25°C. The slides were then developed with diaminobenzidine for 15 min after washing with PBS. After counterstaining with hematoxylin for 30 s, the sections were dehydrated and mounted. Images were acquired using a microscope (Olympus BX53, Olympus, Tokyo, Japan) equipped with a digital camera (Olympus DP73, Olympus). The tan area indicates positive expression, and the “density (mean)” of the average staining intensity was acquired using Image-Pro Plus version 6.0 (Media Cybernetics, Inc., Bethesda, MD, USA).

Observation of mitochondrial morphology

The tissues were cut into 1 mm3 sections on ice, placed in 2.5% glutaraldehyde, and stored at 4°C. The sections were dehydrated in acetone and ethanol gradients and then embedded in paraffin. Ultra-thin sections of 70-nm thickness were prepared and stained with lead citrate. Finally, mitochondrial morphology, quantity, and ultrastructure were evaluated using transmission electron microscopy (FEI Tecnai G2 spirit; Thermo Fisher Scientific, Waltham, MA, USA).

Real-time quantitative polymerase chain reaction (RT-qPCR)

The testicular tissue was washed with cold PBS, and total RNA was extracted with TRIzol reagent (BBI, Sangon Biotech Co., Ltd., Shanghai, China). Total RNA was quantified using a Nanodrop 2000 (Thermo Fisher Scientific). Reverse transcription of 1 μg total RNA was performed using the first-strand cDNA synthesis kit (Takara Bio Inc., Beijing, China). SYBR® TB Green Premix Ex Taq (Takara Bio Inc.) was used to perform RT-qPCR to detect the expression levels of GPX4, COX2, FTH1, and ACSL4. All primers (Table 1) were designed and synthesized by Shanghai Sangon Biological Co., Ltd., Shanghai, China. The relative expression of the target genes was normalized to the average glyceraldehyde-3-phosphate dehydrogenase (GAPDH) level. The expression level of the target gene was calculated using the 2^−ΔΔCt method.

Table 1.

Primer sequences for real-time quantitative polymerase chain reaction

Gene	Primer sequences (5’–3’)	Amplicon size (bp)
m-GAPDH	Forward: AGGTCGGTGTGAACGGATTTG	123
	Reverse: TGTAGACCATGTAGTTGAGGTCA
m-GPX4	Forward: GATGGAGCCCATTCCTGAACC	185
	Reverse: CCCTGTACTTATCCAGGCAGA
m-FTH1	Forward: CAAGTGCGCCAGAACTACCA	122
	Reverse: GCCACATCATCTCGGTCAAAA
m-COX2	Forward: CATGAGCCGTCCCCTCACTAGG	83
	Reverse: TGGTCGGTTTGATGCTACTGTTGC
m-ACSL4	Forward: CTCACCATTATATTGCTGCCTGT	114
	Reverse: TCTCTTTGCCATAGCGTTTTTCT

m: mouse; GPX4: glutathione peroxidase 4; FTH1: ferritin heavy chain 1; ACSL4: acyl-CoA synthetase 4; COX2: cyclooxygenase 2; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; bp: base pair

Western blot analysis

The samples were lysed on ice, and total protein was extracted. Thereafter, the extracted supernatants were diluted appropriately. Protein concentrations were determined using a bicinchoninic acid protein assay kit (Thermo Fisher Scientific). Equal amounts of protein samples were electrophoresed using 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene fluoride membranes (PVDF; Millipore, Waltham, MA, USA). The membranes were blocked with 5% dry milk in Tris-buffered saline with Tween-20 (TBST) for 2 h at room temperature and incubated overnight at 4°C with the primary antibodies. Following incubation, the membranes were probed with a secondary antibody at room temperature for 1 h, and protein bands were visualized using a GE Amersham Imager 600 machine (GE Healthcare Bio-Sciences Corp., Piscataway, NJ, USA). GAPDH (1:2000, Proteintech), GPX4 (1:2000, Proteintech), COX2 (1:2000, Proteintech), FTH1 (1:1000, Proteintech), and ACSL4 (1:800, Santa Cruz Biotechnology Inc.) were the antibodies used in this procedure.

Statistical analyses

Data were statistically analyzed using SPSS version 21.0 (IBM, Armonk, NY, USA). These are presented as the mean ± standard deviation (s.d.). The differences between groups were determined using one-way analysis of variance (ANOVA), and pairwise comparisons were performed using the least significant difference method. Statistical significance was set at P < 0.05.

RESULTS

BPA exposure decreases mouse sperm quality

The effects of BPA on mouse testes and sperm were analyzed. Each experimental group exhibited different degrees of decline in testicular weight and testicular organ coefficient compared with that in group A (control group). However, only the decrease in groups E and F (100 mg kg⁻¹ bw and 200 mg kg⁻¹ bw, respectively) was statistically significant (P < 0.05; Figure 1a). The sperm concentration of groups E and F decreased significantly (P < 0.05), and the sperm motility of groups C–F decreased significantly (all P < 0.05), whereas the deformity rate of groups B–F significantly increased (all P < 0.05) compared to that of group A (Figure 1b). Abnormal sperm with head deformities, curled tails, and docked tails and headless sperm were also observed in all the BPA exposure groups (Figure 1c). Overall, these results were found to be directly proportional to the increase in BPA dosage (Figure 1b). However, through careful observation of each slide, we found no significant difference in the type of sperm deformity among the groups.

Figure 1.

BPA exposure decreased mouse sperm quality. Mice in groups A, B, C, D, E, and F received BPA at 0, 5 mg kg⁻¹ bw, 10 mg kg⁻¹ bw, 50 mg kg⁻¹ bw, 100 mg kg⁻¹ bw, and 200 mg kg⁻¹ bw, respectively. (a) Comparisons of LEE’s index, testicular weight, and testicular organ coefficient among the groups. (b) Comparisons of sperm concentration, sperm motility, and morphological deformity rate among the groups. (c) Abnormal sperm of the mice with head deformities, curled tails, docked tails, and headless sperm. Red arrows point to the morphological abnormal sperm. Scale bars = 10 µm. Values are expressed as the mean ± s.d. of three independent experiments. ^*Significantly different from the control group (P < 0.05). BPA: bisphenol A; bw: body weight; s.d.: standard deviation.

BPA exposure causes oxidative damage, testicular iron accumulation, and testicular mitochondrial damage in mice

We determined the concentrations of MDA and SOD in mouse serum and testis to determine the cause of the decrease in sperm quality after BPA exposure. In serum, each experimental group demonstrated a significant decrease in SOD concentration and a significant increase in MDA concentration compared to that in group A (all P < 0.05); however, these results did not correlate with the increase in BPA dosage (Figure 2a). In the testis, as BPA concentration increased, MDA levels in each experimental group gradually increased, whereas SOD levels gradually decreased. Compared with that in the control group, MDA levels in groups D–F were significantly increased, whereas SOD levels in groups C–F were significantly decreased (all P < 0.05; Figure 2b). To further determine the oxidative damage in the testes, transmission electron microscopy was employed to observe the ultrastructure of the testicular cells. The number of mitochondria in the testicular cells increased. In fact, the cells were evidently damaged. The mitochondrial membrane was pyknotic with increased density, the mitochondria were swollen and rounded, the mitochondrial cristae were broken or absent, and the outer membrane was ruptured (Figure 2c). These damages occurred in spermatogenic cells in a BPA dose-dependent manner (Figure 2c). The mitochondrial damages observed in these testicular cells were similar to the typical morphological changes caused by ferroptosis.11,12 To further confirm these observations, we determined the iron concentration in the testicular tissue. Based on the results, ferritin level in the testes of each model group significantly increased compared with that in the control group (all P < 0.05; Figure 2d).

Figure 2.

BPA exposure caused oxidative damage, testicular iron accumulation, and testicular mitochondrial damage in mice. Mice in groups A, B, C, D, E, and F received BPA at 0, 5 mg kg⁻¹ bw, 10 mg kg⁻¹ bw, 50 mg kg⁻¹ bw, 100 mg kg⁻¹ bw, and 200 mg kg⁻¹ bw, respectively. (a) Comparisons of serum MDA and SOD concentrations among the groups. (b) Comparisons of testicular tissue MDA and SOD concentrations among the groups. (c) The ultrastructure of testicular mitochondria in the groups. Scale bars = 2 µm. (d) Comparisons of ferritin levels in the testicular tissue among the group. Values are expressed as the mean ± s.d. of three independent experiments. ^*Significantly different from the control group (P < 0.05). BPA: bisphenol A; bw: body weight; s.d.: standard deviation; MDA: malondialdehyde; SOD: superoxide dismutase.

BPA exposure affects the mRNA expression of GPX4, FTH1, COX2, and ACSL4 in mouse testes

The pathological damage in the testicular cells and the decrease in sperm quality in mice exposed to BPA may be related to oxidative stress-induced ferroptosis. Therefore, RT-qPCR was performed to determine the mRNA expression levels of the ferroptosis-related indicators, GPX4, FTH1, COX2, and ACSL4, in the testicular tissue. Compared to the levels in the control group, the mRNA expression levels of GPX4 in the experimental groups were significantly reduced (all P < 0.05), whereas that of FTH1 significantly decreased in groups C–E (all P < 0.05; Figure 3). In addition, compared to the levels in the control group, the COX2 mRNA expression levels in groups D and E significantly increased (both P < 0.05), whereas that of ACSL4 mRNA significantly increased in almost all experimental groups (except group F; all P < 0.05; Figure 3).

Figure 3.

BPA exposure affected the mRNA expression of GPX4, FTH1, COX2, and ACSL4 in mouse testes. Mice in groups A, B, C, D, E, and F received BPA at 0, 5 mg kg⁻¹ bw, 10 mg kg⁻¹ bw, 50 mg kg⁻¹ bw, 100 mg kg⁻¹ bw, and 200 mg kg⁻¹ bw, respectively. mRNA expression of GPX4, FTH1, COX2, and ACSL4. Values are expressed as the mean ± s.d. of three independent experiments. ^*Significantly different from the control group (P < 0.05). BPA: bisphenol A; bw: body weight; s.d.: standard deviation; GPX4: glutathione peroxidase 4; FTH1: ferritin heavy chain 1; ACSL4: acyl-CoA synthetase 4; COX2: cyclooxygenase 2.

BPA exposure affects the protein expression of GPX4, FTH1, COX2, and ACSL4 in mouse testes

The biological function of a gene is usually elucidated via its protein expression level. Therefore, we proceeded to verify the protein expression levels of the ferroptosis-related indicators, GPX4, FTH1, COX2, and ACSL4 using western blot. The changes in the expression levels of these indicators were found to be basically consistent with the PCR results. The protein expression levels of GPX4 in groups D and E, and of FTH1 in groups C–E, were significantly lower than those in group A (all P < 0.05; Figure 4a and 4b). Compared with the levels in group A, the protein expression levels of COX2 in groups C–E, and of ACSL4 in groups E and F, were significantly increased (all P < 0.05; Figure 4a and 4b). The combined results of RT-qPCR and western blot indicate that the expression levels of ferroptosis-related indicators in mouse testicular tissue are affected by BPA exposure, especially the tissue of mice in group E.

Figure 4.

BPA exposure affected the protein expression of GPX4, FTH1, COX2, and ACSL4 in mouse testes. Mice in groups A, B, C, D, E, and F received BPA at 0, 5 mg kg⁻¹ bw, 10 mg kg⁻¹ bw, 50 mg kg⁻¹ bw, 100 mg kg⁻¹ bw, and 200 mg kg⁻¹ bw, respectively. (a) GPX4, FTH1, COX2 and ACSL4 levels were detected by western blot. (b) Protein band intensity was normalized to GAPDH. Values are expressed as the mean ± s.d. of three independent experiments. ^*Significantly different from the control group (P < 0.05). BPA: bisphenol A; bw: body weight; s.d.: standard deviation; GPX4: glutathione peroxidase 4; FTH1: ferritin heavy chain 1; ACSL4: acyl-CoA synthetase 4; COX2: cyclooxygenase 2; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.

Expression and localization of GPX4, FTH1, COX2, and ACSL4 in mouse testicular tissues after exposure to BPA

Finally, immunohistochemical staining was performed to locate the expression of the ferroptosis-related indicators GPX4, FTH1, COX2, and ACSL4 in the testicular tissues. In group A, GPX4, FTH1, and COX2 were primarily expressed in spermatogenic cells, whereas ACSL4 was primarily expressed in interstitial cells. After exposure to BPA, the expression levels of GPX4 and FTH1 were significantly reduced (all P < 0.05), whereas those of COX2 and ACSL4 were significantly increased (all P < 0.05), especially in groups D–F (Figure 5). This finding was mostly consistent with the results of RT-qPCR and western blot.

Figure 5.

Expression and localization of GPX4, FTH1, COX2, and ACSL4 in mouse testicular tissues after exposure to BPA. Mice in groups A, B, C, D, E, and F received BPA at 0, 5 mg kg⁻¹ bw, 10 mg kg⁻¹ bw, 50 mg kg⁻¹ bw, 100 mg kg⁻¹ bw, and 200 mg kg⁻¹ bw, respectively. The column “PBS” represents the negative control result of staining with PBS instead of the primary antibody. The tan area indicates positive expression. “Density (mean)” of the average staining intensity was acquired using Image-Pro Plus 6.0. Scale bars = 50 µm. Values are expressed as the mean ± s.d. of three independent experiments. ^*Significantly different from the control group (P < 0.05). BPA: bisphenol A; bw: body weight; s.d.: standard deviation; GPX4: glutathione peroxidase 4; FTH1: ferritin heavy chain 1; ACSL4: acyl-CoA synthetase 4; COX2: cyclooxygenase 2.

DISCUSSION

Ferroptosis is a new form of cell death with unique morphological, biochemical, and genetic manifestations. The main cause of ferroptosis is oxidative damage, which is primarily induced by mitochondrial changes due to the excessive accumulation of iron-dependent lipid peroxidation products.10 A recent study has shown that BPA can cause iron accumulation in the liver and spleen of rats, thereby inducing chronic poisoning.17 However, whether BPA can affect the testes through ferroptosis is still unknown. Therefore, in this study, different concentrations of BPA were administered to healthy mice to assess the possible effects of BPA in their testes. The sperm concentration and quality of mice were significantly reduced after exposure to BPA. In addition, BPA exposure caused oxidative damage, iron accumulation, and abnormal structural changes in the mitochondria and affected the expression of ferroptosis-related indicator proteins, especially the 100 mg kg⁻¹ bw BPA intervention. Collectively, these results indicate that BPA induces oxidative stress, leads to iron deposition, and causes cell death in mouse testes. Our findings provide a new direction for the treatment of BPA-induced male reproductive toxicity, which involves the inhibition of iron deposition.

Ferroptosis is a type of programmed cell death discovered by Dolma et al.18 who found that erastin, a small molecule compound, induced the death of human foreskin fibroblasts with Ras oncogene mutations. The use of inhibitors of apoptosis, necrosis, autophagy, and pyrolysis cannot reverse cell death caused by erastin and the glutathione peroxidase inhibitor, RAS-selective lethal 3 (RSL3); however, antioxidants (vitamin E) and iron chelators (deferoxamine) can reverse this cell death. In 2012, Dixon et al.9 named the cell death mode induced by erastin that has its unique morphological, genetic, and biochemical characteristics as ferroptosis. Ferroptosis is not a specific phenomenon of a certain organ but exists in the pathophysiological process of many diseases.13 In tumor diseases, inducing cell ferroptosis can kill tumor cells, which is a novel cancer treatment strategy. In neurodegenerative diseases, inhibiting cell ferroptosis can delay disease progression.19,20 Ferroptosis is also involved in myocardial ischemia and reperfusion injury.21 In this study, the sperm concentration, testicular weight, and testicular organ coefficient were significantly reduced in mice in the 100 mg kg⁻¹ bw and 200 mg kg⁻¹ bw BPA treatment groups (Figure 1a and 1b). This finding indicates that the main effect of BPA toxicity in male reproduction may be a decrease in the number of testicular cells. We hypothesized that BPA can induce ferroptotic testicular cell death by affecting the expression of ferroptosis-related indicators, thereby causing mitochondrial pathological changes and functional defects, which are characteristic manifestations of ferroptosis.22 In our study, significant iron deposits and severe damages, such as decreased or disappeared mitochondrial cristae, mitochondrial membrane pyknosis, and mitochondrial vacuolation, were observed in the mouse testes exposed to BPA (Figure 2c and 2d). Iron overload can further lead to oxidative stress in mice, which is manifested as a decrease in SOD activity and an increase in the level of peroxide products, such as MDA (Figure 2a). BPA induces oxidative stress in the testes, which ultimately causes mitochondrial damage,23 as observed in this study. The oxidative damage induced by BPA in mouse testes is primarily due to lipid peroxidation in the mitochondria. In particular, damage to the mitochondrial membrane increases the influx of iron, which may further promote the formation of ROS through Fenton reactions,24 thereby aggravating oxidative damage.

In this study, the ferroptosis-related indicators, GPX4, FTH1, and COX2, were primarily expressed in spermatogenic cells, and ACSL4 was primarily expressed in interstitial cells. After BPA treatment, the expression levels of GPX4 and FTH1 were significantly reduced, whereas the expression levels of COX2 and ACSL4 were significantly increased (Figure 5). GPX4 is an antioxidant defense enzyme found in the mitochondria and an important regulator of ferroptosis.25 Previous studies have shown that reduced expression of GPX4 can enhance the lethality of ferroptosis, whereas overexpression of GPX4 can inhibit ferroptosis.25,26 In this study, BPA could significantly inhibit the expression of GPX4 in the testis, especially 50 mg kg⁻¹ bw and 100 mg kg⁻¹ bw BPA. This lack of GPX4 may cause ferroptosis in testicular cells (Figure 4 and 5). Studies have shown that a reduction in GPX4 can induce lipid peroxidation-dependent cell death in mouse testes.27 GPX4 converts lipid hydroperoxides into lipid alcohols, which prevents the formation of ferrous ion (Fe²⁺)-dependent toxic lipid ROS. Inhibiting the function of GPX4 can lead to lipid peroxidation and may lead to the induction of ferroptosis (i.e., the iron-dependent nonapoptotic form of cell death).28 Ferritin is a widely expressed and highly conserved protein composed of two polypeptide chains: ferritin heavy chain and ferritin light chain. The ferritin heavy chain catalyzes the Fe²⁺ oxidation reaction, whereas the ferritin light chain plays an important role in the storage of ferric iron (Fe³⁺). These two chains are essential for maintaining a steady state of iron and preventing iron overload. Therefore, FTH1 is a key subunit of ferritin and its knockdown significantly inhibits cell viability and causes mitochondrial dysfunction.29 A study on the peroxidation of polyunsaturated fatty acids revealed that the expression of FTH1 increased during ferroptosis,30 and its overexpression enhanced the degradation of ferritin.31 COX2 is a membrane-bound protein encoded by the prostaglandin-endoperoxide synthase 2 (PTGS2) gene, which can be markedly induced by pro-inflammatory cytokines, tumor promoters, mitogens, and cytokines in various cells. Therefore, COX2 participates in cell inflammatory responses, proliferation, apoptosis, and other pathological processes, thereby serving as a pivotal gene in ferroptosis biology.32 Studies have shown that the overexpression of miR-137 can protect cells from ferroptosis caused by lipid peroxidation and iron overload, whereas activation of the COX2/PTGS2 pathway can reverse the protective effect of miR-137 overexpression.21 ACSL4 is an enzyme involved in polyunsaturated fatty acids (PUFA) activation and is considered to be a target of ferroptosis.33 The knockout of ACSL4 in ferroptosis-sensitive mouse and human cells has been found to cause a loss in protection against cell death, indicating that ACSL4 is a reliable biomarker of ferroptosis-sensitive cell death.34

In summary, BPA may induce testicular ferroptosis in mouse testicular cells by reducing the expression of GPX4 and FTH1 and increasing the expression of COX2 and ACSL4, especially the 100 mg kg⁻¹ bw BPA intervention (Figure 3–5). However, our study had certain limitations. First, further verification via in vitro experiments is lacking. Second, humans may be exposed to BPA for a long time through various environmental factors; however, animal experiments can only simulate the human exposure environment to a certain extent. Finally, whether supplementation with ferroptosis inhibitors can prevent or treat the decline in male fertility associated with BPA was not investigated. In future studies, we will confirm the regulatory mechanism between ferroptosis-related genes and the decline in male fertility induced by BPA.

AUTHOR CONTRIBUTIONS

LL, YZ, MYW, and LKC developed the original concept of this study and drafted the manuscript. YZ and XQY offered many suggestions for the experimental process and writing of the article. MYW, HBJ, and LKC performed the experiments and helped draft the manuscript. CRG, WWZ, and XDZ performed the statistical analyses and revised the manuscript. All authors contributed to the critical discussion, read, and approved the final manuscript.

COMPETING INTERESTS

All authors declare no competing interests.