Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2023 May 30.
Published in final edited form as: Gene Expr Patterns. 2022 Jun 8;45:119257. doi: 10.1016/j.gep.2022.119257

Differential Expression of the Tmem132 Family Genes in the Developing Mouse Nervous System

Yuan Wang 1,2, Graham Herzig 2, Cassandra Molano 2, Aimin Liu 2,*
PMCID: PMC10228465  NIHMSID: NIHMS1899499  PMID: 35690356

Abstract

The family of novel transmembrane proteins (TMEM) 132 have been associated with multiple neurological disorders and cancers in humans, but have hardly been studied in vivo. Here we report the expression patterns of the five Tmem132 genes (a, b, c, d and e) in developing mouse nervous system with RNA in situ hybridization in wholemount embryos and tissue sections. Our results reveal differential and partially overlapping expression of multiple Tmem132 family members in both the central and peripheral nervous system, suggesting potential partial redundancy among them.

Keywords: Tmem132a, Tmem132b, Tmem132c, Tmem132d, Tmem132e, Mouse, Central nervous system, Peripheral nervous system, embryos

1. Introduction

Despite decades of biochemical and genetic studies and recent high throughput mutagenesis efforts, a large number of the mammalian protein-coding genes still await investigation (e.g. (Pandey et al., 2014). Genome-wide association studies (GWAS) indicated that some of these genes are potentially important for human development and physiological function (Hirschhorn and Daly, 2005). The transmembrane protein family 132 (TMEM132) is a family of genes frequently associated with human genetic disorders, in particular neurological disorders, but has somehow evaded extensive molecular investigation (Gregersen et al., 2014; Sanchez-Pulido and Ponting, 2018).

Anxiety Disorder is a pediatric neurological disorder with a life-time occurrence of more than 20% (Meier and Deckert, 2019). A 2011 study found that TMEM132D was associated with panic disorder (PD), a major form of Anxiety Disorder, panic attacks and unipolar depression (Erhardt et al., 2011). Patients with PD exhibited higher expression of TMEM132D in frontal cortex. Higher expression of Tmem132d in cingulate cortex was also found to be associated with higher anxiety levels in a mouse model (Erhardt et al., 2011). The association between TMEM132D and PD was confirmed by subsequent independent studies in European (Erhardt et al., 2012; Haaker et al., 2014) and Japanese (Shimada-Sugimoto et al., 2016) populations with anxiety-related phenotype. Another TMEM132 family member, TMEM132E, was also associated with PD (Gregersen et al., 2014).

TMEM132 family members were also implicated in other neurological disorders. Mis-sense mutations in TMEM132E were found in multiple patients with autosomal recessive non-syndromic hearing loss, and knockdown of Tmem132e in zebrafish disrupted mechanosensation (Li et al., 2015; Liaqat et al., 2019). GWAS also implicated TMEM132E in insomnia (Agbu et al., 2018). TMEM132B was implicated in Major Depressive Disorder (Hu et al., 2021). TMEM132A has not been associated with any human genetic diseases. However, Tmem132a expression was found in rat brain (Oh-hashi et al., 2003), and loss of Tmem132a led to neural tube closure defects (Dickinson et al., 2016).

Some indications of the potential function of the TMEM132 family members have emerged in recent structural, biochemical and genetics studies. TMEM132 proteins all contain extracellular Ig domains and intracellular WAVE complex binding domains, suggesting that they may mediate cell-cell interaction and intracellular actin network organization (Sanchez-Pulido and Ponting, 2018). Consistent with this notion, the loss of nematode Tmem132 led to abnormal neurite projection (Wang et al., 2021). The Drosophila Tmem132 homolog, dtn, was involved in reproduction and nociception, but the exact cellular mechanism was not revealed (Chon et al., 2021; Honjo et al., 2016). A recent biochemical study suggested that the TMEM132A protein interacted with WNTLESS and may be involved in WNT secretion (Li and Niswander, 2020).

The genetic studies in animal models and association with human diseases strongly indicate that the TMEM132 family of proteins is important for mammalian development and physiology, and deserves further investigation. In the current study, we compare the expression of Tmem132 genes in mouse neural development and reveal differential and sometimes partially overlapping expression patterns of the family members. Our findings provide a basis for further functional studies of this important gene family in neural development and diseases.

2. Results and Discussion

2.1. Expression of the Tmem132 genes during early nervous system development

To explore the contribution of the Tmem132 family genes to the early development of the nervous system, we examined their expression at embryonic day 8.5 (E8.5). Wholemount in situ hybridization (ISH) indicated that Tmem132a was expressed throughout the embryonic region, but not in the extraembryonic membranes (Fig. 1A). A sense probe for Tmem132a did not stain the embryos, indicating the specificity of the procedure (Fig. 1B). Tmem132b (Fig. 1C) and Tmem132d (Fig. 1E) did not exhibit any specific expression at this stage. Interestingly, Tmem132c was expressed in the dorsal midbrain, somites and the tail region (Fig. 1D). Tmem132e expression was present in the ventral neural tube (Fig. 1E and inset). At E9.5, Tmem132a continued to be expressed widely in the embryos (Fig. 2A), whereas Tmem132b and Tmem132d expression remained undetectable (Fig. 2B and D). Tmem132c continued to be expressed in somites and midbrain, and started to be expressed in head mesenchyme (Fig. 2C). Interestingly, Tmem132e expression was detected in the cranial and dorsal root ganglia (DRG) at E9.5 (Fig. 2E).

Figure 1. The expression of Tmem132 family genes at embryonic day 8.5.

Figure 1.

Open in a new tab

Lateral views of E8.5 embryos after wholemount in situ hybridization. Purple staining shows gene expression of Tmem132a (A), Tmem132b (C), Tmem132c (D), Tmem132d (E) and Tmem132e (F). (B) shows an embryo treated with Tmem132a sense probe as a negative control. The inset shows the ventral view of the same embryo in F with the neural tube expression of Tmem132e.

Figure 2. The expression of Tmem132 family genes at embryonic day 9.5.

Figure 2.

Open in a new tab

Lateral views of E9.5 embryos after wholemount in situ hybridization. Purple staining shows expression of Tmem132a (A), Tmem132b (B), Tmem132c (C), Tmem132d (D) and Tmem132e (E).

To study the expression of Tmem132a, Tmem132c and Tmem132e in the nervous system in more detail, we performed ISH analyses on sections of E10.5 embryos. We found that Tmem132a was expressed throughout the neural tube at this stage (Fig. 3A, E and I), and the expression level increased in post-mitotic regions such as the motor neuron domain in the spinal cord (Fig. 3E). It was also highly expressed in the branchial arch (Fig. 3I). Tmem132c was expressed in the surface ectoderm (Fig. 3B, F and J). It was also expressed in dorsal telencephalon and posterior dorsal midbrain, but appeared to be absent from the rest of the neural tube (Fig. 3B, F and J). Tmem132e was expressed in the cranial (Fig. 3C) and spinal ganglia (Fig. 3G) labeled with Isl1 expression (Fig. 3D and H). In addition, it was also expressed in the motor neuron regions labelled with Isl1 and Phox2a (Fig. 3G, H, K and L; (Tiveron et al., 1996)). Tmem132a was also expressed in the cranial (Fig. 3I) and spinal (Fig. 3E) ganglia.

Figure 3. The expression of Tmem132a, Tmem132c and Tmem132e in the CNS and PNS at E10.5.

Figure 3.

Open in a new tab

(A-D) Sagittal sections showing gene expression in the brains and cranial ganglia (E-H) Transverse sections through the neural tube at the thoracic level. (I-L) Coronal sections through the hindbrain and branchial arches. (A, E, I) Tmem132a, (B, F, J) Tmem132c, (C, G, K) Tmem132e, (D) Isl1 to show cranial ganglia. (H) Isl1 to show motor neurons and dorsal root ganglia. (L) Phox2a to show motor neurons and cranial ganglia. ba: branchial arch; drg: dorsal root ganglia; gpg: glossopharyngeal ganglia; mn: motor neurons; so: somites.

2.2. Expression of Tmem132a and Tmem132e in trigeminal ganglia at E14.5

At E14.5, Tmem132a (Fig. 4A) and Tmem132e (Fig. 4C) continued to be expressed in the trigeminal ganglia, which was labeled with strong Isl1 expression (Fig. 4D). In addition, Tmem132a expression was enriched in whisker follicles and oral epithelium (Fig. 4A). Tmem132c was also expressed in the oral epithelium, but it was absent from the trigeminal ganglia (Fig. 4B).

Figure 4. The expression of Tmem132a, Tmem132c and Tmem132e in the craniofacial region at E14.5.

Figure 4.

Open in a new tab

Coronal sections to show the craniofacial regions after RNA in situ hybridization. (A) Tmem132a expression in the trigeminal ganglia (tg), oral epithelium (oe) and whisker follicles (wf). (B) Tmem132c expression in the oral epithelium. (C) Tmem132e expression in the trigeminal ganglia. (D) Isl1 serves as a marker for the trigeminal ganglia.

2.3. Expression of Tmem132a, Tmem132c and Tmem132e in inner ear development

Point mutations in TMEM132E have been associated with hearing loss in humans, and knocking down Tmem132e expression in zebrafish affected inner ear development/function (Li et al., 2015; Liaqat et al., 2019). To better understand the contribution of Tmem132 family members to inner ear development, we examined the expression of Tmem132a, Tmem132c and Tmem132e in developing inner ears at E14.5 and E18.5 in the developing cochlea. At E14.5, both Tmem132a and Tmem132c were expressed in the cells lining the cochlear ducts (Fig. 5A, B), whereas Tmem132e was expressed in what appeared to be the vestibulocochlear ganglion, but not in the cochlear duct itself (Fig. 5C). At E18.5, both Tmem132a and Tmem132e were highly expressed in spiral ganglia (Fig. 5D and F). Tmem132a and Tmem132c were expressed in part of the sensory epithelium of the cochlear ducts at this stage (Fig. 5D and E). As point mutations in TMEM132E were associated with hearing impairment in humans despite overlapping expression of Tmem132a and Tmem132e in spiral ganglia (Li et al., 2015; Liaqat et al., 2019), it will be interesting to determine whether Tmem132e is required early, before Tmem132a expression in the vestibulocochlear nerve. Alternatively, the requirement for TMEM132E in human hearing may reflect a dosage effect.

Figure 5. The expression of Tmem132a, Tmem132c and Tmem132e in inner ear development.

Figure 5.

Open in a new tab

(A-C) Coronal sections through the inner ear at embryonic day 14.5 (E14.5) showing the expression of Tmem132a (A), Tmem132c (B) and Tmem132e (C). (D-F) Sections of the E18.5 cochlea showing the expression of Tmem132a (D), Tmem132c (E) and Tmem132e (F). (G-I) Sections of the postnatal day 7 (P7) cochlea showing the expression of Tmem132a (D), Tmem132c (E) and Tmem132e (F). cd: cochlear duct; vc: vestibulocochlear nerve; sg: spiral ganglia.

2.4. Expression of the Tmem132 family genes in caudal forebrain

A previous study detected Tmem132a in many regions of the adult rat brain with Northern hybridization (Oh-hashi et al., 2003). To reveal the dynamic expression patterns of all five Tmem132 genes in brain development, we performed section ISH at E14.5, E18.5, P7 and P21. At E14.5, we found strong expression of Tmem132a in a specific domain of the caudal forebrain (Fig. 6A, F). By comparison with the known markers of the thalamus (Ngn2, Gbx2; Fig. 6G and H) and prethalamus (Isl1; Fig. 6I), we determined that this Tmem132a -enriched domain corresponded to the post-mitotic regions of the thalamus (Nakagawa and O'Leary, 2001). Tmem132a expression was also present in the hypothalamus, but at a much lower level (Fig. 6A, F). The other Tmem132 genes were not expressed in the thalamus (Fig. 6B-E), but Tmem132b appears to be expressed in a small group of cells of the prethalamus (Fig. 6B), whereas Tmem132d and Tmem132e were expressed at low levels in the hypothalamus (Fig. 6D and E).

Figure 6. The expression of the Tmem132 family genes in the cerebral cortex and caudal forebrain at embryonic day 14.5.

Figure 6.

Open in a new tab

Transverse sections of the E14.5 embryos showing the expression of Tmem132a (A, F), Tmem132b (B), Tmem132c (C), Tmem132d (D) and Tmem132e (E). The expression of Ngn2 (G) and Gbx2 (H) mark the thalamus (TH), whereas the expression of Isl1 (I) marks the prethalamus (pTH). cCtx: cingulate cortex; Ctx: Cortex; hTH: hypothalamus

2.5. Expression of Tmem132 family members in the cerebral cortex and hippocampus

At E14.5, three Tmem132 family members were expressed in the developing cerebral cortex. Tmem132a was expressed in postmitotic cells near the pia surface (Fig. 6A). Tmem132b expression was specific to the ventricular layer (Fig. 6B). Tmem132c was also expressed in the ventricular layer, but it was restricted to the cingulate cortex (Fig. 6C).

We analyzed the expression of the Tmem132 family in more details at E18.5. To better distinguish different cell types, we labeled the neural progenitor cells with Pax6 (Fig. 7A; (Englund et al., 2005; Stoykova and Gruss, 1994)), the intermediate precursors with Tbr2 (Fig. 7B; (Englund et al., 2005)), the deeper layer projection neurons with Tbr1 (layers V/VI, Fig. 7C; (Englund et al., 2005), intermediate layer projection neurons with FoxP1 (layers III-V, Fig. 7D; (Ferland et al., 2003)), and upper layer projection neurons with Cux1 (layers II-IV, Fig. 7E; (Nieto et al., 2004)). We found that Tmem132a was expressed at higher levels in the deeper layers and lower levels in the upper layers (Fig. 7F). Tmem132b was strongly expressed in the progenitors at the ventricular layer, and became weaker in the intermediate precursors (Fig. 7G). An additional domain of weak Tmem132b expression was also detected in deeper layers. A thin line of Tmem132d expressing cells were present at the bottom of the cortical plate (Fig. 7I). Tmem132c and Tmem132e, in contrast, did not show expression in the cerebral cortex at this stage (Fig. 7H and J).

Figure 7. The expression of Tmem132 family genes in embryonic day 18.5 cerebral cortex.

Figure 7.

Open in a new tab

Cross sections of E18.5 brains processed for RNA in situ hybridization. (A) Pax6 marks the progenitors in the ventricular layer. (B) Tbr2 marks the intermediate precursors. (C) Tbr1 marks the deeper layers of projection neurons. (D) FoxP1 marks the intermediate layers of projection neurons. (E) Cux1 marks the superficial layers of projection neurons. (F) Tmem132a expression in all layers of the cortical plate. (G) Strong Tmem132b expression in the ventricular layer and weak expression in the deeper neuronal layers. (H) No Tmem132c expression in the cortex. (I) Weak Tmem132d expression in a thin layer of deep neuronal layers. (J) No Tmem132e expression in the cortex. Brackets outline the domains of gene expression.

The Tmem132 family genes were also differentially expressed in the hippocampus. Tmem132a was expressed in the hippocampus at P7 and P21 (Fig. 8A and F). Tmem132b was also expressed in hippocampus at both stages, but at a lower level (Fig. 8B and G). Tmem132c was not expressed in the hippocampus at either stage (Fig. 8C and H). Tmem132d expression was higher in the CA1 region than in CA3 region, and was absent in the dentate gyrus (Fig. 8D and I). On the contrary, weak Tmem132e expression was restricted to the dentate gyrus and CA3 region, but not in CA1 region (Fig. 8E and J).

Figure 8. The expression of Tmem132 family genes in the hippocampus.

Figure 8.

Open in a new tab

Transverse sections of the brains processed for RNA in situ hybridization. (A-E) The expression of Tmem132a (A), Tmem132b (B), Tmem132c (C), Tmem132d (D) and Tmem132e (E) at postnatal day 7 (P7). (F-J) The expression of Tmem132a (F), Tmem132b (G), Tmem132c (H), Tmem132d (I) and Tmem132e (J) at P21.

2.6. Expression of Tmem132a in cerebellar granule layer

We next examined the expression of the Tmem132a in the cerebellum. At P21, Tmem132a was expressed strongly in the cerebellum (Fig. 9A). Tmem132a expression overlaps with that of En2, a marker of the cerebellar granule neurons (Fig. 9B; (Davis and Joyner, 1988)), suggesting that Tmem132a was expressed in the granule layer. Calb1 labeled a thin layer of Purkinje cells that appeared to abut the Tmem132a expression domain (Fig. 9C; (Iacopino et al., 1990)). To investigate whether Tmem132a was also expressed in Purkinje cells, we compared the expression of Tmem132a and Calb1 through double fluorescent in situ hybridization. We found that the Tmem132a expression domain abutted, but did not overlap with, that of Calb1, suggesting that Tmem132a was not expressed in Purkinje cells (Fig. 9D, D’ and D”).

Figure 9. The expression of Tmem132 family genes in the cerebellum.

Figure 9.

Open in a new tab

Sagittal sections of the cerebellum processed for RNA in situ hybridization. All panels show expression at postnatal day 21 (P21). Tmem132a (A) was expressed in the granule layer marked with En2 expression (B). Calb1 expression marked Purkinje cells (C). (D) Double fluorescence in situ hybridization showing the absence of Tmem132a expression in Purkinje cells. D’ and D” show the close-up view of the highlighted area in D. The positions of Calb1+ cells were indicated by circles in D’ and D”.

3. Conclusions

Our gene expression analyses provide important information regarding the potential functions of the TMEM132 family members that may explain the previously observed association with human diseases and/or genetic data in model animals. Prior to neural tube closure, Tmem132a was widely expressed in the embryos, whereas other Tmem132 family members were either absent or expressed at low levels. This observation is consistent with the frequent neural tube closure defects in a Tmem132a mutant mouse strain (Dickinson et al., 2016). Consistent with the association between TMEM132E and hearing loss in humans, we found specific expression of Tmem132e in spiral ganglia of the inner ear (Li et al., 2015; Liaqat et al., 2019). Interestingly, Tmem132a was also expressed in the spiral ganglia, suggesting possible redundant function between these two genes. The overlapping expression of Tmem132a and Tmem132c in the sensory epithelium of the cochlea suggests another potential role for this family of proteins in hearing that has yet to be elucidated.

Tmem132a, but not Tmem132d, was expressed at high levels in brain regions associated with emotional responses, such as the cortex, hippocampus and thalamus, which appears to contradict the GWAS association between TMEM132D and panic disorders (Erhardt et al., 2011; LeDoux, 2000). However, a gene expression analysis found elevated TMEM132D expression in the frontal cortex of panic disorder patients, suggesting that its expression may need to be kept at a lower level to ensure normal emotional circuit function (Erhardt et al., 2011). It would be interesting to see whether artificially increasing Tmem132d expression in lab animals, e.g. by expressing it under the control of a promoter highly active in frontal cortex, leads to panic disorder-like symptoms.

Human and mouse TMEM132 family members share similar domain structures including an extracellular Cohesin and three tandem ancient bacteria Ig domains, as well as intracellular protein phosphatase and WAVE complex binding motifs (Sanchez-Pulido and Ponting, 2018). Pair-wise BLAST analyses indicate that the overall peptide sequence similarities between TMEM132 family members range from 51% between TMEM132a and TMEM132e, to 72% between TMEM132c and TMEM132d. Therefore, it is likely that these proteins share redundant functions in cells where they are co-expressed, an interesting possibility awaiting direct functional testing.

Our results also suggest potential functions of Tmem132 family genes in other aspects of nervous system function. For example, although TMEM132D was the only family member whose association with panic disorder has been well investigated (Erhardt et al., 2012; Erhardt et al., 2011; Erhardt and Spoormaker, 2013; Haaker et al., 2014; Hodgson et al., 2016; Howe et al., 2016; Inoue et al., 2015; Naik et al., 2018; Quast et al., 2012; Shimada-Sugimoto et al., 2016), the fact that all four other family members were expressed in developing cortex and/or hippocampus suggests that they may also play a role that has yet to be revealed. The strong expression of Tmem132a in the thalamus and cerebellar granule layer points to its potential roles in the functions of these brain regions. However, due to the preweaning lethality of the Tmem132a mutants, a tissue-specific mutagenesis approach may be needed to reveal such functions. Finally, the overlapping expression of Tmem132a and Tmem132e in other cranial and spinal ganglia suggests that they may have overlapping functions in other parts of the PNS in addition to hearing.

Online databases such as Genepaint (http://gp3.mpg.de) and Allen Brain Atlas (https://portal.brain-map.org/) provide valuable snapshots of gene expression patterns in development or adult. However, these databases are limited in terms of optimal stage selection (e.g., Only E14 expression was shown at Genepaint, and P56 for Brain Atlas), angle selection (e.g., only sagittal sections were shown at Genepaint and for many genes at Brain Atlas), lack of annotation and missing genes (e.g., Tmem132b was not examined at Genepaint or Brain Atlas). We carefully selected stages appropriate for each organ to compare the expression of the five Tmem132 family genes, with known markers of various cell types and/or compartments as reference, providing deeper insights into potential connections between these genes and associated human diseases.

The TMEM132 family members were also associated with non-neural traits, such as pulmonary function in human (Son et al., 2015), body weight in pig (Gong et al., 2019) and chicken (Tarsani et al., 2019), limb and kidney development in mice (Dickinson et al., 2016). Recent studies also implicated TMEM132 genes in cancers of the mammary gland, colon, lung and ovary (de Almeida et al., 2019; Iwakawa et al., 2015; Karapetsas et al., 2015; Rudolph et al., 2013; Wan et al., 2022; Yu et al., 2015; Zhang et al., 2020; Zhang et al., 2022). Although it is beyond the scope of this study, which focuses on the expression of Tmem132 genes in the developing neural tissues, it will be interesting to investigate their expression and function in other organs and various cancers to reach a more comprehensive understanding of the physiological roles of this important gene family.

4. Methods

4.1. Animals

C3H/HeNCrl male and female mice (Charles River Labs) were bred to generate embryos for the study. The noon of the day on which the vaginal plug was found was counted as embryonic day 0.5 (E0.5). Female pups/mice from the same strain were used for the study at P7 and P21. The use of the animals in this work was approved by the IACUC (#47340) at the Penn State University (PA, USA).

4.2. RNA in situ hybridization in wholemount embryos

E8.5 and E9.5 embryos were dissected out of uteri in ice-cold PBS and fixed in 4% paraformaldehyde (PFA) for at least 4 hours. Subsequently, the embryos were subject to wholemount RNA in situ hybridization procedure described in detail in (Liu et al., 2012).

4.3. RNA in situ hybridization on cryosections

Whole embryos (E10.5, E14.5) or isolated tissues (whole heads or cochleae) of the embryos (E18.5) or young pups (P7) were fixed in 4% PFA for at least 4 hours. Older (P21) mice were anesthetized and perfused with 4% PFA according to (Dong et al., 2016), then brains were dissected, and further fixed for at least 4 hours. The tissues were then saturated with 30% sucrose, processed for cryosection and subject to a RNA in situ hybridization procedure described in detail in (Liu and Liu, 2014).

4.4. Double fluorescent RNA in situ hybridization on cryosections

Cryosections of P21 cerebellum were treated with H2O2 to inactivate endogenous peroxidase activity, acidified with HCl and acetylated before hybridized with Fluorescein-labeled Tmem132a probe and DIG-labeled Calb1 probe overnight. On the following day, the sections were extensively washed and incubated with anti-Fluorescein POD (Sigma) overnight. On the third day, the sections were incubated with CF488-Tyramide (Biotium) for four hours before treated with H2O2 and incubated with anti-DIG POD (Sigma) overnight. On the final day, the sections were incubated with CF568-Tyramide for two hours and mounted with Vectashield with DAPI. Photos were taken with a Nikon E600 microscope and a QImaging micropublisher camera.

4.5. Synthesis of probes for RNA in situ hybridization.

The probe for Tmem132a was constructed by cloning the 700 base HindIII/KpnI cDNA fragment covering 20 bases of the 5’ UTR and 680 bases of the coding region into pGEM3. All other probes were produced by PCR amplification of the 3’ UTRs of the corresponding genes and cloned into pGEM3 or pGEM11. Fluorescein or DIG-labeled RNA probes were synthesized by in vitro transcription using Roche polymerases per manufacturer’s instructions. DNA sequence information needed for designing RNA in situ hybridization probes were found at https://useast.ensembl.org/Mus_musculus/Info/Index. The following table lists the primers used for probe synthesis

Gene Primers Probe length
Tmem132b forward primer: AACAAGAGCACAACCCCACA
reverse primer: GGCCATTGGTCATGAGGTGA		 976 bases
Tmem132c forward primer: GCGGAGCTCTTGGAGAACAT
reverse primer: TTCCACTCATTGGCCTGACC		 1341 bases
Tmem132d forward primer: CAGACCAAATGGACCTCCCC
reverse primer: CCCACACATGCTCAACCTGA		 1027 bases
Tmem132e forward primer: CATCGTGTTTGTGCTGCGAT
reverse primer: CCCAAGTCTAAGGAGCCGTG		 1129 bases
Isl1 forward: CGACCCAGTCAATGGAAACT
reverse: GCAATGCAAGAGCAAACAAA		 854 bases
Tbr2 TCGGTACGGCGTTCAAAACT
TTAATAGCACCGGGCACTCG		 983 bases
Tbr1 TCCATCAAATCCATCGACTCC
ACTCGACTCGCCTAGGAACA		 858 bases
Cux1 AAGAAGGCTGCGAACTTGAA
TGTGCCAACACAGACAGACA		 1146 bases
FoxP1 GCCAACCACAGTCCAGATTT
GTGGGGACCTTCAGGTGTAA		 1077 bases
Calb1 CTGCTTCTATCTGGCGGAAG
ACCCAAACCTGCATTAGGTG		 866 bases
Open in a new tab

Acknowledgements:

We thank Drs. Joyner and Brunet for providing RNA in situ hybridization probes for En2, Gbx2 and Phox2a. We also thank Dr. Joyner for sharing the double fluorescent in situ hybridization protocol that we adapted for the current study.

Funding:

This work was supported by the National Institutes of Health [R03 HD102462]; a Penn State new lab start up fund; a NASA Pennsylvania Space Grant Consortium program and an undergraduate research fund from the Eberly College of Science of The Pennsylvania State University.

Footnotes

Declarations of interest: none

References

  1. Agbu SO, Liang Y, Liu A, Anderson KV, 2018. The small GTPase RSG1 controls a final step in primary cilia initiation. J Cell Biol 217, 413–427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Chon C, Chon G, Matsui Y, Zeng H, Lai ZC, Liu A, 2021. Efficient multiplexed genome engineering with a polycistronic tRNA and CRISPR guide-RNA reveals an important role of detonator in reproduction of Drosophila melanogaster. PLoS One 16, e0245454. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Davis CA, Joyner AL, 1988. Expression patterns of the homeo box-containing genes En-1 and En-2 and the proto-oncogene int-1 diverge during mouse development. Genes Dev 2, 1736–1744. [DOI] [PubMed] [Google Scholar]
  4. de Almeida BP, Apolonio JD, Binnie A, Castelo-Branco P, 2019. Roadmap of DNA methylation in breast cancer identifies novel prognostic biomarkers. BMC Cancer 19, 219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Dickinson ME, Flenniken AM, Ji X, Teboul L, Wong MD, White JK, Meehan TF, Weninger WJ, Westerberg H, Adissu H, Baker CN, Bower L, Brown JM, Caddle LB, Chiani F, Clary D, Cleak J, Daly MJ, Denegre JM, Doe B, Dolan ME, Edie SM, Fuchs H, Gailus-Durner V, Galli A, Gambadoro A, Gallegos J, Guo S, Horner NR, Hsu CW, Johnson SJ, Kalaga S, Keith LC, Lanoue L, Lawson TN, Lek M, Mark M, Marschall S, Mason J, McElwee ML, Newbigging S, Nutter LM, Peterson KA, Ramirez-Solis R, Rowland DJ, Ryder E, Samocha KE, Seavitt JR, Selloum M, Szoke-Kovacs Z, Tamura M, Trainor AG, Tudose I, Wakana S, Warren J, Wendling O, West DB, Wong L, Yoshiki A, International Mouse Phenotyping, C., Jackson L, Infrastructure Nationale Phenomin, I.C.d.l.S., Charles River L, Harwell MRC, Toronto Centre for, P., Wellcome Trust Sanger, I., Center RB, MacArthur DG, Tocchini-Valentini GP, Gao X, Flicek P, Bradley A, Skarnes WC, Justice MJ, Parkinson HE, Moore M, Wells S, Braun RE, Svenson KL, de Angelis MH, Herault Y, Mohun T, Mallon AM, Henkelman RM, Brown SD, Adams DJ, Lloyd KC, McKerlie C, Beaudet AL, Bucan M, Murray SA, 2016. High-throughput discovery of novel developmental phenotypes. Nature 537, 508–514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Dong F, Jiang J, McSweeney C, Zou D, Liu L, Mao Y, 2016. Deletion of CTNNB1 in inhibitory circuitry contributes to autism-associated behavioral defects. Hum Mol Genet 25, 2738–2751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Englund C, Fink A, Lau C, Pham D, Daza RA, Bulfone A, Kowalczyk T, Hevner RF, 2005. Pax6, Tbr2, and Tbr1 are expressed sequentially by radial glia, intermediate progenitor cells, and postmitotic neurons in developing neocortex. J Neurosci 25, 247–251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Erhardt A, Akula N, Schumacher J, Czamara D, Karbalai N, Muller-Myhsok B, Mors O, Borglum A, Kristensen AS, Woldbye DP, Koefoed P, Eriksson E, Maron E, Metspalu A, Nurnberger J, Philibert RA, Kennedy J, Domschke K, Reif A, Deckert J, Otowa T, Kawamura Y, Kaiya H, Okazaki Y, Tanii H, Tokunaga K, Sasaki T, Ioannidis JP, McMahon FJ, Binder EB, 2012. Replication and meta-analysis of TMEM132D gene variants in panic disorder. Transl Psychiatry 2, e156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Erhardt A, Czibere L, Roeske D, Lucae S, Unschuld PG, Ripke S, Specht M, Kohli MA, Kloiber S, Ising M, Heck A, Pfister H, Zimmermann P, Lieb R, Putz B, Uhr M, Weber P, Deussing JM, Gonik M, Bunck M, Kebler MS, Frank E, Hohoff C, Domschke K, Krakowitzky P, Maier W, Bandelow B, Jacob C, Deckert J, Schreiber S, Strohmaier J, Nothen M, Cichon S, Rietschel M, Bettecken T, Keck ME, Landgraf R, Muller-Myhsok B, Holsboer F, Binder EB, 2011. TMEM132D, a new candidate for anxiety phenotypes: evidence from human and mouse studies. Mol Psychiatry 16, 647–663. [DOI] [PubMed] [Google Scholar]
  10. Erhardt A, Spoormaker VI, 2013. Translational approaches to anxiety: focus on genetics, fear extinction and brain imaging. Curr Psychiatry Rep 15, 417. [DOI] [PubMed] [Google Scholar]
  11. Ferland RJ, Cherry TJ, Preware PO, Morrisey EE, Walsh CA, 2003. Characterization of Foxp2 and Foxp1 mRNA and protein in the developing and mature brain. J Comp Neurol 460, 266–279. [DOI] [PubMed] [Google Scholar]
  12. Gong H, Xiao S, Li W, Huang T, Huang X, Yan G, Huang Y, Qiu H, Jiang K, Wang X, Zhang H, Tang J, Li L, Li Y, Wang C, Qiao C, Ren J, Huang L, Yang B, 2019. Unravelling the genetic loci for growth and carcass traits in Chinese Bamaxiang pigs based on a 1.4 million SNP array. J Anim Breed Genet 136, 3–14. [DOI] [PubMed] [Google Scholar]
  13. Gregersen NO, Buttenschon HN, Hedemand A, Dahl HA, Kristensen AS, Clementsen B, Woldbye DP, Koefoed P, Erhardt A, Kruse TA, Wang AG, Borglum AD, Mors O, 2014. Are TMEM genes potential candidate genes for panic disorder? Psychiatr Genet 24, 37–41. [DOI] [PubMed] [Google Scholar]
  14. Haaker J, Lonsdorf TB, Raczka KA, Mechias ML, Gartmann N, Kalisch R, 2014. Higher anxiety and larger amygdala volumes in carriers of a TMEM132D risk variant for panic disorder. Transl Psychiatry 4, e357. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hirschhorn JN, Daly MJ, 2005. Genome-wide association studies for common diseases and complex traits. Nat Rev Genet 6, 95–108. [DOI] [PubMed] [Google Scholar]
  16. Hodgson K, Almasy L, Knowles EE, Kent JW, Curran JE, Dyer TD, Goring HH, Olvera RL, Fox PT, Pearlson GD, Krystal JH, Duggirala R, Blangero J, Glahn DC, 2016. Genome-wide significant loci for addiction and anxiety. Eur Psychiatry 36, 47–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Honjo K, Mauthner SE, Wang Y, Skene JHP, Tracey WD Jr., 2016. Nociceptor-Enriched Genes Required for Normal Thermal Nociception. Cell Rep 16, 295–303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Howe AS, Buttenschon HN, Bani-Fatemi A, Maron E, Otowa T, Erhardt A, Binder EB, Gregersen NO, Mors O, Woldbye DP, Domschke K, Reif A, Shlik J, Koks S, Kawamura Y, Miyashita A, Kuwano R, Tokunaga K, Tanii H, Smoller JW, Sasaki T, Koszycki D, De Luca V, 2016. Candidate genes in panic disorder: meta-analyses of 23 common variants in major anxiogenic pathways. Mol Psychiatry 21, 665–679. [DOI] [PubMed] [Google Scholar]
  19. Hu G, Yu S, Yuan C, Hong W, Wang Z, Zhang R, Wang D, Li Z, Yi Z, Fang Y, 2021. Gene expression signatures differentiating major depressive disorder from subsyndromal symptomatic depression. Aging (Albany NY) 13, 13124–13137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Iacopino AM, Rhoten WB, Christakos S, 1990. Calcium binding protein (calbindin-D28k) gene expression in the developing and aging mouse cerebellum. Brain Res Mol Brain Res 8, 283–290. [DOI] [PubMed] [Google Scholar]
  21. Inoue A, Akiyoshi J, Muronaga M, Masuda K, Aizawa S, Hirakawa H, Ishitobi Y, Higuma H, Maruyama Y, Ninomiya T, Tanaka Y, Hanada H, Kawano Y, 2015. Association of TMEM132D, COMT, and GABRA6 genotypes with cingulate, frontal cortex and hippocampal emotional processing in panic and major depressive disorder. Int J Psychiatry Clin Pract 19, 192–200. [DOI] [PubMed] [Google Scholar]
  22. Iwakawa R, Kohno T, Totoki Y, Shibata T, Tsuchihara K, Mimaki S, Tsuta K, Narita Y, Nishikawa R, Noguchi M, Harris CC, Robles AI, Yamaguchi R, Imoto S, Miyano S, Totsuka H, Yoshida T, Yokota J, 2015. Expression and clinical significance of genes frequently mutated in small cell lung cancers defined by whole exome/RNA sequencing. Carcinogenesis 36, 616–621. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Karapetsas A, Giannakakis A, Dangaj D, Lanitis E, Kynigopoulos S, Lambropoulou M, Tanyi JL, Galanis A, Kakolyris S, Trypsianis G, Coukos G, Sandaltzopoulos R, 2015. Overexpression of GPC6 and TMEM132D in Early Stage Ovarian Cancer Correlates with CD8+ T-Lymphocyte Infiltration and Increased Patient Survival. Biomed Res Int 2015, 712438. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. LeDoux JE, 2000. Emotion circuits in the brain. Annu Rev Neurosci 23, 155–184. [DOI] [PubMed] [Google Scholar]
  25. Li B, Niswander LA, 2020. TMEM132A, a Novel Wnt Signaling Pathway Regulator Through Wntless (WLS) Interaction. Front Cell Dev Biol 8, 599890. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Li J, Zhao X, Xin Q, Shan S, Jiang B, Jin Y, Yuan H, Dai P, Xiao R, Zhang Q, Xiao J, Shao C, Gong Y, Liu Q, 2015. Whole-exome sequencing identifies a variant in TMEM132E causing autosomal-recessive nonsyndromic hearing loss DFNB99. Hum Mutat 36, 98–105. [DOI] [PubMed] [Google Scholar]
  27. Liaqat K, Hussain S, Bilal M, Nasir A, Acharya A, Ali RH, Nawaz S, Umair M, Schrauwen I, Ahmad W, Leal SM, 2019. Further evidence of involvement of TMEM132E in autosomal recessive nonsyndromic hearing impairment. J Hum Genet. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Liu J, Heydeck W, Zeng H, Liu A, 2012. Dual function of suppressor of fused in Hh pathway activation and mouse spinal cord patterning. Dev Biol 362, 141–153. [DOI] [PubMed] [Google Scholar]
  29. Liu J, Liu A, 2014. Immunohistochemistry and RNA in situ hybridization in mouse brain development. Methods Mol Biol 1082, 269–283. [DOI] [PubMed] [Google Scholar]
  30. Meier SM, Deckert J, 2019. Genetics of Anxiety Disorders. Curr Psychiatry Rep 21, 16. [DOI] [PubMed] [Google Scholar]
  31. Naik RR, Sotnikov SV, Diepold RP, Iurato S, Markt PO, Bultmann A, Brehm N, Mattheus T, Lutz B, Erhardt A, Binder EB, Schmidt U, Holsboer F, Landgraf R, Czibere L, 2018. Polymorphism in Tmem132d regulates expression and anxiety-related behavior through binding of RNA polymerase II complex. Transl Psychiatry 8, 1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Nakagawa Y, O'Leary DD, 2001. Combinatorial expression patterns of LIM-homeodomain and other regulatory genes parcellate developing thalamus. J Neurosci 21, 2711–2725. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Nieto M, Monuki ES, Tang H, Imitola J, Haubst N, Khoury SJ, Cunningham J, Gotz M, Walsh CA, 2004. Expression of Cux-1 and Cux-2 in the subventricular zone and upper layers II-IV of the cerebral cortex. J Comp Neurol 479, 168–180. [DOI] [PubMed] [Google Scholar]
  34. Oh-hashi K, Naruse Y, Amaya F, Shimosato G, Tanaka M, 2003. Cloning and characterization of a novel GRP78-binding protein in the rat brain. J Biol Chem 278, 10531–10537. [DOI] [PubMed] [Google Scholar]
  35. Pandey AK, Lu L, Wang X, Homayouni R, Williams RW, 2014. Functionally enigmatic genes: a case study of the brain ignorome. PLoS One 9, e88889. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Quast C, Altmann A, Weber P, Arloth J, Bader D, Heck A, Pfister H, Muller-Myhsok B, Erhardt A, Binder EB, 2012. Rare variants in TMEM132D in a case-control sample for panic disorder. Am J Med Genet B Neuropsychiatr Genet 159B, 896–907. [DOI] [PubMed] [Google Scholar]
  37. Rudolph A, Hein R, Lindstrom S, Beckmann L, Behrens S, Liu J, Aschard H, Bolla MK, Wang J, Truong T, Cordina-Duverger E, Menegaux F, Bruning T, Harth V, Network G, Severi G, Baglietto L, Southey M, Chanock SJ, Lissowska J, Figueroa JD, Eriksson M, Humpreys K, Darabi H, Olson JE, Stevens KN, Vachon CM, Knight JA, Glendon G, Mulligan AM, Ashworth A, Orr N, Schoemaker M, Webb PM, kConFab I, Group AM, Guenel P, Brauch H, Giles G, Garcia-Closas M, Czene K, Chenevix-Trench G, Couch FJ, Andrulis IL, Swerdlow A, Hunter DJ, Flesch-Janys D, Easton DF, Hall P, Nevanlinna H, Kraft P, Chang-Claude J, Breast Cancer Association C, 2013. Genetic modifiers of menopausal hormone replacement therapy and breast cancer risk: a genome-wide interaction study. Endocr Relat Cancer 20, 875–887. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Sanchez-Pulido L, Ponting CP, 2018. TMEM132: an ancient architecture of cohesin and immunoglobulin domains define a new family of neural adhesion molecules. Bioinformatics 34, 721–724. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Shimada-Sugimoto M, Otowa T, Miyagawa T, Khor SS, Omae Y, Toyo-Oka L, Sugaya N, Kawamura Y, Umekage T, Miyashita A, Kuwano R, Kaiya H, Kasai K, Tanii H, Okazaki Y, Tokunaga K, Sasaki T, 2016. Polymorphisms in the TMEM132D region are associated with panic disorder in HLA-DRB1*13:02-negative individuals of a Japanese population. Hum Genome Var 3, 16001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Son HY, Sohn SW, Im SH, Kim HJ, Lee MK, Gombojav B, Kwon HS, Park DS, Kim HL, Min KU, Sung J, Seo JS, Kim JI, 2015. Family-Based Association Study of Pulmonary Function in a Population in Northeast Asia. PLoS One 10, e0139716. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Stoykova A, Gruss P, 1994. Roles of Pax-genes in developing and adult brain as suggested by expression patterns. J Neurosci 14, 1395–1412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Tarsani E, Kranis A, Maniatis G, Avendano S, Hager-Theodorides AL, Kominakis A, 2019. Discovery and characterization of functional modules associated with body weight in broilers. Sci Rep 9, 9125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Tiveron MC, Hirsch MR, Brunet JF, 1996. The expression pattern of the transcription factor Phox2 delineates synaptic pathways of the autonomic nervous system. J Neurosci 16, 7649–7660. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Wan X, Hao S, Hu C, Qu R, 2022. Identification of a novel lncRNA-miRNA-mRNA competing endogenous RNA network associated with prognosis of breast cancer. J Biochem Mol Toxicol, e23089. [DOI] [PubMed] [Google Scholar]
  45. Wang X, Jiang W, Luo S, Yang X, Wang C, Wang B, Dang Y, Shen Y, Ma DK, 2021. The C. elegans homolog of human panic-disorder risk gene TMEM132D orchestrates neuronal morphogenesis through the WAVE-regulatory complex. Mol Brain 14, 54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Yu J, Wu WK, Li X, He J, Li XX, Ng SS, Yu C, Gao Z, Yang J, Li M, Wang Q, Liang Q, Pan Y, Tong JH, To KF, Wong N, Zhang N, Chen J, Lu Y, Lai PB, Chan FK, Li Y, Kung HF, Yang H, Wang J, Sung JJ, 2015. Novel recurrently mutated genes and a prognostic mutation signature in colorectal cancer. Gut 64, 636–645. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Zhang X, Kang X, Jin L, Bai J, Zhang H, Liu W, Wang Z, 2020. ABCC9, NKAPL, and TMEM132C are potential diagnostic and prognostic markers in triple-negative breast cancer. Cell Biol Int 44, 2002–2010. [DOI] [PubMed] [Google Scholar]
  48. Zhang X, Li T, Niu Q, Qin CJ, Zhang M, Wu GM, Li HZ, Li Y, Wang C, Du WF, Wang CY, Zhao Q, Zhao XD, Wang XL, Zhu JB, 2022. Genome-wide analysis of cell-Free DNA methylation profiling with MeDIP-seq identified potential biomarkers for colorectal cancer. World J Surg Oncol 20, 21. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES