Reassessing the adrenomedullin scavenging function of ACKR3 in lymphatic endothelial cells

Elena C Sigmund; Aline Bauer; Barbara D Jakobs; Hazal Tatliadim; Carlotta Tacconi; Marcus Thelen; Daniel F Legler; Cornelia Halin

doi:10.1371/journal.pone.0285597

. 2023 May 30;18(5):e0285597. doi: 10.1371/journal.pone.0285597

Reassessing the adrenomedullin scavenging function of ACKR3 in lymphatic endothelial cells

Elena C Sigmund ¹, Aline Bauer ¹, Barbara D Jakobs ², Hazal Tatliadim ¹, Carlotta Tacconi ¹, Marcus Thelen ³, Daniel F Legler ^2,⁴, Cornelia Halin ^1,^*

Editor: Gabriella Lupo⁵

PMCID: PMC10228790 PMID: 37252916

Abstract

Atypical chemokine receptor 3 (ACKR3) is a scavenger of the chemokines CXCL11 and CXCL12 and of several opioid peptides. Additional evidence indicates that ACKR3 binds two other non-chemokine ligands, namely the peptide hormone adrenomedullin (AM) and derivatives of the proadrenomedullin N-terminal 20 peptide (PAMP). AM exhibits multiple functions in the cardiovascular system and is essential for embryonic lymphangiogenesis in mice. Interestingly, AM-overexpressing and ACKR3-deficient mouse embryos both display lymphatic hyperplasia. Moreover, in vitro evidence suggested that lymphatic endothelial cells (LECs), which express ACKR3, scavenge AM and thereby reduce AM-induced lymphangiogenic responses. Together, these observations have led to the conclusion that ACKR3-mediated AM scavenging by LECs serves to prevent overshooting AM-induced lymphangiogenesis and lymphatic hyperplasia. Here, we further investigated AM scavenging by ACKR3 in HEK293 cells and in human primary dermal LECs obtained from three different sources in vitro. LECs efficiently bound and scavenged fluorescent CXCL12 or a CXCL11/12 chimeric chemokine in an ACKR3-dependent manner. Conversely, addition of AM induced LEC proliferation but AM internalization was found to be independent of ACKR3. Similarly, ectopic expression of ACKR3 in HEK293 cells did not result in AM internalization, but the latter was avidly induced upon co-transfecting HEK293 cells with the canonical AM receptors, consisting of calcitonin receptor-like receptor (CALCRL) and receptor activity-modifying protein (RAMP)2 or RAMP3. Together, these findings indicate that ACKR3-dependent scavenging of AM by human LECs does not occur at ligand concentrations sufficient to trigger AM-induced responses mediated by canonical AM receptors.

Introduction

ACKR3, formerly known as CXCR7 [1] or RDC1 [2], is an atypical chemokine receptor expressed by blood vascular and lymphatic endothelial cells (BECs and LECs, respectively) amongst many other cell types [3, 4] and is a well-known scavenging receptor of the chemokines CXCL12 and CXCL11 [5]. Rather than inducing G protein-mediated signaling, ligand binding to ACKR3 triggers β-arrestin recruitment and internalization of the receptor/ligand complex, followed by intracellular ligand degradation [3, 4]. By regulating site-specific or systemic concentrations of CXCL12, ACKR3 was shown to impact diverse biologic processes, including the migration of leukocytes [6] and tumor cells [7] as well as of germ cells during development [8]. Recent studies additionally revealed that ACKR3 functions as a broad-range scavenging receptor for a class of opioid peptides [9, 10]. In mice, ACKR3-deficiency was found to be embryonically lethal as it results in abnormal cardiac development and hyperplasia, in addition to abnormalities in neuronal development and in the immune system [11–13]. Moreover, ACKR3-deficient embryos display lymphatic hyperplasia and lymphedema [14], a phenotype that has been attributed to ACKR3’s role as a scavenging receptor for AM in LECs [14]. AM is a well described vascular peptide hormone and driver of endothelial cell proliferation [14]. AM was shown to induce proliferation, migration and tube formation of LECs in vitro [15], as well as lymphangiogenesis and modulation of lymphatic drainage in mice in vivo [15, 16]. AM signals via its conventional receptors AM1 and AM2, which are heterodimers consisting of the calcitonin receptor-like receptor (CALCRL) in association with either the receptor activity-modifying protein (RAMP)2 (AM1) or RAMP3 (AM2) [17].

Interestingly, upon crossing ACKR3^-/- animals with AM haplo-insufficient (Adm^+/−) animals, Klein et al. observed that AM haploinsufficiency improved postnatal survival and rescued the phenotype caused by ACKR deficiency in ACKR3^-/- Adm^+/− animals. In contrast, postnatal survival was significantly reduced in ACKR3^+/- mice crossed with AM overexpressing Adm^hi/hi mice [14]. The observed phenotypic interconnection between ACKR3 and AM expression in vivo was in agreement with a previous literature report [2] suggesting that ACKR3 functions as a scavenging receptor for AM. In further direct support of this assumption, knockdown of ACKR3 in LECs in vitro was shown to enhance AM-induced proliferation and migration of human LECs [14]. Moreover, in indirect support of ACKR3-mediated AM scavenging, ectopic expression of ACKR3 in HEK293T cells was found to enhance the depletion of biotinylated AM from the cell culture supernatant, whereas this process was diminished upon shRNA-mediated knockdown of ACKR3 in human LECs [14]. Based on these findings [14] it is nowadays commonly assumed in the field of lymphatic biology that ACKR3 expression in LECs serves to counterbalance overshooting AM-induced lymphangiogenic responses [18–22]. However, studies performed in ACKR3 overexpressing human cell lines have recently questioned the ability of AM to be scavenged by ACKR3 at physiologically meaningful concentrations [23, 24]. For example, Meyrath et al. could only detect β-arrestin recruitment to ACKR3 in response to sub-micromolar AM concentrations in HEK293 cells transfected with ACKR3 [24]. Moreover, a previous study from our lab found that conditional, postnatal knockout of ACKR3 in the lymphatic vasculature in mice did neither recapitulate the observations made during embryonic development nor affect lymphatic function [25].

In the present study, we therefore set out to better investigate the ability of LEC-expressed ACKR3 to scavenge AM and to modulate LEC responses to AM. To this end, we performed in vitro LEC proliferation assays as well as uptake assays with fluorescently labeled AM and chemokine in primary human dermal neonatal, juvenile or adult LECs. Notably, three different sources of LECs were used to account for potential differences in ACKR3 expression and scavenging activity between LEC donors and/ or differences caused by the donors’ age. ACKR3 function was either pharmacologically modulated using the ACKR3-specific competitive agonist CCX771, a well-described inhibitor of CXCL12 scavenging [7, 26], or knocked-down by shRNA. In addition, we studied AM scavenging in HEK293 cells transfected with ACKR3 and/or different components of the canonical AM receptors. These experiments did not provide any evidence of ACKR3 mediating the scavenging of AM.

Material and methods

Isolation and culture of adult primary human skin LECs (adLECs)

LECs were isolated and cultured as previously described [27]. Briefly, LECs were obtained from the breast skin of a healthy 58 years old female subject admitted for plastic surgery at the University Hospital Zurich. Written informed consent was obtained as approved by the Ethics Committee of the Kanton Zurich (2017–00687). The skin sample was washed in hank’s balanced salt solution (HBSS) supplemented with 5% fetal bovine serum (FBS, Gibco), 2% antibiotic and antimycotic solution (AA, Gibco), and 20mM HEPES (Gibco), and incubated in 0.25% trypsin (Sigma) overnight at 4°C. After removal of the epidermal sheets, the dermis was finely minced and enzymatically digested (RPMI medium, 5% FBS, 2% AA, 20mM HEPES, 1000U/mL collagenase type 1 (Worthington), 40μg/mL DNase I (Roche) for 45 min at 37°C under constant agitation. The digested tissue was then filtered through a 100μm cell strainer (Falcon), washed with RPMI medium supplemented with 10% FBS, 2% AA, and 20mM HEPES, and centrifuged at 485 ×g for 6min at 4°C. Cells were seeded into plates previously coated with 10 μg/ml fibronectin (Roche) and cultured in EGM-2 complete medium (Lonza) supplemented with 5% FBS at 37°C in a 5% CO₂ incubator. After 7–10 days, cells were trypsinized, and endothelial cells were selected based on CD31 positivity with Dynabeads CD31 magnetic beads (Thermo Fisher Scientific) and cultured until confluency. Endothelial cells were detached, washed with FACS buffer (DPBS supplemented with 2% FBS and 1mM EDTA), and incubated with Alexa647-conjugated mouse anti-human podoplanin antibody (1:70, clone 18H5, Novus Biologicals) and PE-conjugated mouse anti-human CD31 antibody (1:20, clone WM59, BD Pharmingen) in FACS buffer for 30min at 4°C. After a wash with FACS buffer, adLECs were finally sorted according to their positivity for CD31 and podoplanin on a FACSAria II (BD Biosciences) with a 100μm nozzle, using FACSDiva software (ver. 6.1.3). adLECs were used between passage (p) 2 and 6. Cells were routinely tested for mycoplasma contamination using the MycoScope PCR Mycoplasma Detection Kit (Genlantis).

Culture of commercial primary human neonatal and juvenile dermal LECs (ndLECs and jdLECs)

Single donor human neonatal dermal lymphatic microvascular endothelial cells (ndLECs) were obtained from Lonza (Visp, Switzerland, catalogue #CC-2812; HMVEC-dLyNeo) and cultured in complete EBM-2 medium consisting of EBM-2 basal Medium (CC-3156, Lonza) supplemented with EGM-2 MV Single Quots^TM (CC-4147, Lonza). Cell culture dishes were pre-coated with 10μg/ml collagen type 1 (Advanced Biomatrix) and 10μg/ml fibronectin (Merck Millipore) in PBS.

Juvenile skin LECs (jdLECs) from the foreskin of a single male donor (Lot Nr. 431Z006.2) were obtained from Promocell (Heidelberg, Germany, # C-12216) and cultured in complete EBM-2 (CC-3156, Lonza) supplemented with EGM^TM-2 SingleQuots^TM (CC-4176, Lonza), without VEGF-A (CC-4176, Lonza), additionally supplemented with (3%) FBS for a final concentration of 5% FBS (Gibco), as used for ndLECs. Cell culture dishes were pre-coated with 10μg/ml collagen type 1 (Advanced Biomatrix, San Diego, CA, USA) and 10μg/ml fibronectin (Merck Millipore) in PBS.

HEK293 cell culture

HEK293-CTRL and stably transfected HEK293-ACKR3 cells (generated as described below) were maintained in DMEM (Invitrogen), 10% FBS (Gibco) 1% penicillin/streptomycin (Gibco).

qRT-PCR analysis of ackr3, ramp2, ramp3 and calcrl expression in LECs and HEK293 cells

Total cellular RNA was extracted from confluent plates of human LECs or HEK293 control (HEK293-CTRL) cells and HEK293 cell stably transfected with ACKR3 (HEK293-ACKR3) using TRIZOL reagent (Life Technologies, cat. no.15596026). cDNA was generated using the High-Capacity cDNA Reverse Transcription Kit (Fisher Scientific, cat. no. 10400745). Quantitative PCR was performed on reversely transcribed RNA using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific, cat. no. A25776). Gene expression analysis was performed on a QuantStudio 7 Flex system (Applied Biosciences) using the following primer pairs:

Ackr3 (RV: 5’-GTA GAG CAG GAC GCT TTT GTT-3’; FW: 5’-TCT GCA TCT CTT CGA CTA CTC- 3’); Calcrl (RV: 5’-CAT CAA TGG TGT GCT GGA AC-3’; FW: 5’-CAC TAT GCC TGA TGT GAC GC-3’); Ramp2 (RV: 5’-GTT GGC AAA GTG GAT CTG GT- 3’; FW: 5’-GCC ATG ATT AGC AGG CCT TA-3’); Ramp3 (RV: 5’-CTC ATC CCG CTG ATC GTT AT- 3’; FW: 5’AAC TTT CTT CCA GCT TGC CA- 3’); β-actin (ACTB) (QuantiTect primer, Qiagen, cat no. QT01680476). Cxcr4 (QuantiTect primer, Qiagen, cat no. QT00223188).

Anti-ACKR3 staining of cultured human LECs for flow cytometry

In vitro cultured ndLECs were washed 2x with PBS and detached with Accutase (A6964, Sigma-Aldrich) at 37°C. Antibody staining with 5μg/ml monoclonal mouse anti-human ACKR3-APC (clone 11G8, originally described as anti-CXCR7/RDC-1-APC, R&D) or 10μg/ml mouse anti-human ACKR3 (clone 9C4, originally described as anti-CXCR7 [28]) or corresponding isotype controls (mouse IgG1-APC and mouse IgG1) was performed in FACS buffer for 30min on ice. Mouse anti-human CXCR7 (9C4) was detected with a secondary anti-mouse IgG Alexa Fluor488 antibody (Invitrogen) and acquired on a FACSCanto™ (BD Biosciences). The antibody staining with anti-human ACKR3-APC (clone 11G8) was acquired on a Cytoflex S apparatus.

ShRNA-mediated silencing of ACKR3 in human LECs

Briefly, adLECs p2 or jdLECs p3 were seeded and expanded for 4 days in a 10 cm culture plate in EBM2 complete medium (Lonza). On the day of the transduction with lentivirus particles, containing one of four different shRNAs or the scrambled control, LECs cells were seeded into 5x 4 wells of a 6-well plate at a concentration of 50 000 cells/ well. (Four wells for each of the ACKR3 shRNAs (A-D) and the scramble control, packaged into Lentivirus particles). After 5h, LECs were infected with ACKR3- shRNA Lentivirus particles (A-D) using a calculated MOI of 10. Four days after transduction, cells were harvested and seeded into a T75 cell culture flask for expansion. Eight days after the Lentivirus infection, LECs were harvested and GFP positive cells were sorted on a FACSAria II (BD Biosciences) cell sorter with a 100μm nozzle, using FACSDiva software (version 6.1.3). Afterwards, cells were expanded and cryopreserved at p6, as a stock for subsequent experiments. Experiments were performed at p7 and p8. The following commercially available shRNA constructs in pGFP-C-shLenti-particles (Origene) were used for shRNA mediated silencing of ACKR3:

TL305345-A (TI321373): CCGAGCACAGCATCAAGGAGTGGCTGATC
TL305345-B (TI321374): GAGTGGCTGATCGGCATGGAGCTGGTCTC
TL305345-C (TI321375): GACACGCACTGCTACATCTTGAACCTGGC
TL305345-D (TI321376): CGCAACTACAGGTACGAGCTGATGAAGGC

Generation of HEK293-ACKR3 cells

HEK293 cells were stably transfected with a hemagglutinin (HA)-tagged ACKR3 construct [28] cloned into pcDNA3. Transfection was performed using lipofectamine according to the manufacturer’s instructions (Invitrogen, 153380100). Bulk ACKR3-expressing cells were selected with G418 (0.9 μg/ml, Invitrogen) and tested for HA surface expression, using anti-HA antibody clone 12CA5, and stably transfected HEK293-ACKR3 cells isolated by FACS sorting on a FACSAria^TM III (BD Biosciences).

Plasmid construction for transient expression of CALCRL, RAMP2 and RAMP3 in HEK293 cells

The entire open reading frame of CALCRL was amplified by PCR using the primers 5’-CGCGGATCCGCCATGGAGAAAAAGTGTACCC and 5’-CGCGGATCCCTAATTATATAAATTTTCTGGTTTTAAGAG and cloned into the EcoRI and ApaI restriction sites of pEGFP-N1 (Clontech), revealing pCALCRL-EGFP. The vector pcDNA3.1(+)_CD33_FLAG-RAMP1 containing a CD33 signal peptide and a FLAG-tag in front of the mature protein sequence of RAMP1 [29] was kindly provided by Dr. David R. Poyner (Aston University, Birmingham, UK) and served as template. The EcoRI restriction site in front of the CD33 signal sequence within the multiple-cloning-site was removed by site-directed mutagenesis. Subsequently, the mature protein sequence of RAMP1 was replaced by the mature protein sequence of RAMP2 and RAMP3 using specific PCR products and the two remaining EcoRI restriction sites. The following two PCR primer pairs were used: for Ramp2: 5’- CGATTAGAATTCTTGCATGGATCCGCTCAGCCTCTTCCC and 5’- CGATTAGAATTCCTAGGCCTGGGCCTCACTG; for Ramp3: 5’-GCATTAGAATTCTTGCATGGATCCGCAGGCGGCTGCAACG and 5'-CGATTAGAATT’TTCACAGCAGCGTGTCGGTG. The resulting plasmids pcDNA3.1(+) CD33_FLAG-RAMP2 and pcDNA3.1(+)_CD33_FLAG-RAMP3 encode for FLAG-tagged RAMP2 and FLAG-tagged RAMP3, respectively.

Transient transfection of HEK293 cells

For transient transfection of RAMP2, RAMP3 and CALCRL, HEK293-CTRL or HEK293-ACKR3 cells were seeded into a 12 well plate at 125.000 cells / well in 0.6 mL medium and transfected the next day, after reaching 60–80% confluency. Briefly, after addition of fresh medium to each well, the transfection mixture containing 500ng plasmid DNA and 1.875μl TransIT®-LT1 Transfection Reagent (Mirus Bio LLC, Madison USA) in 50μl Opt-MEM^TM (Gibco), was added in a drop-wise manner to the cells, according to the manufacturer’s instructions. Experiments were performed on day 2 after transfection, when peak induction of CALCRL-eGFP was observed by fluorescent microscopy. Following plasmids were used for transfection: pcDNA3.1+_CD33_FLAG-RAMP2 cloned according to [30], pCALCRL-EGFP-N1, pcDNA3.1+_FLAG-RAMP3.

Use of LECs for different types of experiments

ndLECs were used for chemokine uptake assays, anti-ACKR3 staining by flow cytometry, as well as fluorescent AM, CXCL12 or CXCL11/12 uptake experiments analyzed by flow cytometry and microscopy. ndLECs were also used in proliferation assays in combination with CCX771 treatment and AM titration.

adLECs and jdLECs were used for all shRNA-mediated ACKR3-knockdown and related assays, including fluorescent AM or CXCL11/12 uptake experiments analyzed by microscopy or flow cytometry and proliferation assays.

Fluorescently labelled AM and chemokines used in uptake experiments

AFdye568 (AF568)-labelled AM (AM-AF568) was custom-synthesized and fluorescently labelled at Cambridge Research Biochemicals Ltd (Billingham, UK), according to a previous report by Schönauer et al. [31]. In the latter, carboxytetramethylrhodamine (Tam)-labelled AM was successfully used to visualize AM internalization in transfected HEK293 cells [31]. Here, Tam was replaced by AF568, due to experimental considerations and superior dye properties. The amino acid sequence (1–52) of the synthesized AM peptide was: YRQSMNNF-Pra-GLRSFGCRFGTCTVQKLAHQIYQFTDKDKDNVAPRSKISPQGY-amide. Notably, Pra at position 9, which corresponds to the unnatural amino acid L-propargyl glycine, was inserted and replaced a Gln (Q), to allow for the site-specific attachment of AF568 picolyl azide via a copper(I)-catalyzed azide alkyne cycloaddition at this position. In analogy to natural human AM, the resulting AF568-labelled AM peptide [Pra⁹(AF568)] AM(1–52) contained one intramolecular disulfide bridge between residues C¹⁶ and C²¹ and an amidated tyrosine at the carboxy terminus.

AlexaFluor 647-labeled CXCL12 (CXCL12-AF647) was purchased from ALMAC Group (UK). The ACKR3-specific chimeric chemokine CXCL11/12 site-specifically labeled with either AlexaFluor 647 (CXCL11/12-AF647) or Atto565 dye (CXCL11/12-Atto565), as previously described in [32].

Chemokine and AM uptake assays in LECs

Human LECs were seeded into 24-well plates coated with 10μg/ml collagen type 1 (Advanced Biomatrix) and fibronectin (Merck Millipore) (in PBS) in their respective EBM-2 complete culture medium (without human VEGF-A), as described before. After 24h, the medium was changed to starvation medium consisting of EBM-2 basal medium (CC-3156, Lonza), containing 2% FBS (Gibco) and 1% antibiotic-antimycotic solution (Thermo Fisher Scientific) for 24h. For cytokine stimulation (stim), starved LECs were subsequently stimulated for 24h with 20ng/ml TNFα (AF-300-01A, Peprotech, London, UK) and IFN-γ (AF-300-02, Peprotech). When treated with CCX771, LECs were pre-incubated for 30min with 1μM CCX771 (ChemoCentryx, Mountain View, CA, USA) or vehicle control, both diluted in starvation medium, before adding fluorescently-labelled chemokines or AM. For all assays, fluorescent chemokines (50nM) or AM (concentrations as indicated in the text) were diluted in EBM-2 starvation medium and incubated with LECs at 37°C, in presence of either 1μM CCX771 or the vehicle control. Chemokine/AM binding controls were incubated for 1h at 4°C. After 1h, LECs were washed once with PBS and subsequently incubated for 1min with an acidic wash buffer (100mM NaCl, 50 mM glycine in PBS, adjusted to pH3) at RT. Afterwards, LECs were washed with PBS and detached from the plates by short incubation with Accutase® at 37°C. LECs were harvested in ice cold FACS buffer for subsequent acquisition on a Cytoflex S apparatus.

Ligand competition assay in LECs

Ligand competition assays were performed similar to scavenging assays (see chemokine uptake assays). Indicated molar concentrations of AM (0-10000nM) and 50nM CXCL11/12-AF647 were added simultaneously to cultured ndLECs. After 1h, ndLECs were washed with PBS and subsequently washed shortly with an acid wash buffer (100mM NaCl, 50mM glycine in PBS, adjusted to pH3) and detached using Accutase. Subsequently, ndLECs were harvested in FACS buffer and acquired on a Cytoflex S apparatus.

LEC proliferation assays

ShRNA-treated adLECs and jdLECs, which were used in case of proliferation assessment upon CCX771 treatment, were seeded into collagen and fibronectin-coated 96-well plates (50μg/ml in PBS) (2200 cells per well, 10 wells per condition). After 24h, the culture medium was changed to starvation medium (EBM-2 and 2% FBS, 1% P/S) for 24h before treatment with 1nM AM (or 0.01nM AM, 0.1nM AM or 10nM AM) (Bachem AG, Switzerland) in starvation medium and optionally in presence of either 1μM of CCX771 or vehicle control (ChemoCentryx, Mountain View, CA, USA), respectively. After 72h, cells were washed with PBS and incubated with 1mg/ml 5-methylumbelliferylheptanoate (MUH, Sigma-Aldrich) for 1h. The fluorescent intensity correlating with the number of viable cells was quantified spectrophotometrically using a SpectraMax Gemini EM microplate reader (Bucher Biotec AG, Basel, Switzerland).

AM-AF568 binding/internalization experiments in HEK293 cells

AM-AF568 binding/internalization experiments were performed 48h post transfection. Briefly, transfected HEK293-CTRL and HEK293-ACKR3 cells were incubated for 1h in starvation medium (DMEM 2%FBS, 1% P/S) containing 50nM AM-AF568 at either 37°C or 4°C. Subsequently, the cells were washed once with PBS and then incubated for 1 min with an acidic wash buffer (100mM NaCl, 50 mM glycine in PBS, adjusted to pH3) at RT. Immediately after, the cells were washed once with PBS, detached with Accutase® at 37°C, and then harvested in ice cold FACS buffer. One part was used for direct acquisition on a Cytoflex S apparatus while the remaining cells were used for subsequent staining with monoclonal anti-FLAG BioM2 (CCF9291, Sigma-Aldrich), diluted 1:400, and Streptavidin-Brilliant Violet 421™ (CC 405226, Biolegend) diluted 1:300, before acquisition.

Statistical data analysis

Statistical analysis was performed using Prism 8 (GraphPad Software, LaJolla, CA, USA). All data are presented as mean ± standard deviation (SD). Student`s t-test (paired, two-tailed) was used to compare the means of two groups. One-way or two-way ANOVA, was used to compare the means of two or more groups and different conditions, followed by either Tukey’s post-hoc test, to make individual pairwise comparisons between all groups (and conditions), or alternatively, Šídák’s post hoc test, when pairwise comparisons to respective (untreated) controls were calculated. Data that contain mean or matched data from repeated experiments were analyzed using repeated-measure (RM) one-way or two-way ANOVA, followed by either Tukey’s post-hoc test, Dunnett’s (when comparing all mean values to one shared control value), or Šídák’s multiple comparison test. In case of missing repeated data points, a mixed effects model analysis followed Tukey’s or Šídák’s multiple comparison post-hoc test was performed, A p-value of p<0.05 was considered significant.

Results

AM fails to reduce the chemokine scavenging activities of ACKR3 in a ligand competition assay in LECs in vitro

For our experiments we used primary dermal LECs isolated from three different sources: namely, LECs derived from neonatal, juvenile or adult human dermis (ndLECs, jdLECs and adLECs, respectively). These cells uniformly expressed CD31 and podoplanin in FACS (S1 Fig). qRT-PCR analysis indicated expression of Ackr3 in steady state and its induction upon stimulating LECs by overnight incubation in presence of the inflammatory cytokines TNFα and IFN γ (S1 Fig). Flow cytometry analysis using two different anti-human ACKR3 antibody clones (9C4 [28]) and 11G8 [33]) revealed only minute or non-detectable ACKR3 surface expression in ndLECs under regular culture conditions (S1 Fig), likely reflecting the fact that ACKR3 continuously internalizes and recycles through intracellular vesicles [34]. Conversely, in line with the qRT-PCR data, robust ACKR3 surface expression was observed upon overnight stimulation of ndLECs with TNFα and IFNγ (S1 Fig).

To assess the scavenging capacity of LEC-expressed ACKR3, we incubated TNFα/IFNγ stimulated ndLECs for 1h at either 37°C with fluorescently labelled CXCL12 (CXCL12-AF647), performed an acidic wash to remove surface-bound chemokine and subsequently analyzed the cells by flow cytometry. As a control, chemokine uptake was simultaneously performed at 4°C, i.e. a temperature at which endocytic processes are strongly impaired. Flow cytometric analysis revealed a high Mean Fluorescent Intensity (MFI) of CXCL12-AF647 upon incubation at 37°C, indicative of cellular uptake, as compared to a low MFI observed upon incubation at 4°C (Fig 1A and 1B). By contrast, when the experiment at 37°C was performed in presence of the ACKR3-specific competitive agonist CCX771, a well-described inhibitor of CXCL12 scavenging [7, 26], CXCL12-AF647 uptake was markedly reduced (Fig 1A and 1B). Similar scavenging experiments were also performed with an Atto565-labelled version of the recombinant chimeric chemokine CXCL11/12 (CXCL11/12-Atto565), composed of the N-terminus of CXCL11 and the main body and C-terminus of CXCL12 [32]. The latter was shown to be specifically bound and scavenged by ACKR3—but not by CXCL12’s or CXCL11’s natural receptors, i.e. CXCR4 or CXCR3 [32]. These experiments confirmed strong ACKR3-mediated scavenging activity in TNFα/IFNγ stimulated ndLECs at 37°C (Fig 1C and 1D). Upon treatment with CCX771, CXCL11/12-Atto565 uptake was almost completely abrogated in TNFα/IFNγ stimulated ndLECs (Fig 1C and 1D). Similarly, also CXCL11/12 labeled with AlexaFluor647 (CXCL11/12-AF647) was taken up by TNFα/IFNγ stimulated, and to a lesser extent also by unstimulated ndLECs in an ACKR3-dependent manner (Fig 1E and 1F). To investigate whether AM competes with CXCL11/12 for ACKR3 binding, we next performed a ligand competition assay, in which we tested the ability of unlabeled, recombinant human AM to outcompete CXCL11/12-AF647 binding to ACKR3 and diminish its scavenging. To this end, ndLECs were again stimulated overnight in presence of TNFα/IFNγ and incubated for one hour with 50nM CXCL11/12-AF647 in presence of increasing concentrations of AM (0–10’000nM). While the uptake of CXCL12/12-AF647 (50nM) was efficiently blocked in presence of CCX771, even a 200-fold excess of AM failed to diminish CXCL11/12 scavenging (Fig 1G). Thus, AM was not able to out-compete the chemokine scavenging activity of ACKR3 in ndLECs.

Fig 1 — (**A-D**) ndLECs stimulated by overnight treatment with TNFα/IFNγ take up (**A, B**) CXCL12-AF647 or (**C, D**) the ACKR3-specific chimeric chemokine CXCL11/12-Atto565 at 37°C but not at 4°C. Uptake at 37°C is abrogated by treatment with CCX771. (A, C) Representative histograms and (**B, D**) quantifications of 3–5 independent experiments. One-way ANOVA. (**E, F**) Scavenging of the ACKR3-specific chimeric chemokine CXCL11/12-AF647 at 37°C by unstimulated and TNFα/IFNγ stimulated human LECs is abrogated by treatment with CCX771 (E) Representative histograms and (F) quantification of 3 independent experiments. Two-way ANOVA. (G) AM is not able to displace CXCL11/12-AF647 in a ligand competition assay. CXCL11/12-AF647 (50nM) scavenging assay was performed in presence of exceeding concentrations of AM. Data of three independent experiments are shown as mean ±SD. Each dot represents the value obtained in an individual experiment. Statistics: RM One-way ANOVA, Dunnett’s multiple comparison test.

AM internalization in primary LECs is not altered by pharmacologic modulation of ACKR3

In order to visualize AM scavenging in LECs, we custom-synthesized an AF568-labelled AM molecule (AM-AF568) (Fig 2A). Similarly to unmodified AM [35], the chosen format had previously been shown to be internalized by HEK293 cells expressing the conventional AM receptor AM1, consisting of CALCRL and RAMP2 [31]. Notably, all LECs (ndLECs, jdLECs, adLECs) expressed CALCRL, RAMP2 and RAMP3 (S1 Fig). To assess the bioactivity of AM-AF568, we first tested its capacity to induce ndLEC proliferation in vitro [15, 36, 37]. In these experiments, synthesized AM-AF568 displayed comparable activity to commercial, unlabeled human AM in inducing LEC proliferation (Fig 2B). In agreement with the previous publication working with AM1-transfected HEK293 cells [31], AM-AF568 (50nM) was taken up at low levels by unstimulated ndLECs and by TNFα/IFNγ stimulated ndLECs (Fig 2C). Notably, the latter had downregulated the AM receptor components RAMP2 and RAMP3 (S1 Fig). However, in contrast to uptake of CXCL11/12-AF647 (Fig 2D), uptake of AM-AF568 was not reduced upon treatment of ndLECs with CCX771 (Fig 2C).

Considering that a recent study working with ACKR3-overexpressing cell lines only detected AM binding to ACKR3 at AM concentrations in the sub-micromolar range [9], we repeated the internalization experiment using 500nM and 1μM of AM-AF568 in unstimulated and TNFα/IFNγ stimulated ndLECs. Notably, at a concentration of 500nM AM-AF568 internalization was detected by confocal microscopy (Fig 2E). Similarly, internalization of CXCL11/12-AF647 could be observed, albeit at much lower concentrations (50nM) (Fig 2F). When analyzing uptake of AM-AF568 by FACS in either unstimulated or TNFα/IFNγ stimulated LECs, MFIs were strongly increased at 500nM and 1μM concentrations (Fig 2G and 2H), as compared to 50nM (Fig 2C). However, also at these high concentrations, CCX771 treatment did not reduce AM-AF566 scavenging (Fig 2G and 2H), suggesting that the cellular uptake observed by confocal microscopy (Fig 2E and [31]) was not dependent on ACKR3.

ShRNA-mediated knockdown of ACKR3 does not impede AM internalization and uptake

To exclude the possibility that CCX771 and chemokines bind ACKR3 at a different site compared to AM and consequently might not compete with the AM scavenging function of ACKR3, we decided to knockdown ACKR3 expression in LECs by lentiviral transduction with shRNA. ACKR3 knockdown was performed in both adLECs and jdLECs using three different ACKR3-targeting shRNA-sequences (shRNA A-C). qRT-PCR-based analysis revealed that shRNA clones B and C effectively reduced Ackr3 mRNA expression in unstimulated or TNFα/IFNγ stimulated LECs, while no reduction could be achieved with clone A (S2 Fig). The qRT-PCR-based results nicely correlated with the CXCL11/12-AF647 scavenging function, which was significantly reduced in TNFα/IFNγ stimulated adLECs treated with shRNAs B and C, but not in untreated adLECs (Ctrl) or adLECs treated with the ineffective shRNA clone A (Fig 3A). In contrast, when in parallel performing uptake experiments with AM-AF568, we did not detect any difference in the MFI between TNFα/IFNγ stimulated ACKR3-sufficient (i.e. Ctrl adLECs or adLECs treated with shRNA A) and ACKR3 knockdown adLECs (i.e. adLECs treated with shRNA clone B and C) (Fig 3B). Similarly, shRNA mediated knockdown of ACKR3 with shRNA clone C resulted in a significantly reduced uptake of CXCL11/12-AF647 but did not reduce AM-AF568 uptake in jdLECs (Fig 3C and 3D). Surprisingly, knockdown of ACKR3 with shRNA B resulted in a less robust reduction in CXCL11/12-AF647 uptake (Fig 3C), indicating that this knockdown was less robust as the one achieved with shRNA clone C. Since we could not detect any evidence of ACKR3-mediated scavenging when working with 50nM AM-AF568 (Fig 3B and 3D), we repeated the uptake experiments in TNFα/IFNγ stimulated jdLECs using a 10-fold higher concentration of 500nM AM-AF568. However, also at this concentration, no difference in the MFI of AM-568 uptake was observed between ACKR3-sufficient and ACKR3-deficient jdLECs (Figs 3E and S3).

Fig 3 — adLECs and jdLECs were transduced with ACKR3-specific shRNA constructs (A: no knockdown, B,C; 50–80% knockdown–see S3 Fig), scrambled shRNA (shRNA Ctrl) or untransduced control LECs (Ctrl). Cells were stimulated by overnight incubation with TNFα/IFNγ. Subsequently, cells were incubated with either CXCL11/12-AF647 (50nM) or AM-AF568 (50nM) and uptake analysed by flow cytometry. While CXCL11/12-AF647 scavenging correlated with ACKR3 knockdown in (A) adLECs and (C) jdLECs, no impact of ACKR3 levels on AM-AF568 scavenging was observed in (B) adLECs and (D) jdLECs. (E) Also when performing the experiment with 500nM AM-AF568, no impact of ACKR3-knockdown on scavenging was observed. Data from three or four independent experiments are shown as mean ±SD. Each data point represents one replicate. Two-way ANOVA, followed by Tukey’s multiple comparison test **(A, C)**. Mixed effects model, followed by Tukey’s multiple comparison test, was applied, when repeated measures pairing was incomplete, due to subclone availability **(B, D, E)**. A p-value of p≥0.05 was considered not significant (ns).

To exclude any bias that might have been induced by the TNFα/IFNγ stimulation, we also repeated the side-by-side uptake experiments with CXCL11/12-AF647 and AM-AF568 in unstimulated shRNA-transduced adLECs and jdLECs, but also under these conditions no evidence for ACKR3 mediated AM scavenging was observed (S4 Fig). In summary, we did not observe any difference in AM-AF568 scavenging in ACKR3-shRNA silenced human LECs from two different sources as compared to ACKR3-sufficient controls. However, we observed that human LECs were able to take up residual amounts of AM-AF568 independently of ACKR3, likely by internalization mediated by canonical AM1 or AM2 receptors [31, 35].

AM-mediated proliferation is not enhanced upon treatment with CCX771 or shRNA-mediated knockdown of ACKR3

According to the current model, LEC-expressed ACKR3 is thought to prevent overshooting responses of LECs towards AM. Consequently, one would expect stronger AM-induced responses to occur in absence of ACKR3, as a consequence of increased AM availability and signalling via AM1 (CALCRL:RAMP2) or AM2 (CALCRL:RAMP3) [14]. To investigate whether in our hands modulation of ACKR3 would impact LEC responsiveness towards AM (Fig 4A), we performed proliferation assays in presence of the ACKR3-selective competitive agonist CCX771 or upon shRNA-mediated knockdown of ACKR3. Treatment with CCX771 (1μM) by itself did not alter basal ndLEC proliferation (Fig 4B) and did not enhance LEC proliferation in response to AM concentrations ranging from 0.01 – 10nM (Fig 4C). Moreover, in contrast to published results [14], we did not observe that shRNA-mediated ACKR3 knockdown (clones B,C) enhanced adLEC proliferation in response to AM, in comparison to the proliferative response observed in control LECs (Fig 4D and 4E). Similarly, no increased AM responsiveness was observed in jdLECs in which ACKR3 had been knocked down by shRNA treatment (clones B,C) (Fig 4F and 4G). Thus, despite observing some differences and inter-assay variability in baseline cell growth between the different shRNA-treated LECs and control-treated cells (Fig 4D and 4F), the relative AM responsiveness of ACKR3-deficient was not increased as compared to ACKR3-sufficient LECs (Fig 4E and 4G). In summary, we did not observe that AM-induced proliferation was enhanced upon pharmacologic blockade or shRNA-mediated knockdown of ACKR3 in human LECs obtained from three different sources (i.e. ndLECs, jdLECs or adLECs).

Fig 4 — (A) Titration of AM in a LEC proliferation assay. Data from one out of two similar titration assays, performed with ndLECs and adLECs with 10 technical replicates per condition, are shown. (B) Treatment with CCX771 does not affect baseline proliferation of ndLECs. (C) CCX771 treatment does not alter AM-induced proliferation of primary human ndLECs. Data of three experiments with 10 technical replicates are shown in (B,C) and represented as mean ±SD. RM One-way ANOVA, Šídák’s multiple comparison test. (D) shRNA-mediated knockdown of ACKR3 does not alter proliferation induced by either 0.1nM, 1nM and 10nM AM in adLECs. Data of one out of one or two similar experiments with 10 technical replicates per condition are shown. (E) Data from (D) are shown as percentage of proliferation induced when compared to the corresponding untreated control. (**F, G)** Proliferation induced by 1nM AM was investigated in shRNA-transduced jdLECs. Data of three experiments are shown and represented as mean ±SD. Each data point represents the mean of 8 technical replicates, showing (F) Absolute fluorescence units as a readout of proliferation or (G) Percentage of proliferation induction relative to the untreated control. Statistics: Two-way ANOVA, Šídák’s multiple comparison test (D,E). RM-Two-way ANOVA, Šídák’s multiple comparison test (F,G). A p-value of p≥0.05 was considered not significant (ns).

AM-AF568 uptake in HEK293 cells exclusively depends on CALCRL and RAMP2/3 expression but not on ACKR3 expression

AM exerts its biological effects, such as induction of proliferation, by binding to its conventional receptors AM1 (CALCRL:RAMP2) and AM2 (CALCRL:RAMP3) [17]. Moreover, stimulation with AM was shown to induce AM internalization in complex with AM1 and AM2 [31, 35]. To exclude that in our primary LECs the ACKR3-dependency of AM-AF568 internalization was masked by stronger AM-AF568 binding/ internalization via LEC-expressed AM1 or AM2, we decided to test AM scavenging in a system with controlled CALCRL, RAMP2 or RAMP3 and ACKR3 expression. To this end, we made use of HEK293 cells stably transfected with ACKR3 bearing a hemagglutinin (HA) tag at its N-terminus (HEK293-ACKR3). ACKR3 expression was confirmed in HEK293-ACKR3 cells by flow cytometry (Fig 5A). Notably, neither the untransfected HEK293 control cells (ACKR3-CTRL) nor HEK293-ACKR3 cells expressed endogenous levels of Ramp2 or Calcrl, as shown by qRT-PCR (S5 Fig). While stably transfected HEK293-ACKR3 cells scavenged CXCL11/12-AF647 (50nM) in comparison to HEK293-CTRL (Fig 5B and 5C), both cell types failed to scavenge AM-AF568 (50nM) (Fig 5D and 5E). We next transiently transfected both HEK293-CTRL and HEK293-ACKR3 cells with plasmids encoding CALCRL C-terminally fused to GFP (CALCRL-GFP) and RAMP2 N-terminally expressing a FLAG tag (RAMP2-FLAG) or a combination of both and subsequently performed AM-AF568 uptake experiments in these cell lines. Similarly, to the baseline HEK293-CTRL and HEK293-ACKR3 cells, neither RAMP2-FLAG nor CALCRL-GFP single-transfectants displayed any AM-AF568 internalization (Fig 5F). Conversely, in RAMP2-FLAG/ CALCRL-GFP double-transfected HEK293-CTRL and HEK293-ACKR3 cells, approximately 20% of all cells were positive for AM-AF568 (Fig 5F). Thus, the ability to internalize/ scavenge AM did not depend on the expression of ACKR3 but exclusively on expression of both AM1 receptor components (Fig 5F). Indeed, analysis by flow cytometry revealed that cells that had internalized AM-AF568 expressed RAMP2-FLAG on their surface and were, at the same time, positive for CALCRL-GFP (S5 Fig).

Fig 5 — (A) ACKR3 is expressed in HEK293-ACKR3 but not in HEK293-CTRL cells. Antibody staining with anti-human ACKR3 (clone 11G8). (**B-E**) HEK293-ACKR3 or HEK293-CTRL cells were incubated with CXCL11/12-AF647 or AM-AF568 at either 4°C or 37°C and uptake activity was quantified by flow cytometry. While (**B, C**) CXCL11/12-AF647 was avidly scavenged by HEK293-ACKR3 cells, (**D, E**) no evidence of uptake was observed for AM-AF568 in HEK293-ACKR3 cells. (A,B,D) Representative Histograms. (C,E) Pooled measurements of 3–4 independent experiments are shown as mean ±SD. Statistics: Paired Student’s t-test. (**F, G**) HEK293-ACKR3 or HEK293-CTRL cells were transiently transfected with CALCRL, RAMP2 or RAMP3 encoding plasmids and combinations thereof and AM-AF568 uptake was investigated by flow cytometry. AM-AF568 internalization was exclusively dependent on co-expression of CALCRL with (F) RAMP2 or (G) RAMP3, regardless of ACKR3 expression. (F,G) Pooled measurements from 4 independent experiments are shown as mean ±SD. RM two-way ANOVA , Šídáks multiple comparison test. A p-value of p≥0.05 was considered not significant (ns).

In addition to RAMP2 [36] also expression of RAMP3, which forms part of the AM2 receptor, was previously reported in isolated LECs and BECs [38, 39]. Moreover, RAMP3 has recently been implicated in ACKR3-mediated scavenging of AM [38]. Therefore, to investigate whether ACKR3’s scavenging activity might depend on the expression of RAMP3, we also assessed AM scavenging in HEK293-CTRL and HEK293-ACKR3 cells transiently transfected with CALCRL-GFP, RAMP3-FLAG or both constructs. Similarly, to what we had seen in the case of RAMP2-FLAG transfectants (Fig 5F), only HEK293-CTRL and HEK293-ACKR3 cells double-transfected with CALCRL-GFP and RAMP3-FLAG were capable of internalizing AM-AF568 (Figs 5G and S5). Again, the efficiency of AM-AF568 uptake/ internalization did not depend on the presence of ACKR3 (Fig 5G).

In summary, in our hands, ACKR3 expression did not contribute to AM scavenging/ internalization, neither in primary human LECs nor in ACKR3-overexpressing HEK293 cells.

Discussion

In this study, we further examined the prevailing concept that ACKR3 functions as scavenger of the vascular peptide hormone AM in LECs, thereby helping to prevent excessive AM-induced lymphangiogenic responses. To this end, we performed in vitro experiments in primary human LECs, which endogenously express ACKR3 and proliferate in response to AM, as well as in HEK293 cells transfected with combinations of ACKR3 and/ or components of the AM receptors AM1 and AM2. While our experiments provided ample evidence of proliferation and/or internalization induced by AM binding to canonical AM receptors, none of our readouts supported the conclusion that ACKR3 acts as a cell-intrinsic AM scavenger at concentrations at which AM-induced proliferation in LECs is observed.

Whether or not ACKR3 binds and scavenges AM has been a topic of recurrent debate over the past years. Initial evidence had been gathered more than 20 years ago, when AM stimulation of the orphan canine RDC-1 receptor (now known as ACKR3) over-expressed in COS-7 cells was found to elicit a dose-dependent cAMP response with an EC₅₀ of 100nM [2]. Although several other putative AM receptors were brought forward at the time [40], AM1 and AM2, consisting of CALCRL in complex with either RAMP2 or RAMP3, were subsequently discovered as high affinity receptors of human AM, with reported binding affinities in the low nanomolar range [41]. New evidence for the receptor-ligand relationship of AM and ACKR3 was only published in 2014, when Klein et al. proposed ACKR3 as an AM scavenger, based on the striking phenotypic interrelationship between ACKR3-deficient and AM-overexpressing mouse embryos and overshooting in vitro responses of ACKR-deficient LECs towards AM [14]. In further support of this concept, two recent studies reported that stimulation with micromolar concentrations of AM induced β-arrestin recruitment to ACKR3 in ACKR3-overexpressing HEK293, indicative of binding but not necessarily scavenging [24, 38]. On the other hand, two additional studies found that AM was not capable of displacing fluorescent CXCL12 from ACKR3 in ligand competition assays, performed with either ACKR3-overexpressing U87 or HEK293 cells [23, 24]. In agreement with the latter results, the ligand competition assay performed in our study with primary human LECs also revealed that CXCL11/12-AF647 scavenging was not diminished in presence of a 200-fold excess amount of AM (10μM). Furthermore, we could not identify any evidence of ACKR3-dependent AM scavenging in human LECs when performing experiments at AM concentrations ranging from 50nM– 1μM.

Considering that β-arrestin recruitment was only observed in response to micromolar AM concentrations [24, 38], we cannot rule out that ACKR3-mediated AM scavenging in LECs might only be observable at even higher concentrations of AM than the ones used in our assays (up to 1μM). However, as previously reported, AM induces LEC proliferation, migration or ERK phosphorylation in LECs at optimal concentrations ranging from of 0.1 – 100nM [14, 15], as also seen in our experiments, where LEC proliferation was induced in presence of as little as 0.1nM AM (Fig 4A).Therefore, the AM concentrations triggering cellular responses in LECs appear to be at least two log units lower than the concentration at which AM binding to ACKR3 reportedly occurs [24, 38]. This makes it rather unlikely that ACKR3 might directly function as a physiological cell-intrinsic scavenger, regulating bioavailability of AM towards LEC-expressed AM receptors. In fact, in order to function as competitive cell-intrinsic scavenger, a receptor would be expected to display comparable if not increased affinity for its ligand in comparison to the conventional receptor competing for ligand binding. In agreement with this basic principle, ACKR3 exhibits comparable or higher affinity for its chemokine ligands CXCL11 and CXCL12 in comparison to the chemokines’ affinity towards their conventional chemokine receptors CXCR3 and CXCR4, respectively [5, 42]. In light of these considerations, it seems perhaps not so surprising that we could not observe any evidence of enhanced LEC proliferation towards AM (0.1 – 10nM tested) upon pharmacologic inhibition of ACKR3 or lentiviral knockdown of ACKR3 expression. Although we consistently obtained the same results in experiments performed with different shRNAs and LEC cell types (adLECs and jdLECs, Fig 4A–4D), we cannot exclude that the reason why different results, namely, enhanced AM-induced proliferation upon shRNA-mediated knockdown of ACKR3, were observed by Klein et al. [14] might lie in the different cellular source and shRNA clone used in these experiments.

Nonetheless, it remains possible that ACKR3 might indirectly affect AM responses mediated by conventional AM receptors, by e.g. competing with the binding of accessory molecules such as β-arrestins and G-protein-coupled receptor kinases (GRKs) required for optimal AM signaling and internalization. Intriguingly, overexpression studies in HEK293 cells have recently revealed that RAMP2 and RAMP3 associate with many chemokine receptors, including ACKR3 [38]. Specifically, association of RAMP3 with ACKR3 was shown to influence vesicular trafficking of ACKR3 following AM-induced internalization and rapid receptor recycling and re-sensitization [38]. On the other hand, our experiments performed in HEK293-CTRL or HEK293-ACKR3 cells revealed that internalization of AM-AF568 exclusively depended on the expression of CALCRL together with either RAMP2 or RAMP3, but was completely independent of ACKR3 expression. Notably, these findings are in line with Meyrath et al, who reported that AM-induced β-arrestin recruitment was not altered by co-expression of RAMPs together with ACKR3 in HEK293 cells [9].

Our current findings indicating that ACKR3 displays no—or at best poor–cell-intrinsic AM scavenging activity in LECs is further supported by a recent study from our lab showing that conditional knockdown of ACKR3 in LECs in newborn mouse pups did not impact postnatal lymphatic development and lymphatic drainage [25]. Despite the findings from our previous [25] and the present study, it remains possible that the impressive lymphatic hyperproliferation and edema phenotype observed in global ACKR3 knockout embryos, which lack ACKR3 expression not only in LECs but in many other cell types, is in some way caused by altered signalling induced by AM, its receptors or potentially even by related, AM-derived vasoactive peptides: of interest in this context, PAMP-12, a derivative of the proadrenomedullin N-terminal 20 peptide (PAMP), was recently found to bind ACKR3 with nanomolar affinity, inducing β-arrestin recruitment and receptor internalization in ACKR3-expressing HEK293 cells [24]. Notably, AM and PAMPs derive from the same pro-adrenomedullin precursor [43]. Although a G-protein coupled receptor (RMGPRX2 [44]) has been identified as a receptor of PAMPs including PAMP12, the physiologic functions of PAMP12 remain largely unknown [24]. The fact that both AM and PAMP-12 are encoded by the adrenomedullin locus adds an additional layer of complexity to the phenotypic observations made in in vivo models of AM knockout or overexpression. It will therefore remain important to further dissect the complex relationship between ACKR3, AM receptors and pro-adrenomedullin derivatives, to hopefully better understand the striking phenotypic similarity observed between ACKR3-deficient and AM-overexpressing mouse embryos [14].

Supporting information

S1 Fig. Characterization of LECs used in experiments.

(A) FACS analysis showing expression of CD31 and podoplanin in ndLECs, jdLECs and adLECs. (B) qRT-PCR was performed to investigate Ackr3 mRNA expression in steady-state (unstim) and TNFα/ IFN® stimulated (stim) ndLECs, jdLECs and adLECs. Prox-1 levels were determined for comparison. CT values are shown on the left and resulting fold-changes on the right. (C-F) ACKR3 protein expression was not detectable in resting ndLECs (unstim) by flow cytometry, but could be detected on the ndLEC cell surface after TNFα/ IFNγstimulation (stim). Staining was performed with two different anti-ACKR3 antibodies, i.e. with (C, D) clone 9C4 and (E, F) clone 11G8. Representative histograms are shown in (C,E) and quantifications of 3–4 independent experiments in (D,E). Each dot represents the ΔMFI value (normalized to the isotype control) from one staining. Student’s t-test. (G) qRT-PCR was performed to investigate Calcrl, Ramp2 and Ramp3 mRNA expression in steady-state (Ctrl) and TNFα/ IFN® stimulated (stim) ndLECs, jdLECs and adLECs. Data from 1 RNA extraction and 3 technical replicates are shown in (B,G). Statistical analysis performed in (B,G): One sample t test.

(TIF)

Click here for additional data file.^{(1.4MB, tif)}

S2 Fig. qRT-PCR-based characterization of shRNA-transduced adLECs and jdLECs.

Validation of shRNA-mediated ACKR3 knockdown in lentivirally transduced and subsequently sorted adLECs and jdLECs, in comparison to untransduced (Ctrl) or scrambled RNA-transduced (shRNA Ctrl) cells. (A) Knockdown efficiency in steady-state adLECs was analysed at p6, shortly, after sorting and p9, after all experiments were performed. (B) Knockdown efficiency in resting jdLECs at p8. (C) Knockdown efficiency in TNFα/IFN® stimulated shRNA-transduced jdLECs at p8. Each data point represents the normalized relative expression calculated from three technical replicates per repetition.

(TIF)

Click here for additional data file.^{(528KB, tif)}

S3 Fig. Knockdown of ACKR3 in jdLECs prevents CXCL11/12-AF647 scavenging but does not impact AM-AF568 internalization.

Sorted jdLECs (p7), transduced with either scrambled control shRNA or ACKR3-targeting scRNA construct C, were first starved, then stimulated for 24h with 20ng TNFα/ IFN® or left untreated. Uptake assays were performed with AM-AF568 (500nM) or CXCL11/12-AF647 (50 nM). (A, B) Representative images of (A) CXCL11/12-AF647 and (B) AM-AF568 uptake performed in unstimulated (Ctrl) jdLECs. (C, D) Representative images of 2 uptake experiments performed with (C) CXCL11/12-AF647 and (D) AM-AF568 in TNFα/IFNγ stimulated jdLECs. Scale bars: 10μm.

(TIF)

Click here for additional data file.^{(3.4MB, tif)}

S4 Fig. shRNA-mediated knockdown of ACKR3 does not diminish AM uptake in unstimulated primary adLECs or jdLECs.

adLECs and jdLECs were transduced with ACKR3-specific shRNA constructs (A: no knockdown, B,C; 50–80% knockdown–see S2 Fig), scrambled shRNA (shRNA Ctrl) or untransduced control LECs (Ctrl). For uptake assays, cells were incubated with either CXCL11/12-AF647 (50nM) or AM-AF568 (50nM) and uptake analysed by FACS. While CXCL11/12-AF647 scavenging correlated with ACKR3 knockdown in (A) adLECs and (C) jdLECs, no impact of ACKR3 levels on AM-AF568 scavenging was observed in (B) adLECs and (D) jdLECs. (E) Also, when performing the experiment with 500nM AM-AF568, no impact of ACKR3-knockdown on scavenging was observed. Data from three or four independent experiments are shown as mean ±SD. Each data point represents one replicate. Statistics: Two-way ANOVA, followed by Tukey’s multiple comparison test (C). A mixed effects model, followed by Tukey’s multiple comparison test, was applied in all other cases, due to incomplete repeated measures-pairing (A, B, D, E). A p-value of p≥0.05 was considered not significant (ns).

(TIF)

Click here for additional data file.^{(935.6KB, tif)}

S5 Fig. Validation of the HEK293 overexpression system.

(A, B) Analysis of mRNA expression in untransfected HEK293 control (HEK293-CTRL) and HEK293-ACKR3 cells indicated no endogenous expression of Ackr3, Calcrl or Ramp2 in HEK293-CTRL cells. (A) Comparative mRNA expression between HEK293-CTRL and HEK293-ACKR3 cells. Data are shown as mean ±SD. (B) Fold change. Values from one qRT-PCR experiment, with three technical replicates are shown. (C, D) FACS plots of uptake experiments performed in presence of 50nM AM-AF568 in HEK293-CTRL and HEK293-ACKR3 cells transiently transfected with (C) CALCLRL-GFP and RAMP2-FLAG or with (D) CALCLRL-GFP and RAMP3-FLAG. Back-gating (dot plot on right) demonstrated that AM-AF568 was exclusively scavenged by cells co-expressing both constructs. Representative Dot plots of one out of four independent experiments are shown in (C, D).

(TIF)

Click here for additional data file.^{(551.1KB, tif)}

Acknowledgments

The authors thank Thomas Schall (ChemoCentryx Inc., Mountain View, CA, USA) for providing CCX771. Moreover, they thank Angela Vallone, Lilian Baur and Katharina Blatter for excellent technical assistance.

Data Availability

All relevant data are within the paper and its Supporting Information files. Raw data are available on the ETH research collection (http://hdl.handle.net/20.500.11850/610801). The DOI is as follows: 10.3929/ethz-b-000610801

Funding Statement

Swiss National Science Foundation (https://www.snf.ch/en) Sinergia program (CRSII3_160719 / 1) for CH, MT, DF (Cornelia Halin, Marcus Thelen, Daniel Legler) ETH Zurich Core Funding for CH (Cornelia Halin)

References

1.Balabanian K, Lagane B, Infantino S, Chow KYC, Harriague J, Moepps B, et al. The chemokine SDF-1/CXCL12 binds to and signals through the orphan receptor RDC1 in T lymphocytes. Journal of Biological Chemistry. 2005;280(42):35760–6. doi: 10.1074/jbc.M508234200 [DOI] [PubMed] [Google Scholar]
2.Kapas S, Clark AJL. Identification of an orphan receptor gene as a type 1 calcitonin gene-related peptide receptor. Biochem Bioph Res Co. 1995;217(3):832–8. doi: 10.1006/bbrc.1995.2847 [DOI] [PubMed] [Google Scholar]
3.Bonecchi R, Graham GJ. Atypical Chemokine Receptors and Their Roles in the Resolution of the inflammatory Response. Front Immunol. 2016;7. doi: 10.3389/fimmu.2016.00224 [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Quinn KE, Mackie DI, Caron KM. Emerging roles of atypical chemokine receptor 3 (ACKR3) in normal development and physiology. Cytokine. 2018;109:17–23. doi: 10.1016/j.cyto.2018.02.024 [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Burns JM, Summers BC, Wang Y, Melikian A, Berahovich R, Miao Z, et al. A novel chemokine receptor for SDF-1 and I-TAC involved in cell survival, cell adhesion, and tumor development. J Exp Med. 2006;203(9):2201–13. doi: 10.1084/jem.20052144 [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Cruz-Orengo L, Holman DW, Dorsey D, Zhou L, Zhang P, Wright M, et al. CXCR7 influences leukocyte entry into the CNS parenchyma by controlling abluminal CXCL12 abundance during autoimmunity. Journal of Experimental Medicine. 2011;208(2):327–39. doi: 10.1084/jem.20102010 [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Zabel BA, Wang Y, Lewen S, Berahovich RD, Penfold ME, Zhang P, et al. Elucidation of CXCR7-mediated signaling events and inhibition of CXCR4-mediated tumor cell transendothelial migration by CXCR7 ligands. J Immunol. 2009;183(5):3204–11. Epub 2009/07/31. doi: 10.4049/jimmunol.0900269 [DOI] [PubMed] [Google Scholar]
8.Raz E, Boldajipour B, Mahabaleshwar H, Kardash E, Reichman-Fried M, Blaser H, et al. Control of chemokine-guided cell migration by ligand sequestration. Cell. 2008;132. doi: 10.1016/j.cell.2007.12.034 [DOI] [PubMed] [Google Scholar]
9.Meyrath M, Szpakowska M, Zeiner J, Massotte L, Merz MP, Benkel T, et al. The atypical chemokine receptor ACKR3/CXCR7 is a broad-spectrum scavenger for opioid peptides. Nat Commun. 2020;11(1):3033. Epub 2020/06/21. doi: 10.1038/s41467-020-16664-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Ikeda Y, Kumagai H, Skach A, Sato M, Yanagisawa M. Modulation of circadian glucocorticoid oscillation via adrenal opioid-CXCR7 signaling alters emotional behavior. Cell. 2013;155(6):1323–36. Epub 2013/12/10. doi: 10.1016/j.cell.2013.10.052 [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Gerrits H, Schenau DSVI, Bakker NEC, van Disseldorp AJM, Strik A, Hermens LS, et al. Early postnatal lethality and cardiovascular defects in CXCR7-deficient mice. Genesis. 2008;46(5):235–45. doi: 10.1002/dvg.20387 PubMed PMID: WOS:000256631300001. [DOI] [PubMed] [Google Scholar]
12.Sierro F, Biben C, Martinez-Munoz L, Mellado M, Ransohoff RM, Li M, et al. Disrupted cardiac development but normal hematopoiesis in mice deficient in the second CXCL12/SDF-1 receptor, CXCR7. P Natl Acad Sci USA. 2007;104(37):14759–64. doi: 10.1073/pnas.0702229104 [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Yu SH, Crawford D, Tsuchihashi T, Behrens TW, Srivastava D. The Chemokine Receptor CXCR7 Functions to Regulate Cardiac Valve Remodeling. Dev Dynam. 2011;240(2):384–93. doi: 10.1002/dvdy.22549 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Klein KR, Karpinich NO, Espenschied ST, Willcockson HH, Dunworth WP, Hoopes SL, et al. Decoy receptor CXCR7 modulates adrenomedullin-mediated cardiac and lymphatic vascular development. Dev Cell. 2014;30(5):528–40. Epub 2014/09/10. doi: 10.1016/j.devcel.2014.07.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Jin D, Harada K, Ohnishi S, Yamahara K, Kangawa K, Nagaya N. Adrenomedullin induces lymphangiogenesis and ameliorates secondary lymphoedema. Cardiovasc Res. 2008;80(3):339–45. Epub 2008/08/19. doi: 10.1093/cvr/cvn228 [DOI] [PubMed] [Google Scholar]
16.Dunworth WP, Fritz-Six KL, Caron KM. Adrenomedullin stabilizes the lymphatic endothelial barrier in vitro and in vivo. Peptides. 2008;29(12):2243–9. Epub 2008/10/22. doi: 10.1016/j.peptides.2008.09.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Fischer JP, Els-Heindl S, Beck-Sickinger AG. Adrenomedullin—Current perspective on a peptide hormone with significant therapeutic potential. Peptides. 2020;131:170347. Epub 2020/06/23. doi: 10.1016/j.peptides.2020.170347. [DOI] [PubMed] [Google Scholar]
18.Francois M, Oszmiana A, Harvey NL. When form meets function: the cells and signals that shape the lymphatic vasculature during development. Development. 2021;148(11). doi: 10.1242/dev.167098 [DOI] [PubMed] [Google Scholar]
19.Farnsworth RH, Karnezis T, Maciburko SJ, Mueller SN, Stacker SA. The Interplay Between Lymphatic Vessels and Chemokines. Front Immunol. 2019;10. doi: 10.3389/fimmu.2019.00518 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Vaahtomeri K, Karaman S, Makinen T, Alitalo K. Lymphangiogenesis guidance by paracrine and pericellular factors. Gene Dev. 2017;31(16):1615–34. doi: 10.1101/gad.303776.117 [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Wang C, Chen WL, Shen JZ. CXCR7 Targeting and Its Major Disease Relevance. Front Pharmacol. 2018;9. doi: 10.3389/fphar.2018.00641 [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Dieterich LC, Detmar M. Tumor lymphangiogenesis and new drug development. Adv Drug Deliver Rev. 2016;99:148–60. doi: 10.1016/j.addr.2015.12.011 [DOI] [PubMed] [Google Scholar]
23.Szpakowska M, Nevins AM, Meyrath M, Rhainds D, D’Huys T, Guite-Vinet F, et al. Different contributions of chemokine N-terminal features attest to a different ligand binding mode and a bias towards activation of ACKR3/CXCR7 compared with CXCR4 and CXCR3. Br J Pharmacol. 2018;175(9):1419–38. Epub 2017/12/23. doi: 10.1111/bph.14132 [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Meyrath M, Palmer CB, Reynders N, Vanderplasschen A, Ollert M, Bouvier M, et al. Proadrenomedullin N-Terminal 20 Peptides (PAMPs) Are Agonists of the Chemokine Scavenger Receptor ACKR3/CXCR7. ACS Pharmacol Transl Sci. 2021;4(2):813–23. Epub 2021/04/17. doi: 10.1021/acsptsci.1c00006 [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Sigmund EC, Baur L, Schineis P, Arasa J, Collado-Diaz V, Vranova M, et al. Lymphatic endothelial-cell expressed ACKR3 is dispensable for postnatal lymphangiogenesis and lymphatic drainage function in mice. Plos One. 2021;16(4). doi: 10.1371/journal.pone.0249068 [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Gustavsson M, Wang L, van Gils N, Stephens BS, Zhang P, Schall TJ, et al. Structural basis of ligand interaction with atypical chemokine receptor 3. Nat Commun. 2017;8:14135. Epub 2017/01/18. doi: 10.1038/ncomms14135 [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Ducoli L, Agrawal S, Sibler E, Kouno T, Tacconi C, Hon CC, et al. LETR1 is a lymphatic endothelial-specific lncRNA governing cell proliferation and migration through KLF4 and SEMA3C. Nat Commun. 2021;12(1):925. Epub 2021/02/12. doi: 10.1038/s41467-021-21217-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Infantino S, Moepps B, Thelen M. Expression and regulation of the orphan receptor RDC1 and its putative ligand in human dendritic and B cells. J Immunol. 2006;176(4):2197–207. Epub 2006/02/04. doi: 10.4049/jimmunol.176.4.2197 [DOI] [PubMed] [Google Scholar]
29.Wootten D, Lindmark H, Kadmiel M, Willcockson H, Caron KM, Barwell J, et al. Receptor activity modifying proteins (RAMPs) interact with the VPAC2 receptor and CRF1 receptors and modulate their function. Br J Pharmacol. 2013;168(4):822–34. Epub 2012/09/06. doi: 10.1111/j.1476-5381.2012.02202.x [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Qi T, Dong M, Watkins HA, Wootten D, Miller LJ, Hay DL. Receptor activity-modifying protein-dependent impairment of calcitonin receptor splice variant Delta(1–47)hCT((a)) function. Br J Pharmacol. 2013;168(3):644–57. Epub 2012/09/06. doi: 10.1111/j.1476-5381.2012.02197.x [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Schönauer R, Kaiser A, Holze C, Babilon S, Kobberling J, Riedl B, et al. Fluorescently labeled adrenomedullin allows real-time monitoring of adrenomedullin receptor trafficking in living cells. J Pept Sci. 2015;21(12):905–12. Epub 2016/01/16. doi: 10.1002/psc.2833 [DOI] [PubMed] [Google Scholar]
32.Ameti R, Melgrati S, Radice E, Cameroni E, Hub E, Thelen S, et al. Characterization of a chimeric chemokine as a specific ligand for ACKR3. J Leukoc Biol. 2018;66:1. doi: 10.1002/JLB.2MA1217-509R [DOI] [PubMed] [Google Scholar]
33.Berahovich RD, Zabel BA, Penfold ME, Lewen S, Wang Y, Miao Z, et al. CXCR7 protein is not expressed on human or mouse leukocytes. J Immunol. 2010;185(9):5130–9. Epub 2010/10/05. doi: 10.4049/jimmunol.1001660 [DOI] [PubMed] [Google Scholar]
34.Luker KE, Steele JM, Mihalko LA, Ray P, Luker GD. Constitutive and chemokine-dependent internalization and recycling of CXCR7 in breast cancer cells to degrade chemokine ligands. Oncogene. 2010;29. doi: 10.1038/onc.2010.212 [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Kuwasako K, Shimekake Y, Masuda M, Nakahara K, Yoshida T, Kitaura M, et al. Visualization of the calcitonin receptor-like receptor and its receptor activity-modifying proteins during internalization and recycling. J Biol Chem. 2000;275(38):29602–9. Epub 2000/07/07. doi: 10.1074/jbc.M004534200 [DOI] [PubMed] [Google Scholar]
36.Fritz-Six KL, Dunworth WP, Li M, Caron KM. Adrenomedullin signaling is necessary for murine lymphatic vascular development. J Clin Invest. 2008;118(1):40–50. Epub 2007/12/22. doi: 10.1172/JCI33302 ; [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Miyashita K, Itoh H, Sawada N, Fukunaga Y, Sone M, Yamahara K, et al. Adrenomedullin promotes proliferation and migration of cultured endothelial cells. Hypertens Res. 2003;26 Suppl:S93–8. Epub 2003/03/13. doi: 10.1291/hypres.26.s93 [DOI] [PubMed] [Google Scholar]
38.Mackie DI, Nielsen NR, Harris M, Singh S, Davis RB, Dy D, et al. RAMP3 determines rapid recycling of atypical chemokine receptor-3 for guided angiogenesis. Proc Natl Acad Sci U S A. 2019;116(48):24093–9. Epub 2019/11/13. doi: 10.1073/pnas.1905561116 [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Yamauchi A, Sakurai T, Kamiyoshi A, Ichikawa-Shindo Y, Kawate H, Igarashi K, et al. Functional differentiation of RAMP2 and RAMP3 in their regulation of the vascular system. J Mol Cell Cardiol. 2014;77:73–85. Epub 2014/09/30. doi: 10.1016/j.yjmcc.2014.09.017 [DOI] [PubMed] [Google Scholar]
40.Hay DL, Smith DM. Adrenomedullin receptors: molecular identity and function. Peptides. 2001;22(11):1753–63. doi: 10.1016/s0196-9781(01)00532-0 [DOI] [PubMed] [Google Scholar]
41.McLatchie LM, Fraser NJ, Main MJ, Wise A, Brown J, Thompson N, et al. RAMPs regulate the transport and ligand specificity of the calcitonin-receptor-like receptor. Nature. 1998;393(6683):333–9. doi: 10.1038/30666 [DOI] [PubMed] [Google Scholar]
42.Cole KE, Strick CA, Paradis TJ, Ogborne KT, Loetscher M, Gladue RP, et al. Interferon-inducible T cell alpha chemoattractant (I-TAC): A novel non-ELR CXC chemokine with potent activity on activated T cells through selective high affinity binding to CXCR3. Journal of Experimental Medicine. 1998;187(12):2009–21. doi: 10.1084/jem.187.12.2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Kitamura K, Sakata J, Kangawa K, Kojima M, Matsuo H, Eto T. Cloning and Characterization of Cdna-Encoding a Precursor for Human Adrenomedullin (Vol 194, Pg 720, 1993). Biochem Bioph Res Co. 1994;202(1):643-. doi: 10.1006/bbrc.1994.1976 [DOI] [PubMed] [Google Scholar]
44.Kamohara M, Matsuo A, Takasaki J, Kohda M, Matsumoto M, Matsumoto S, et al. Identification of MrgX2 as a human G-protein-coupled receptor for proadrenomedullin N-terminal peptides. Biochem Biophys Res Commun. 2005;330(4):1146–52. Epub 2005/04/13. doi: 10.1016/j.bbrc.2005.03.088 [DOI] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0285597.r001

Decision Letter 0

Gabriella Lupo

13 Feb 2023

PONE-D-23-00791

Reassessing the adrenomedullin scavenging function of ACKR3 in lymphatic endothelial cells

PLOS ONE

Dear Dr. Halin,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

One of the two reviewers asks for a minor revision and the second for a major revision, particularly on the part on the part concerning the experimental procedures followed for the construction and transfection of the plasmid.

Please submit your revised manuscript by Mar 30 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Gabriella Lupo

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Thank you for stating the following financial disclosure:

“C.H., M.T. and D.F. Legler gratefully acknowledge common financial support from the Swiss National Science Foundation (https://www.snf.ch/en) Sinergia program (CRSII3_160719 / 1) and C.H additional support (core funding) from ETH Zurich.”

Please state what role the funders took in the study. If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."

If this statement is not correct you must amend it as needed.

Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

3. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.

Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.

Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.

We will update your Data Availability statement to reflect the information you provide in your cover letter.

4. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.

5. Thank you for stating the following in the Acknowledgments Section of your manuscript:

“The authors thank Thomas Schall (ChemoCentryx Inc., Mountain View, CA, USA) for providing CCX771. Moreover, they thank Angela Vallone, Lilian Baur and Katharina Blatter for excellent technical assistance. C.H., M.T. and D.F. Legler gratefully acknowledge common financial support from the Swiss National Science Foundation (https://www.snf.ch/en) Sinergia program (CRSII3_160719 / 1) and C.H additional support from ETH Zurich.”

We note that you have provided additional information within the Acknowledgements Section that is not currently declared in your Funding Statement. Please note that funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: This manuscript from the Halin laboratory has reassessed the established notion (Klein et al. Dev Cell 2014) that ACKR3 acts as a scavenger of the opioid peptide adrenomedullin (AM) in LECs. They have convincingly demonstrated that, in their hands, ACKR3 does not have scavenging activity on AM at physiologically relevant concentrations either in primary LECs (from multiple sources) or transfected cell lines. They have used a combination of approaches to demonstrate this, including knock down of ACKR3 and an ACKR3-specific inhibitor. The experiments are generally well controlled and unequivocal. The manuscript is well-written, appropriately discussed and the data generally are well presented. There are a few concerns regarding statistical analysis, rigour and data interpretation that should be addressed prior to publication however.

1) Figure 1A: data is from a single experiment. This should be done more than once at a minimum.

2) Figure 1A and 1B: quantification and statistical analysis should be provided here.

3) Figure 2C: a direct statistical comparison between the MFI of the '37C AM-AF568' condition between the unstim and TNFa/IFNg groups should be provided to support the claim made on line 354 of the results.

4) Figure 4E and 4F: To show that the signal measured for AM/chemokine uptake in these assays is specific, a negative control should be provided (e.g. cells at 4C)

5) Figure 4H and 4I: the 50nM group depicted in these plots appears to be identical to the data shown in Figure 2C. This group should be removed from 4H and 4I to avoid this duplication.

6) It is notable that the data shown in Figure 4D and 4E appear to suggest that the KD of ACKR3 using shRNA 'C' has actually inhibited AM-induced LEC proliferation. While this is clearly the opposite of what would be expected based on the data published by Klein et al. Dev Cell 2014, the authors should discuss what might underly this.

7) Some of the p values being reported in the manuscript do not seem to match the distribution of data points as presented. Figure 4F (Ctrl: Ctrl v AM p=0.0010); Supp Figure 4C (Ctrl 37C v shRNA C 37C p=0.0004). Please clarify how these values have been computed.

8) Statistical tests and p values should be provided in Supp Fig 1B and SF1G to support claims made in the manuscript.

Minor: human gene names should be italicised all caps not lower case for annotation of genes in qPCR

Reviewer #2: In the study by Halin et Al., “Reassessing the adrenomedullin scavenging function of ACKR3 in lymphatic endothelial cells” the role of ACKR3 as scavenger of the vascular peptide hormone adrenomedullin (AM) was clarified. In this work, in vitro experiments were performed to evaluate the uptake of AM in primary human Lymphatic Endothelial Cells (LECs) and in ACKR3-overexpressing Human Epithelial Kidney (HEK) cells. The aim of this work was to verify a competition between the normal ACKR3-ligand CXCL11/12 and AM, to evaluate if this receptor can influence/reduce the AM proliferative effects on LECs. The Authors conclude that the AM does not compete with CXCL11/12 for ACKR3 binding, but it binds their canonical receptor (CALCRL and PAMP2/3. In my opinion this finding may have a relevance in this field, but major revisions are required.

The background should be improved, experimental procedures should be better described and rearranged. For example, first cell culture (including HEK cells), second the treatments and silencing on LECs, then the plasmid construction and transfection, finally the assay.

A few questions:

Why three type of LECs were used?

Why the coating was different between adLECs and nd- and jd-LECs?

The abbreviations should be uniformed and the same name should be used for the same protein, for example: ACKR3 was used throughout manuscript, but to indicate the antibody against this protein the CXCR/RDC-1 APC was used. The terms CXCL11/12-AF647 should be clarified as extended terms of CXCL; AF647 should be described as alexa flour 647; Atto 565 should be explained.

In the introduction, CCX771 should be described as an antagonist of ACKR3.

The description of the plasmids in the section “construction of expression plasmids for HEK293 cell transfection” should match with the description in the section “HEK293 cell transfection…”

In Figure1D, the error bars should be indicated in the graphic, which could be expanded to avoid the overlap between 37 °C ° and 37 °C + CCX771.

Please check and harmonize all the figures. For example, in fig 2D CXCL11/12 is reported as CXCl11/12; cell types are indicated in fig 3A, but not in fig 2.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Attachment

Submitted filename: Reviewer 1.pdf

Click here for additional data file.^{(61.8KB, pdf)}

Attachment

Submitted filename: Reviewer 2.pdf

Click here for additional data file.^{(61.2KB, pdf)}

PLoS One. 2023 May 30;18(5):e0285597. doi: 10.1371/journal.pone.0285597.r002

Author response to Decision Letter 0

20 Apr 2023

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf

and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

Response #1: We have updated the file names to fit PLOS ONE's style requirements.

2. Thank you for stating the following financial disclosure:

If this statement is not correct you must amend it as needed. Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

Response #2: The funders had not role in the study design. Thus, please include the suggested statement: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."

We will update your Data Availability statement to reflect the information you provide in your cover letter.

Response #3: The data presented in this study will be made openly available in the ETH Research Collection (https://www.research-collection.ethz.ch/) upon acceptance. At this point, we will be able to generate and receive a DOI.

Response #4: The data presented in this study will be made openly available in the ETH Research Collection (https://www.research-collection.ethz.ch/) upon acceptance. At this point, we will be able to generate and receive a DOI.

5. Thank you for stating the following in the Acknowledgments Section of your manuscript:

Response #5: We have removed the funding statement from the Acknowledgement section. The latter now reads as follows:

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

Response #5: The funding statement should remain unchanged:

Comments from the Reviewers:

Response to comments from Reviewer 1:

Reviewer #1: This manuscript from the Halin laboratory has reassessed the established notion (Klein et al. Dev Cell 2014) that ACKR3 acts as a scavenger of the opioid peptide adrenomedullin (AM) in LECs. They have convincingly demonstrated that, in their hands, ACKR3 does not have scavenging activity on AM at physiologically relevant concentrations either in primary LECs (from multiple sources) or transfected cell lines. They have used a combination of approaches to demonstrate this, including knock down of ACKR3 and an ACKR3-specific inhibitor. The experiments are generally well controlled and unequivocal. The manuscript is well-written, appropriately discussed and the data generally are well presented. There are a few concerns regarding statistical analysis, rigor and data interpretation that should be addressed prior to publication however.

1) Figure 1A: data is from a single experiment. This should be done more than once at a minimum.

Response: Sparked by the comment of the Reviewer, we have repeated the uptake experiments with CXCL12-AF647 two more times and now also provide quantification of the MFIs measured in all three experiments (Figure 1B), in addition to showing the representative histogram (Figure 1A).

2) Figure 1A and 1B: quantification and statistical analysis should be provided here.

Response: We have also performed further repetitions of the uptake experiment with CXCL11/12-AF647 (previously shown in Figure 1B – now shown in Figure 1E) and provide the requested quantifications of this experiment in Figure 1F (and of Figure 1A, as discussed above). Notably, in the case of the uptake of CXCL11/12-AF647, we decided to repeat the experiment with more experimental groups than previously shown; namely, uptake performed in presence / absence of the inhibitor CCX771 in either unstimulated or stimulated LECs, in addition to the respective 4°C control. By including all 6 groups we are now able to provide statistical proof for our claim that ACKR3-mediated uptake is enhanced in TNF�/IFN�-stimulated LECs (Figure 1E,F – see also text in lines 360-362).

Response: Since – in contrast to the experiments quantified in Figure 1E,F - the uptake experiments shown in Figures 2C and 2D were not performed on the same day in unstimulated vs. stimulated LECs, we decided against pooling the data into one single graph and statistically comparing the stimulated and unstimulated condition. Consequently, we cannot claim that TNFa/IFNg-stimulated LECs take up less AM-AF568 as compared to unstimulated LECs. Sparked by the comment of the Reviewer, we have now rephrased the sentences describing the results of Figure 2C (lines 395-397).

4) Figure 4E and 4F: To show that the signal measured for AM/chemokine uptake in these assays is specific, a negative control should be provided (e.g. cells at 4C)

Response: After consulting with our editor Dr. Lupo, we believe that the Reviewer was referring to the microscopy images shown in Figure 2E and 2F. We have added the requested negative control images from uptake experiments performed at 4°C in Figures 2E and 2F. Notably, this condition had been included in the original experiments and images had been acquired, but we had in the preparation phase of the manuscript decided against including the images in the Figure, for space reasons. The Figure legend has been adapted accordingly (lines 408-409).

5) Figure 4H and 4I: the 50nM group depicted in these plots appears to be identical to the data shown in Figure 2C. This group should be removed from 4H and 4I to avoid this duplication.

Response: (We again assumed that the Reviewer was referring to Figures 2H and 2I). We thank the Reviewer for spotting this! The 50nM groups have now been removed from Figures 2H and 2I.

Response: We thank the Reviewer for spotting this! – Indeed, in Figure 4D/E LECs transduced with shRNA clone C, which induced the most effective knockdown of ACKR3, seemed to have a reduced proliferative response as compared to the other LEC clones. Although this was consistently observed at all AM concentrations in all experiments performed with adLECs (Figure 4D/F and data not shown), it is worth noticing that we did not see the same striking trend when performing experiments in shRNA-transduced jdLECs (Figure 4F/G). At this point, we therefore suspect that the differences observed could be due to different LECs sources - in our experiments but also in the study of Klein et al. – or linked with this particular shRNA clone. We therefore cannot conclude anything about a potential inhibitory effect of ACKR3 knockdown. However, we can say with certainty that - at least in the two cell types and the shRNAs we worked with - ACKR3 knockdown did not enhance proliferative responses towards AM, in contrast to what was reported by Klein et al. We have now inserted a sentence in the discussion speculating on why different results might have been reported by Klein et al (lines 621 - 625).

While intensively discussing the data in Figure 4 E-G, we noticed that we had by mistake inserted a wrong panel in Figure 4D (left panel - 0.1nM AM), which did not correspond to the correct panel for the % response data shown in Figure 4E. In fact, the experimental data originally shown in Figure 4D (left panel – 0.1nM AM) belonged to a repeat experiment performed for all concentrations (0.1nM, 1.0 nM, 10 nM AM). This mistake has now been corrected and the panel (Figure 4D, left panel - 0.1nM AM) exchanged. As the Reviewer will see, the message remains the same; i.e. no enhancement of proliferation upon ACKR3 knockdown – potential loss of proliferative response with shRNA clone C.

Response: Sparked by the comment of the Reviewer, we have once again checked the statistical analyses performed for Figures 4F and for Supplemental Figure 4C. Indeed, due to the different types of experiments reported in these two Figures, different types of comparisons and hence statistical analyses were performed:

Figure S4C shows data from a chemokine uptake experiment, analyzed by flow cytometry. The statistical analysis performed in this case was a Repeated measures two-way ANOVA, followed by Tukey’s multiple comparison test, with a single pooled variance, for individual pairwise comparisons. Tukey’s multiple comparisons test was chosen because it compares between the means of all different groups. In this experiment, pairwise comparisons were made to assess the effect of different treatments (4°C binding ctrl, 37°C + CCX771, 37°C) on chemokine uptake, in relation to treatment with the different shRNAs (4 groups). Hence, pairwise comparisons for all different shRNA knockdown groups and conditions (4°C binding ctrl, 37°C + CCX771, 37°C) were calculated. Repeated-measures ANOVA was used due to the paired nature of the data, which came from different uptake experiments always performed with all different treatment and shRNA knockdown groups. However, for overview / clarity reasons, only the statistics of the relevant comparisons (i.e CTRL vs shRNA at 37°C) were displayed in the final Figure S4C.

Conversely, Figure 4F shows data from a proliferation assay, performed to assess AM-induced proliferation in the different shRNA-transduced LEC clones. This assay measures the uptake of a fluorescent substrate (MUH) into viable cells present in the well 72 h after addition of AM or vehicle control. Considering that the readout of the assay is 72 hours after onset of treatment, already minor differences in the number of LECs seeded in the wells can amplify and potentially lead to substantial differences in untreated LECs present in the wells 72 h later (as a result of cell proliferation). This is not a problem when pipetting LECs of the same origin (i.e. one type of shRNA-transduced LECs). However, we experienced that differences / variance may arise when seeding LECs from different shRNA-transduced LECs preparations. For this reason, we think that the procedure introduced a degree of inter-assay variability in the baseline values (cell numbers) between the shRNA-treated groups due to technical, and not necessarily biological reasons. Therefore, in our opinion, repeated, direct comparisons between all shRNA groups (and treatments) were not possible in this case. As this potential error appeared to average out with experimental repetitions, we nevertheless felt confident that we can perform a grouped analysis using repeated-measures ANOVA, by calculating the degree of proliferation induction in individual groups (after AM treatment). Hence, we calculated repeated pairwise comparisons between AM-treated and respective untreated control groups. When choosing this type of analysis, Tukey’s multiple comparisons test is not an option for post hoc analysis, as it requires the comparison of all mean values to every other mean value within one experiment. Instead, with this type of analysis (i.e. when comparing individual (mean) values to selected control (mean) values), Šídák’s multiple comparisons is one of the recommended posthoc tests. Thus, by choosing to make direct pairwise comparisons between AM-treated mean values with the respective untreated control mean values only, we circumvented that technical error/ variance could compromise the statistical analysis and were still able to show potential differences in % proliferation induction, relative to the untreated control.

In conclusion, the reason why the results shown in Figure 4F are more significant than those in Figure S4C because a different statistical analysis was performed. We have now updated the Statistics paragraph in the Methods section, to better explain which test was performed for which type of data (lines 321-324 & 326-327).

8) Statistical tests and p values should be provided in Supp Fig 1B and SF1G to support claims made in the manuscript.

Response: We have now performed a statistical analysis of the fold-change data reported in Figure S1B and S1G. Specifically, a One sample t test, comparing to the value of 1 was performed (Line 829).

Minor: human gene names should be italicised all caps not lower case for annotation of genes in qPCR

Response: We thank the Reviewer for spotting this mistake in Supplementary Figures 1 & 5 and the corresponding Figure legends (lines 810 and 853 and following). We have now italicized all gene names. Regarding capitalization of letters, the rules in the literature and of PLOS are ambiguous. In most publications we checked, only the first letter of the gene name was capitalized. Therefore, we decided to adopt this writing style (e.g. Ackr3, Ramp2).

Reviewer #2: In the study by Halin et Al., “Reassessing the adrenomedullin scavenging function of AKR3 in lymphatic endothelial cells” the role of ACKR3 as scavenger of the vascular peptide hormone adrenomedullin (AM) was clarified. In this work, in vitro experiments were performed to evaluate the uptake of AM in primary human Lymphatic Endothelial Cells (LECs) and in ACKR3-overexpressing Human Epithelial Kidney (HEK) cells. The aim of this work was to verify a competition between the normal ACKR3-ligand CXCL11/12 and AM, to evaluate if this receptor can influence/reduce the AM proliferative effects on LECs. The Authors conclude that the AM does not compete with CXCL11/12 for ACKR3 binding, but it binds their canonical receptor (CALCRL and PAMP2/3. In my opinion this finding may have a relevance in this field, but major revisions are required.

#2.1.) The background should be improved, experimental procedures should be better described and rearranged. For example, first cell culture (including HEK cells), second the treatments and silencing on LECs, then the plasmid construction and transfection, finally the assay.

Response: The order of the different sections of the Material & Methods has been revised according to the Reviewer’s suggestion. Moreover, we have further detailed certain parts, especially those concerning the plasmid generation and transfections (lines 192– 232) and the custom-synthesis of AM-AF568 (lines 246-258).

A few questions:

#2.2.) Why three type of LECs were used?

Response: Three different human LEC sources were used to account for potential differences in ACKR3 expression and scavenging activity between LECs from different donors and/ or differences caused by donor age. We hypothesized that we might not see the same effect in LECs from a 58 year-old donor vs. a neonatal or a juvenile LEC donor (also considering the reported role of ACKR3/AM during development). A sentence explaining the rationale for the use of three different types of LECs has now been inserted in the introduction (lines 90-92).

#2.3.) Why the coating was different between adLECs and nd- and jd-LECs?

Response: Depending on their isolation method and source (in our lab vs commercial supplier), different culturing protocols were used, and hence these primary human LECs were conditioned to different coatings from the start. Therefore, LEC types were kept with the type of coating they were used to / that was recommended for their culture in order to avoid causing any unexpected change for the cells during experiments. As a side note; in our lab we had performed chemokine uptakes with both types of coatings beforehand and observed no obvious differences.

#2.4.) The abbreviations should be uniformed and the same name should be used for the same protein, for example: ACKR3 was used throughout manuscript, but to indicate the antibody against this protein the CXCR/RDC-1 APC was used. The terms CXCL11/12-AF647 should be clarified as extended terms of CXCL; AF647 should be described as alexa flour 647; Atto 565 should be explained.

Response: We thank the Reviewer for spotting these inconsistencies. We had used the old names for ACKR3 (i.e. CXCR7 / RDC-1) for the antibodies in those cases where the antibodies had been exclusively described under these names in the literature / the company homepage. However, for ease of understanding, this has now been changed and these antibodies are called “anti-ACKR3” throughout the manuscript and their old names only listed in brackets in the Material & Methods section (lines 163 – 165).

We have also now inserted an additional sentence describing the composition and function of the chimeric chemokine CXCL11/12 (lines 354-357). Moreover, the fluorophores attached to the different chemokines are now introduced in the Methods part in lines 260-262.

#2.5.) In the introduction, CCX771 should be described as an antagonist of ACKR3.

Response: As requested by the Reviewer, the inhibitor CCX771 has now already been introduced in the Introduction (lines 92-94).

#2.6) The description of the plasmids in the section “construction of expression plasmids for HEK293 cell transfection” should match with the description in the section “HEK293 cell transfection…”

Response: The relevant sections have now been re-organized and expanded (lines 193 – 232).

#2.7) In Figure1D, the error bars should be indicated in the graphic, which could be expanded to avoid the overlap between 37 °C ° and 37 °C + CCX771.

Response: Sparked by the comments of the Reviewer 1 and Reviewer 2, we have revised the format and order of the entire Figure 1. In the case of Figure 1D (former and current Figure 1D) we have now adapted it to the style of all other quantifications in manuscript and also in this Figure, namely bar plots with error bars and symbols for the individual data points. We have also solved the space problem by using colored bars and explaining te bars in a separate legend (same style as e.g. used in Figure 2).

#2.7) Please check and harmonize all the figures. For example, in fig 2D CXCL11/12 is reported as CXCl11/12; cell types are indicated in fig 3A, but not in fig 2.

Response: Sparked by the Reviewer’s comment we have once again checked all Figure panels and have hopefully removed all remaining typos.

Attachment

Submitted filename: Rebuttal, Sigmund et al., 20230420.pdf

Click here for additional data file.^{(114.7KB, pdf)}

PLoS One. doi: 10.1371/journal.pone.0285597.r003

Decision Letter 1

Gabriella Lupo

27 Apr 2023

Reassessing the adrenomedullin scavenging function of ACKR3 in lymphatic endothelial cells

PONE-D-23-00791R1

Dear Dr. Cornelia Halin,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Gabriella Lupo

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

PLoS One. doi: 10.1371/journal.pone.0285597.r004

Acceptance letter

Gabriella Lupo

19 May 2023

PONE-D-23-00791R1

Reassessing the adrenomedullin scavenging function of ACKR3 in lymphatic endothelial cells

Dear Dr. Halin:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Prof Gabriella Lupo

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Characterization of LECs used in experiments.

(TIF)

Click here for additional data file.^{(1.4MB, tif)}

S2 Fig. qRT-PCR-based characterization of shRNA-transduced adLECs and jdLECs.

(TIF)

Click here for additional data file.^{(528KB, tif)}

S3 Fig. Knockdown of ACKR3 in jdLECs prevents CXCL11/12-AF647 scavenging but does not impact AM-AF568 internalization.

(TIF)

Click here for additional data file.^{(3.4MB, tif)}

S4 Fig. shRNA-mediated knockdown of ACKR3 does not diminish AM uptake in unstimulated primary adLECs or jdLECs.

(TIF)

Click here for additional data file.^{(935.6KB, tif)}

S5 Fig. Validation of the HEK293 overexpression system.

(TIF)

Click here for additional data file.^{(551.1KB, tif)}

Attachment

Submitted filename: Reviewer 1.pdf

Click here for additional data file.^{(61.8KB, pdf)}

Attachment

Submitted filename: Reviewer 2.pdf

Click here for additional data file.^{(61.2KB, pdf)}

Attachment

Submitted filename: Rebuttal, Sigmund et al., 20230420.pdf

Click here for additional data file.^{(114.7KB, pdf)}

Data Availability Statement

[pone.0285597.ref001] 1.Balabanian K, Lagane B, Infantino S, Chow KYC, Harriague J, Moepps B, et al. The chemokine SDF-1/CXCL12 binds to and signals through the orphan receptor RDC1 in T lymphocytes. Journal of Biological Chemistry. 2005;280(42):35760–6. doi: 10.1074/jbc.M508234200 [DOI] [PubMed] [Google Scholar]

[pone.0285597.ref002] 2.Kapas S, Clark AJL. Identification of an orphan receptor gene as a type 1 calcitonin gene-related peptide receptor. Biochem Bioph Res Co. 1995;217(3):832–8. doi: 10.1006/bbrc.1995.2847 [DOI] [PubMed] [Google Scholar]

[pone.0285597.ref003] 3.Bonecchi R, Graham GJ. Atypical Chemokine Receptors and Their Roles in the Resolution of the inflammatory Response. Front Immunol. 2016;7. doi: 10.3389/fimmu.2016.00224 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0285597.ref004] 4.Quinn KE, Mackie DI, Caron KM. Emerging roles of atypical chemokine receptor 3 (ACKR3) in normal development and physiology. Cytokine. 2018;109:17–23. doi: 10.1016/j.cyto.2018.02.024 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0285597.ref005] 5.Burns JM, Summers BC, Wang Y, Melikian A, Berahovich R, Miao Z, et al. A novel chemokine receptor for SDF-1 and I-TAC involved in cell survival, cell adhesion, and tumor development. J Exp Med. 2006;203(9):2201–13. doi: 10.1084/jem.20052144 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0285597.ref006] 6.Cruz-Orengo L, Holman DW, Dorsey D, Zhou L, Zhang P, Wright M, et al. CXCR7 influences leukocyte entry into the CNS parenchyma by controlling abluminal CXCL12 abundance during autoimmunity. Journal of Experimental Medicine. 2011;208(2):327–39. doi: 10.1084/jem.20102010 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0285597.ref007] 7.Zabel BA, Wang Y, Lewen S, Berahovich RD, Penfold ME, Zhang P, et al. Elucidation of CXCR7-mediated signaling events and inhibition of CXCR4-mediated tumor cell transendothelial migration by CXCR7 ligands. J Immunol. 2009;183(5):3204–11. Epub 2009/07/31. doi: 10.4049/jimmunol.0900269 [DOI] [PubMed] [Google Scholar]

[pone.0285597.ref008] 8.Raz E, Boldajipour B, Mahabaleshwar H, Kardash E, Reichman-Fried M, Blaser H, et al. Control of chemokine-guided cell migration by ligand sequestration. Cell. 2008;132. doi: 10.1016/j.cell.2007.12.034 [DOI] [PubMed] [Google Scholar]

[pone.0285597.ref009] 9.Meyrath M, Szpakowska M, Zeiner J, Massotte L, Merz MP, Benkel T, et al. The atypical chemokine receptor ACKR3/CXCR7 is a broad-spectrum scavenger for opioid peptides. Nat Commun. 2020;11(1):3033. Epub 2020/06/21. doi: 10.1038/s41467-020-16664-0 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0285597.ref010] 10.Ikeda Y, Kumagai H, Skach A, Sato M, Yanagisawa M. Modulation of circadian glucocorticoid oscillation via adrenal opioid-CXCR7 signaling alters emotional behavior. Cell. 2013;155(6):1323–36. Epub 2013/12/10. doi: 10.1016/j.cell.2013.10.052 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0285597.ref011] 11.Gerrits H, Schenau DSVI, Bakker NEC, van Disseldorp AJM, Strik A, Hermens LS, et al. Early postnatal lethality and cardiovascular defects in CXCR7-deficient mice. Genesis. 2008;46(5):235–45. doi: 10.1002/dvg.20387 PubMed PMID: WOS:000256631300001. [DOI] [PubMed] [Google Scholar]

[pone.0285597.ref012] 12.Sierro F, Biben C, Martinez-Munoz L, Mellado M, Ransohoff RM, Li M, et al. Disrupted cardiac development but normal hematopoiesis in mice deficient in the second CXCL12/SDF-1 receptor, CXCR7. P Natl Acad Sci USA. 2007;104(37):14759–64. doi: 10.1073/pnas.0702229104 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0285597.ref013] 13.Yu SH, Crawford D, Tsuchihashi T, Behrens TW, Srivastava D. The Chemokine Receptor CXCR7 Functions to Regulate Cardiac Valve Remodeling. Dev Dynam. 2011;240(2):384–93. doi: 10.1002/dvdy.22549 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0285597.ref014] 14.Klein KR, Karpinich NO, Espenschied ST, Willcockson HH, Dunworth WP, Hoopes SL, et al. Decoy receptor CXCR7 modulates adrenomedullin-mediated cardiac and lymphatic vascular development. Dev Cell. 2014;30(5):528–40. Epub 2014/09/10. doi: 10.1016/j.devcel.2014.07.012 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0285597.ref015] 15.Jin D, Harada K, Ohnishi S, Yamahara K, Kangawa K, Nagaya N. Adrenomedullin induces lymphangiogenesis and ameliorates secondary lymphoedema. Cardiovasc Res. 2008;80(3):339–45. Epub 2008/08/19. doi: 10.1093/cvr/cvn228 [DOI] [PubMed] [Google Scholar]

[pone.0285597.ref016] 16.Dunworth WP, Fritz-Six KL, Caron KM. Adrenomedullin stabilizes the lymphatic endothelial barrier in vitro and in vivo. Peptides. 2008;29(12):2243–9. Epub 2008/10/22. doi: 10.1016/j.peptides.2008.09.009 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0285597.ref017] 17.Fischer JP, Els-Heindl S, Beck-Sickinger AG. Adrenomedullin—Current perspective on a peptide hormone with significant therapeutic potential. Peptides. 2020;131:170347. Epub 2020/06/23. doi: 10.1016/j.peptides.2020.170347. [DOI] [PubMed] [Google Scholar]

[pone.0285597.ref018] 18.Francois M, Oszmiana A, Harvey NL. When form meets function: the cells and signals that shape the lymphatic vasculature during development. Development. 2021;148(11). doi: 10.1242/dev.167098 [DOI] [PubMed] [Google Scholar]

[pone.0285597.ref019] 19.Farnsworth RH, Karnezis T, Maciburko SJ, Mueller SN, Stacker SA. The Interplay Between Lymphatic Vessels and Chemokines. Front Immunol. 2019;10. doi: 10.3389/fimmu.2019.00518 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0285597.ref020] 20.Vaahtomeri K, Karaman S, Makinen T, Alitalo K. Lymphangiogenesis guidance by paracrine and pericellular factors. Gene Dev. 2017;31(16):1615–34. doi: 10.1101/gad.303776.117 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0285597.ref021] 21.Wang C, Chen WL, Shen JZ. CXCR7 Targeting and Its Major Disease Relevance. Front Pharmacol. 2018;9. doi: 10.3389/fphar.2018.00641 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0285597.ref022] 22.Dieterich LC, Detmar M. Tumor lymphangiogenesis and new drug development. Adv Drug Deliver Rev. 2016;99:148–60. doi: 10.1016/j.addr.2015.12.011 [DOI] [PubMed] [Google Scholar]

[pone.0285597.ref023] 23.Szpakowska M, Nevins AM, Meyrath M, Rhainds D, D’Huys T, Guite-Vinet F, et al. Different contributions of chemokine N-terminal features attest to a different ligand binding mode and a bias towards activation of ACKR3/CXCR7 compared with CXCR4 and CXCR3. Br J Pharmacol. 2018;175(9):1419–38. Epub 2017/12/23. doi: 10.1111/bph.14132 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0285597.ref024] 24.Meyrath M, Palmer CB, Reynders N, Vanderplasschen A, Ollert M, Bouvier M, et al. Proadrenomedullin N-Terminal 20 Peptides (PAMPs) Are Agonists of the Chemokine Scavenger Receptor ACKR3/CXCR7. ACS Pharmacol Transl Sci. 2021;4(2):813–23. Epub 2021/04/17. doi: 10.1021/acsptsci.1c00006 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0285597.ref025] 25.Sigmund EC, Baur L, Schineis P, Arasa J, Collado-Diaz V, Vranova M, et al. Lymphatic endothelial-cell expressed ACKR3 is dispensable for postnatal lymphangiogenesis and lymphatic drainage function in mice. Plos One. 2021;16(4). doi: 10.1371/journal.pone.0249068 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0285597.ref026] 26.Gustavsson M, Wang L, van Gils N, Stephens BS, Zhang P, Schall TJ, et al. Structural basis of ligand interaction with atypical chemokine receptor 3. Nat Commun. 2017;8:14135. Epub 2017/01/18. doi: 10.1038/ncomms14135 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0285597.ref027] 27.Ducoli L, Agrawal S, Sibler E, Kouno T, Tacconi C, Hon CC, et al. LETR1 is a lymphatic endothelial-specific lncRNA governing cell proliferation and migration through KLF4 and SEMA3C. Nat Commun. 2021;12(1):925. Epub 2021/02/12. doi: 10.1038/s41467-021-21217-0 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0285597.ref028] 28.Infantino S, Moepps B, Thelen M. Expression and regulation of the orphan receptor RDC1 and its putative ligand in human dendritic and B cells. J Immunol. 2006;176(4):2197–207. Epub 2006/02/04. doi: 10.4049/jimmunol.176.4.2197 [DOI] [PubMed] [Google Scholar]

[pone.0285597.ref029] 29.Wootten D, Lindmark H, Kadmiel M, Willcockson H, Caron KM, Barwell J, et al. Receptor activity modifying proteins (RAMPs) interact with the VPAC2 receptor and CRF1 receptors and modulate their function. Br J Pharmacol. 2013;168(4):822–34. Epub 2012/09/06. doi: 10.1111/j.1476-5381.2012.02202.x [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0285597.ref030] 30.Qi T, Dong M, Watkins HA, Wootten D, Miller LJ, Hay DL. Receptor activity-modifying protein-dependent impairment of calcitonin receptor splice variant Delta(1–47)hCT((a)) function. Br J Pharmacol. 2013;168(3):644–57. Epub 2012/09/06. doi: 10.1111/j.1476-5381.2012.02197.x [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0285597.ref031] 31.Schönauer R, Kaiser A, Holze C, Babilon S, Kobberling J, Riedl B, et al. Fluorescently labeled adrenomedullin allows real-time monitoring of adrenomedullin receptor trafficking in living cells. J Pept Sci. 2015;21(12):905–12. Epub 2016/01/16. doi: 10.1002/psc.2833 [DOI] [PubMed] [Google Scholar]

[pone.0285597.ref032] 32.Ameti R, Melgrati S, Radice E, Cameroni E, Hub E, Thelen S, et al. Characterization of a chimeric chemokine as a specific ligand for ACKR3. J Leukoc Biol. 2018;66:1. doi: 10.1002/JLB.2MA1217-509R [DOI] [PubMed] [Google Scholar]

[pone.0285597.ref033] 33.Berahovich RD, Zabel BA, Penfold ME, Lewen S, Wang Y, Miao Z, et al. CXCR7 protein is not expressed on human or mouse leukocytes. J Immunol. 2010;185(9):5130–9. Epub 2010/10/05. doi: 10.4049/jimmunol.1001660 [DOI] [PubMed] [Google Scholar]

[pone.0285597.ref034] 34.Luker KE, Steele JM, Mihalko LA, Ray P, Luker GD. Constitutive and chemokine-dependent internalization and recycling of CXCR7 in breast cancer cells to degrade chemokine ligands. Oncogene. 2010;29. doi: 10.1038/onc.2010.212 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0285597.ref035] 35.Kuwasako K, Shimekake Y, Masuda M, Nakahara K, Yoshida T, Kitaura M, et al. Visualization of the calcitonin receptor-like receptor and its receptor activity-modifying proteins during internalization and recycling. J Biol Chem. 2000;275(38):29602–9. Epub 2000/07/07. doi: 10.1074/jbc.M004534200 [DOI] [PubMed] [Google Scholar]

[pone.0285597.ref036] 36.Fritz-Six KL, Dunworth WP, Li M, Caron KM. Adrenomedullin signaling is necessary for murine lymphatic vascular development. J Clin Invest. 2008;118(1):40–50. Epub 2007/12/22. doi: 10.1172/JCI33302 ; [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0285597.ref037] 37.Miyashita K, Itoh H, Sawada N, Fukunaga Y, Sone M, Yamahara K, et al. Adrenomedullin promotes proliferation and migration of cultured endothelial cells. Hypertens Res. 2003;26 Suppl:S93–8. Epub 2003/03/13. doi: 10.1291/hypres.26.s93 [DOI] [PubMed] [Google Scholar]

[pone.0285597.ref038] 38.Mackie DI, Nielsen NR, Harris M, Singh S, Davis RB, Dy D, et al. RAMP3 determines rapid recycling of atypical chemokine receptor-3 for guided angiogenesis. Proc Natl Acad Sci U S A. 2019;116(48):24093–9. Epub 2019/11/13. doi: 10.1073/pnas.1905561116 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0285597.ref039] 39.Yamauchi A, Sakurai T, Kamiyoshi A, Ichikawa-Shindo Y, Kawate H, Igarashi K, et al. Functional differentiation of RAMP2 and RAMP3 in their regulation of the vascular system. J Mol Cell Cardiol. 2014;77:73–85. Epub 2014/09/30. doi: 10.1016/j.yjmcc.2014.09.017 [DOI] [PubMed] [Google Scholar]

[pone.0285597.ref040] 40.Hay DL, Smith DM. Adrenomedullin receptors: molecular identity and function. Peptides. 2001;22(11):1753–63. doi: 10.1016/s0196-9781(01)00532-0 [DOI] [PubMed] [Google Scholar]

[pone.0285597.ref041] 41.McLatchie LM, Fraser NJ, Main MJ, Wise A, Brown J, Thompson N, et al. RAMPs regulate the transport and ligand specificity of the calcitonin-receptor-like receptor. Nature. 1998;393(6683):333–9. doi: 10.1038/30666 [DOI] [PubMed] [Google Scholar]

[pone.0285597.ref042] 42.Cole KE, Strick CA, Paradis TJ, Ogborne KT, Loetscher M, Gladue RP, et al. Interferon-inducible T cell alpha chemoattractant (I-TAC): A novel non-ELR CXC chemokine with potent activity on activated T cells through selective high affinity binding to CXCR3. Journal of Experimental Medicine. 1998;187(12):2009–21. doi: 10.1084/jem.187.12.2009 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0285597.ref043] 43.Kitamura K, Sakata J, Kangawa K, Kojima M, Matsuo H, Eto T. Cloning and Characterization of Cdna-Encoding a Precursor for Human Adrenomedullin (Vol 194, Pg 720, 1993). Biochem Bioph Res Co. 1994;202(1):643-. doi: 10.1006/bbrc.1994.1976 [DOI] [PubMed] [Google Scholar]

[pone.0285597.ref044] 44.Kamohara M, Matsuo A, Takasaki J, Kohda M, Matsumoto M, Matsumoto S, et al. Identification of MrgX2 as a human G-protein-coupled receptor for proadrenomedullin N-terminal peptides. Biochem Biophys Res Commun. 2005;330(4):1146–52. Epub 2005/04/13. doi: 10.1016/j.bbrc.2005.03.088 [DOI] [PubMed] [Google Scholar]

PERMALINK

Reassessing the adrenomedullin scavenging function of ACKR3 in lymphatic endothelial cells

Elena C Sigmund

Aline Bauer

Barbara D Jakobs

Hazal Tatliadim

Carlotta Tacconi

Marcus Thelen

Daniel F Legler

Cornelia Halin

Roles

Abstract

Introduction

Material and methods

Isolation and culture of adult primary human skin LECs (adLECs)

Culture of commercial primary human neonatal and juvenile dermal LECs (ndLECs and jdLECs)

HEK293 cell culture

qRT-PCR analysis of ackr3, ramp2, ramp3 and calcrl expression in LECs and HEK293 cells

Anti-ACKR3 staining of cultured human LECs for flow cytometry

ShRNA-mediated silencing of ACKR3 in human LECs

Generation of HEK293-ACKR3 cells

Plasmid construction for transient expression of CALCRL, RAMP2 and RAMP3 in HEK293 cells

Transient transfection of HEK293 cells

Use of LECs for different types of experiments

Fluorescently labelled AM and chemokines used in uptake experiments

Chemokine and AM uptake assays in LECs

Ligand competition assay in LECs

LEC proliferation assays

AM-AF568 binding/internalization experiments in HEK293 cells

Statistical data analysis

Results

AM fails to reduce the chemokine scavenging activities of ACKR3 in a ligand competition assay in LECs in vitro

Fig 1. Addition of AM does not reduce the chemokine scavenging activities of ACKR3 in a ligand competition assay in ndLECs in vitro.

AM internalization in primary LECs is not altered by pharmacologic modulation of ACKR3

Fig 2. AM scavenging in primary ndLECs is not reduced by pharmacologic manipulation of ACKR3.

ShRNA-mediated knockdown of ACKR3 does not impede AM internalization and uptake

Fig 3. shRNA-mediated ACKR3 knockdown does not diminish AM scavenging in TNFα/IFNγ stimulated primary adLECs or jdLECs.

AM-mediated proliferation is not enhanced upon treatment with CCX771 or shRNA-mediated knockdown of ACKR3

Fig 4. AM-mediated proliferation is not enhanced upon treatment with CCX771 or shRNA-mediated knockdown of ACKR3.

AM-AF568 uptake in HEK293 cells exclusively depends on CALCRL and RAMP2/3 expression but not on ACKR3 expression

Fig 5. AM scavenging in HEK293 cells requires co-expression of RAMP2/3 and CALCRL but is independent of ACKR3.

Discussion

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Gabriella Lupo

Roles

Author response to Decision Letter 0

Decision Letter 1

Gabriella Lupo

Roles

Acceptance letter

Gabriella Lupo

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases