Abstract
Objective
Flavonoids are the bioactive compounds in safflower (Carthamus tinctorius), in which chalcone synthase (CHS) is the first limiting enzyme. However, it is unclear that which chalcone synthase genes (CHSs) are participated in flavonoids biosynthesis in C. tinctorius. In this study, the CHSs in the molecular characterization and enzyme activities were investigated.
Methods
Putative chalcone biosynthase genes were screened by the full-length transcriptome sequences data in C. tinctorius. Chalcone biosynthase genes in C. tinctorius (CtCHSs) were cloned from cDNA of flowers of C. tinctorius. The cloned gene sequences were analyzed by bioinformatics, and their expression patterns were analyzed by real-time PCR (RT-PCR). The protein of CtCHS in the development of flowers was detected by polyclonal antibody Western blot. A recombinant vector of CtCHS was constructed. The CtCHS recombinant protein was induced and purified to detect the enzyme reaction (catalyzing the reaction of p-coumaryl-CoA and malonyl-CoA to produce naringin chalcone). The reaction product was detected by HPLC and LC-MS.
Results
Two full-length CtCHS genes were successfully cloned from the flowers of safflower (CtCHS1 and CtCHS3), with gene lengths of 1525 bp and 1358 bp, respectively. RT-PCR analysis showed that both genes were highly expressed in the flowers, but the expression of CtCHS1 was higher than that of CtCHS3 at each developmental stage of the flowers. WB analysis showed that only CtCHS1 protein could be detected at each developmental stage of the flowers. HPLC and LC-MS analyses showed that CtCHS1 could catalyze the conversion of p-coumaryl-CoA and malonyl-CoA substrates to naringin chalcone.
Conclusion
CtCHS1 is involved in the biosynthesis of naringin chalcone in safflower.
Keywords: Carthamus tinctorius L., chalcone synthase, expression analysis, flavonoids, functional identification, gene cloning, safflower
1. Introduction
Flowers of Carthamus tinctorius L. are commonly used as traditional Chinese medicines Carthami Flos (Honghua in Chinese) for promoting blood circulation and removing blood stasis, in which flavonoids are the major biological active ingredients. In the past few decades, a large number of studies showed that the extracts have a positive impact on cardiovascular and cerebralvascular function, such as the protection of cardiomyocytes and endothelial cells, as well as the prevention of myocardial damage and coronary heart disease (Xian et al., 2022, Asgarpanah and Kazemivash, 2013, Nie et al., 2012). The main active ingredients are flavonoids including safflower yellow (SY), hydroxy safflower yellow A (HSYA), anhydrosafflor yellow B (AHSYB), etc (Ao, Feng, & Peng, 2018).
Flavonoids are one of the most important secondary metabolites in plants (Kumar, & Pandey, 2013). The main pathway of flavonoid biosynthesis is mainly concentrated in model plants (Winkel-Shirley, 2002, Du et al., 2010). Studies have shown that the synthesis pathway of safflower flavonoids starts with one molecule of p-coumaroyl-CoA and three molecules malonyl-CoA through chalcone synthase (CHS) catalytic form into 4,2′,4′,6′-tetrahydroxychalcone, 4,2′,4′,6′-tetrahydroxychalcone as an intermediate product. On the one hand, it can form quinone chalcones, on the other hand, it can be catalyzed by chalcone isomerase (CHI) to form naringenin. So CHS is the rate-limiting enzyme in flavonoid biosynthesis pathway (Dao, Linthorst, & Verpoorte, 2011). In recent years, molecular cloning and the functional identification of chalcone synthase genes (CHSs) have been reported in many plants and most of the studies focused on cloning, sequencing and expression analysis (Lei et al., 2010, Jiang et al., 2006, Wang et al., 2018, Tuteja et al., 2004). It had been proved that three CtCHS genes in C. tinctorius have activities in vitro in terms of biosynthetic gene resources (Shinozaki et al., 2016). However, it was not well known which CtCHS gene was indeed involved in the synthesis of flavonoids in C. tinctorius. In the previous research, full-length transcriptome sequences were analysed in C. tinctorius, and putative CHSs (CtCHS1, CtCHS2 and CtCHS3) were screened (Chen et al., 2018).
In this study, the CHSs were cloned. Their gene expression patterns were analysed by RT-PCR, and their protein expressions were detected by Western blot. Results from gene and protein expression indicated that CtCHS1 was more likely to participate in the synthesis of flavonoids in flowers. The CtCHS1 recombinant proteins were expressed and purified. An enzyme activity reaction in vitro showed that it could catalyse the conversion of p-coumaroyl-CoA and malonyl-CoA substrates to naringenin chalcone. All results proved that CtCHS1 was participated in the biosynthesis of naringenin chalcone in C. tinctorius, which was not only useful for the analysis of the molecular mechanism of C. tinctorius flavonoid biosynthesis, but also provided genetic resources for the flavonoid biosynthesis by biotechnology.
2. Materials and methods
2.1. Plant materials
C. tinctorius which in flowering period plants were cultivated at the Medicinal Botanical Garden on the Wenjiang campus of Chengdu University of Traditional Chinese Medicine (Chengdu, China). Four organs of C. tinctorius, incuding roots, stems, leaves, and flowers without the ovary, were collected. The four developmental stages of the flowers were picked (Fig. 1). The four organs and the four developmental stages of the flowers from at least five plants with the same genetic background and growth status were pooled as a sample. Three of such samples (three repetitions) were carried in each test. All the samples were immediately frozen in liquid N2 for the RNA extraction and expression analysis.
Fig. 1.
Flowers at blooming (A) and four developmental stages of flowers (B) (1, flower bud stage (petals are a little bit red); 2, flower bud stage (petals are more red); 3, flowers bloom 1 d; 4, flowers bloom for 3 d) of C. tinctorius.
2.2. Cloning of full-length of CtCHS
Total RNA was extracted from C. tinctorius flowers using the methods described in the TRIzol Chaperone Kit (Tiandz, Beijing, China). Total RNA was treated with DNase (Takara, Dalian, China) to remove DNA, then reversed transcribed into cDNA using the reverse transcription kit (Takara, Beijing, China). The three CtCHSs sequences were obtained from the full-length transcriptome sequencing data, and primers were designed by Primer primier 5. The primers (FCtCHS1、FCtCHS2, FCtCHS3) were listed in Table 1. They were cloned into the pMD19-T vector (Takara, Beijing, China) and were determined by sequencing.
Table 1.
Primer sequences used in this study.
| Primers | Sequence and restriction sites |
|---|---|
| FCtCHS1 | F: ACCAACATCCATCGGTGT |
| R: CCCTAATTCTGCATTATTTT | |
| FCtCHS2 | F: CGCGCCAAGATCTGGTGGTG |
| R: ATAATCACCCCATTGTAAAA | |
| FCtCHS3 | F: CTTGGAATCAAACAAACCG |
| R: CACAATACATCTTATTCCCACA | |
| QCtCHS1 | F: TATCAAGCCGATTACCCTG |
| R: CTTCGACCACGACCACAT | |
| QCtCHS3 | F: ACGAAGCTCCGTCGTTAGAC |
| R: TGCTGGTACATCATGAGGCG | |
| Ct25S | F: GGAGGTTGAGGGAAAAGGAG |
| R: GTGACCTCGTCACCCGTAGT | |
| pET32a-CtCHS1 | F: CCGGAATTCATGGCATCCTTAACCGATATTG (EcoRI) |
| R: CCCAAGCTTCCCTAATTCTGCATTATTTT (HindIII) |
2.3. Sequence bioinformatics analysis
The open reading frame (ORF) was searched using the ORF Finder (https://www.ncbi.nlm.nih.gov/orffinder/). The molecular weight (MW) and theoretical isoelectric point (pI) calculations were performed online (http://Web.expasy.org/compute_pi/). Protscale was used to predicted the hydrophobicity map of two CHS proteins (http://web.expasy.org/protscale/). Psipred was used to predict the proteins’ secondary structure (http://bioinf.cs.ucl.ac.uk/psipred). SWISS-MODEL was used to predict the three-dimensional structure of proteins (https://swissmodel.expasy.org/).
2.4. Gene expression pattern analysis by RT-PCR
The gene expressions in four organs, as well as four stages of flower samples were determined by Real-time PCR. SYBR Green PCR Master Mix (Toyobo, Osaka, Japan) was used in the experiment. The Ct25S (25S acidic ribosomal protein gene) was used as the reference gene. All gene specific primers were designed to amplify products of 100–400 bp in length. The length of the primers was (20 ± 2) bp. All the gene primers (QCtCHS1, QCtCHS3 and Ct25S) for RT-PCR were listed in Table 1.
Quantitative PCR analysis mainly refers to previous research. The main steps are as follows: a first denaturation step for 30 s at 95 °C; And then 40 cycles of 5 s at 58 °C, Extension 30 s at 72 °C. Preservation forever at 12 °C. The specificity of PCR reactions was verified by agarose gel electrophoresis. Each study was repeated three times and all reactions were performed on Bio-Rad CFX96 Manager System (Bio-Rad, CA, USA).
2.5. Protein expression detection by Western blot with polyclonal antibody
The antigen was prepared according to the amino acid sequence of CHSs, and a rabbit was deimmunised with the antigen. The potency was detected after three immunisations, and the qualified antibody was extracted. The cross-reaction was halted by using the recombinant protein, and then the polyclonal antibody was purified. The total protein in the flowers of C. tinctorius was extracted. Briefly, the flowers of C. tinctorius were ground with liquid nitrogen and then added with RIPA pyrolysis solution (Beyotime, Beijing, China), then cracked on ice for 30 min, ultrasound in ice bath for 3 min and centrifugation for 10 min at 4 °C 12 000 rpm. The supernatant was transferred to a new EP tube. The concentration of protein was determined by BCA method. The loading buffer (5 × SDS) was added according to the volume of the pyrolysate and boiled at 100 °C for 5 min.
Western blot analysis was carried out according to a previous report (Ma, Wang, Xu, Wang, & Wang, 2018). Protein concentrations were determined by BCA Protein Assay Kit (Beyotime, Beijing, China). Proteins were resolved on a 10% SDS-PAGE and then transferred onto polyvinylidene fluoride membranes (Bio-Rad, CA, USA). The membranes were blocked in 5% non-fat milk in TBST buffer for 2 h, and immuno blot was thus performed by incubating the membranes with the corresponding primary antibodies in TBST at 4 °C overnight. After washing with TBST three times, the resulting membranes were incubated with sheep anti-rabbit IgG secondary antibody (1:10 000) for 2 h at room temperature. The resultant membranes were washed extensively before analysis. The protein bands were detected by ChemiDoc™XRS + Imaging System (Bio-Rad, CA, USA). β-Actin was used as the control. The grey value of CtCHS1 and the internal reference were calculated using the imageJ program (https://imagej.nih.gov/ij/). The expression levels of the four developmental stages were compared using the ratio of CtCHS1 with the internal reference, according to the grey value.
2.6. Expression and identification of recombination protein
The full-length of CtCHS1 with the restriction sites (EcoRI/HindIII) was amplified using PCR Master Mix (Tiangen, Beijing, China). The PCR reaction conditions were set as follows: 95 °C for 4 min; 35 cycles of 95 °C for 30 s, 56 °C for 60 s, and 72 °C for 2 min; and final extension at 72 °C for 8 min. The amplified fragment of CtCHS1 was introduced to a EcoRI/HindIII-digested pET-32a expression vector. Primers with restriction sites (pET32a-CtCHS1) were listed in Table 1. The E. coli strain BL21 (DE3) (Takara, Beijing, China) was used for the protein expression. The recombinant vector was transformed into BL21 (DE3) and induced by 1 mmol/L IPTG at 37 °C for 4 h. The protein was purified using a protein purification kit (Cwbio, Beijing, China). Western blot with anti-His-tag was used to further verify the accuracy proteins.
2.7. Enzyme activity determination in vitro
The determination of enzymatic activity was mainly based on previous studies, with some modifications were made (Wang et al., 2018). The pET32a-CtCHS1 recombinant protein is an insoluble protein. Before in vitro enzymatic reaction, the purified recombinant protein requires renaturation by reducing the concentration gradient of the urea to obtain the activity. The renatured protein was examined during in vitro enzymatic reaction with p-coumaroyl-CoA (Yuanye, Shanghai, China) and malonyl-CoA (Sigma-Aldrich, MO, USA) as substrates. The reaction system contained p-coumaroyl-CoA, malonyl-CoA, 500 μL 1 × PBS, 1 mmol/L DTT, and 30 μg of protein, and was incubated at 30 °C for 1 h. Next, 25 μL glacial acetic acid was added to the reaction product before adjusting the pH to 9 with NaOH and then centrifugation at room temperature for 10 min. Subsequently, reactions were extracted with 600 μL ethyl acetate, and the mixture was centrifuged at 10,000 rpm for 5 min. After drying at 30 °C, the sample was dissolved in 300 μL of methanol. Meanwhile, BL21(DE3) transformed with an empty pET-32a vector were used for a negative control. The reaction products were detected by HPLC. The mobile phases were water (A) and methanol (B), isocratic elution, the flow rate was 0.8 mL/min. The condition for the detection of the products was carried out among 289 nm using isocratic elution with equal amounts of A and B.
2.8. Identification of product components by LC-MS
The products were identified by LC-MS (ultra performance LC: Shimadzu, Japan; MS: AB Sciex, Washington DC, US). Naringenin was used as the reference control. The mobile phases were water (A) and methanol (B) at a flow rate of 0.3 mL/min, and the elution gradient was as follows: 0 to 2 min, 10%−40% B; 2 to 3 min, 40%−70% B; 3 to 4 min, 70%−90% B; 4 to 6 min, 90%−95% B. The MS method was as follows: An electrospray ionisation method was used, with negative ions as the detection ions; The capillary voltage was 4.5 kV, the ion source temperature was 500 °C, and the declustering potential (DP) was −100 V. The naringenin was measured using multiple reaction monitoring (MRM) as the detection mode. The corresponding monitored ion pairs and collision energies were as follows: The ion was 271.2, the daughter of the ion was 119.2, the resident time was 0.2 s, and the collision energies were −33 eV.
3. Results
3.1. Cloning and bioinformatics analysis of CHSs in C. tinctorius
CtCHS1 and CtCHS3 were successfully cloned from the mixed cDNA of the flowers of C. tinctorius (Fig. 2A). The full-lengths of CtCHS1 and CtCHS3 were 1525 bp and 1358 bp, respectively. They had 1041 bp and 1206 bp ORF encoding 346 and 401 amino acid polypeptides, respectively. Sequence analysis results showed that CtCHS1 and CtCHS3 had a theoretical isoelectric point (pI) of 6.27 and 5.72. Both the CtCHS1 and CtCHS3 proteins were hydrophilic proteins (Fig. 2B). And CtCHS1 had 119 α-helices, 75 β-sheets, and 152 random coils; CtCHS3 had 119 α-helices, 75 β-sheets, and 206 random coils. The predicted three-dimensional structure of the two proteins was very similar (Fig. 2C).
Fig. 2.
Cloning and protein structure prediction of chalcone synthase genes in safflower. (A), Gel electrophoresis for cloning of CtCHS1 and CtCHS3; (B), Hydrophilicity analysis of CtCHS1 and CtCHS3; (C), Three-dimensional structure analysis of CtCHS1 and CtCHS3.
3.2. CtCHS1 mainly expressed in flowers with each developmental stage
Expression pattern analysis showed that both CtCHS1 and CtCHS3 had the highest expression in the flowers and almost no expression in the roots (Fig. 3A). However, comparing the expression between CtCHS1 and CtCHS3 during the four developmental stages of the flowers, results showed that the expression of CtCHS1 was higher than that of CtCHS3 in each developmental stage (Fig. 3B).
Fig. 3.
Relative expressions of CtCHS1 and CtCHS3. (A), Relative quantity of CtCHS1 and CtCHS3 in four organs of safflower; (B), Relative quantity of CtCHS1 and CtCHS3 in four developmental stages of flowers.
Protein expression by Western blot analysis showed that there was CtCHS1 protein but not CtCHS3 protein in each developmental stage (Fig. 4A and B). The result showed that CtCHS1 had the highest expression in the second stage and lowest in the fourth stage (Fig. 4C).
Fig. 4.
Protein expression of CtCHS1 and CtCHS3 in four stages of flower development. (A), CtCHS1 and CtCHS3 detection by Western blot with polyclonal antibody. (B), CtCHS1 detection by Western blot with CtCHS3 polyclonal antibody; (C), Ratio of CtCHS1 protein to β-actin at each stage.
3.3. Expression and purification of CtCHS1 protein
As CtCHS1 was mainly expressed in the flowers, the CtCHS1 protein was further analysed. Fig. 5A showed that the recombinant protein was inclusion. Fig. 5B showed that the correct recombinant CtCHS1 proteins were obtained. The purified protein with His-tag kit was obtained (Fig. 5C). In order to analyse the enzymatic activity of CtCHS1, the purified protein of CtCHS1 proteins was renatured. Fig. 5C showed that after the denaturant using dialysis by urea, the soluble recombination CtCHS1 proteins were obtained.
Fig. 5.
Expression, purification and renaturation of CtCHS1 recombinant protein. (A), Protein solubility analysis. M, protein marker. Lanes 1 to 3: total protein of BL21(DE3) with empty carrier, the centrifugal supernatant of BL21(DE3) transformed with pET32-CtCHS1, and the centrifugal precipitation of BL21(DE3) transformed with pET32-CtCHS1. The arrow refers to CtCHS1. (B), Western blot analysis, lines 1 and 4: BL21(DE3) strains only. Lines 2 and 5: transformed with pET-32a only. Lines 3 and 6: CtCHS1 recombinant protein. The arrow refers to CtCHS1. Line 7: positive antibody control. (C), The CtCHS1 protein renaturation. Lines 1 to 4: total protein of BL21(DE3) transformed with pET-32a only, the centrifugal supernatant of BL21(DE3) transformed with pET32-CtCHS1, purified product of the CtCHS1, and centrifugal supernatant after renaturation. The arrow refers to CtCHS1.
3.4. CtCHS1 participated in conversion of p-coumaroyl-CoA and malonyl-CoA substrates to naringenin chalcone in C. tinctorius
CHS can recognize the substrates p-coumaroyl-CoA and malonyl-CoA to produce naringenin chalconein in vitro. And naringenin chalcone can be non-enzymatically converted to naringenin. Thus the activity of CtCHS1 enzyme can be determined by detecting whether naringenin is produced or not when p-coumaroyl-CoA and malonyl-CoA are added. The chromatographic results showed that there was a peak for the reaction during the retention time and it matched the control naringenin reference. The negative control had no peak at this retention time (Fig. 6). Thus it can be surmised that the reaction produces naringenin.
Fig. 6.
HPLC chromatograph of naringen in standard (A), enzymatic reaction products in vitro (B), and negative control (C).
In order to further prove that the CtCHS1 can catalytic production of naringenin, LC-MS was used to further confirm it. The results showed that both the sample and the naringenin reference peaked at 3.77 min, while the blank control did not (Fig. 7). Thus, this result proved that CtCHS1 had a typical CHS enzymatic function, catalysing the conversion of p-coumaroyl-CoA and malonyl-CoA substrates to naringenin chalcone.
Fig. 7.
Detection of reaction products by LC-MS.(A), Mass spectrogram for naringenin mother ion; (B), Mass spectrogram for naringenin daughter ion; (C), LC-MS for naringen in standard; (D), Enzymatic reaction products in vitro; (E), Negative control.
4. Discussion
4.1. Comparison of second-generation transcriptome sequencing and full-length transcriptome sequencing
CHS is a very important gene in the pathway of flavonoid metabolism. In recent years, molecular cloning and the functional identification of CHSs have been reported in many plants, such as Scutellaria viscidula Bunge (Lei, Tang, Luo, & Sun, 2010), Physcomitrella patens (Hedw.) Bruch & Schimp. (Jiang, Schommer, Kim, & Suh, 2006), Citrus reticulata Blanco (Wang et al., 2018) and Glycine max (L.) Merr. (Tuteja, Clough, Chan, & Vodkin, 2004). In the research of Shinozaki et al. (2016), three CtCHSs genes had been cloned. We compared our three CtCHS gene sequences with Shinozaki’s three CtCHS genes. Results showed that CtCHS1 and CtCHS2 from our transcriptome sequences data had higher similarity with CtCHS1 in Shinozaki’s report, and CtCHS3 from our transcriptome sequences data had higher similarity with CtCHS2 in Shinozaki’s report. However, the CtCHS3 in Shinozaki’s report was not detected in our transcriptome sequences data. Probably because the second-generation transcriptome sequencing was carried in their research, there will be more annotated CHS genes compared with the third-generation transcriptome sequencing in our research, as the data amount of the second generation sequencing is much larger than that of the third generation sequencing. Besides, three CtCHSs genes in C. tinctorius have activities in vitro in terms of biosynthetic gene resources, which had also been reported in the research (Shinozaki et al., 2016). However, from the perspective of plants, it was not well known which CtCHS gene was indeed involved in the synthesis of flavonoids in C. tinctorius.
4.2. CtCHS1 and CtCHS3 genes were successfully cloned in this study
In our previous study, three putative CtCHS genes were screened from the full-length transcriptome sequencing data (Chen et al., 2018). But only CtCHS1 and CtCHS3 were cloned in this study. The reason was that these two genes were cloned from cDNA of flowers, and the material sequenced by three generations is the mixed samples, including the roots, stems, leaves and flowers. CtCHS2 was not cloned in the cDNA of the flower, indicating that the CtCHS2 gene is not expressed in the flowers.
4.3. Our study laies a foundation for analyzing metabolic mechanism of flavonoids in C. tinctorius
Generally, genes function can be verified by transgenic plants in vitro, and also be verified by enzyme activity in vitro. The immaturity of the transgenic technology system for most of traditional Chinese medicines, gene functions in the flavonoid metabolic pathway have been verified by the enzyme catalysis reaction in vitro, such as GbCHI from Ginkgo biloba L. (Sun et al., 2015) and chalcone synthase from Freesia hybrida Klatt. (Cheng et al., 2011). In our experiments, we also focused on the in vitro enzymatic activity test to verify the activity of the protein, and LC-MS further proved that CtCHS1 was involved in the flavonoid synthesis pathway. Guo et al. cloned one CHS gene and used an agrobacterium-mediated pollen-tube pathway transgenic in C. tinctorius to verify its function (Guo et al., 2017). Sequence analysis showed that the gene was identical to CtCHS1 in this study. Our results validate the function of the gene from the aspect of enzyme activity and complement the Guo’s research.
Although molecular characterization and enzyme activity analysis of CtCHS1 proved CtCHS1 participated in the conversion of p-coumaroyl-CoA and malonyl-CoA substrates to naringenin chalcone in C. tinctorius, it has only been proved to be active by our experiments, but its active conditions and optimal reaction conditions need to be further studied. Interestingly, although the transcriptional expression of CtCHS1 and CtCHS3 can be detected by RT-PCR, the protein of CtCHS3 has not been detected. Whether there is post-transcriptional modification or not requires further testing.
5. Conclusion
Our study cloned and proved CtCHS1 participated in the conversion of p-coumaroyl-CoA and malonyl-CoA substrates to naringenin chalcone in C. tinctorius, providing genetic resources for the synthesis of flavonoids in vitro.
Declaration of Competing Interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Acknowledgments
This project was supported by grants from the National Natural Science Foundation of China (No. 82274039, 81803669) and China Postdoctoral Science Foundation (No. 2018M643790XB)
Contributor Information
Jiang Chen, Email: janshen1986@163.com.
Jin Pei, Email: peixjin@163.com.
References
- Asgarpanah J., Kazemivash N. Phytochemistry, pharmacology and medicinal properties of Carthamus tinctorius L. Chinese Journal of Integrative Medicine. 2013;19(2):153–159. doi: 10.1007/s11655-013-1354-5. [DOI] [PubMed] [Google Scholar]
- Ao H., Feng W.W., Peng C. Hydroxysafflor Yellow A: A promising therapeutic agent for a broad spectrum of diseases. Evidence-based Complementary and Alternative Medicine. 2018;2018:1–17. doi: 10.1155/2018/8259280. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen J., Tang X.H., Ren C.X., Wei B., Wu Y.Y., Wu Q.H., Pei J. Full-length transcriptome sequences and the identification of putative genes for flavonoid biosynthesis in safflower. BMC Genomics. 2018;19(1):548–560. doi: 10.1186/s12864-018-4946-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cheng H., Li L., Cheng S., Cao F.L., Wang Y., Yuan H.H. Molecular cloning and function assay of a chalcone isomerase gene (GbCHI) from Ginkgo biloba. Plant Cell Report. 2011;30(1):49–62. doi: 10.1007/s00299-010-0943-4. [DOI] [PubMed] [Google Scholar]
- Dao T.T., Linthorst H.J., Verpoorte R. Chalcone synthase and its functions in plant resistance. Phytochemistry Reviews. 2011;10(3):397–412. doi: 10.1007/s11101-011-9211-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Du H., Huang Y.B., Tang Y.X. Genetic and metabolic engineering of isoflavonoid biosynthesis. Applied Microbiology and Biotechnology. 2010;86(5):1293–1312. doi: 10.1007/s00253-010-2512-8. [DOI] [PubMed] [Google Scholar]
- Guo D.D., Xue Y.R., Li D.Q., He B.X., Jia X.L., Dong X., Guo M.L. Overexpression of CtCHS1 increases accumulation of quinochalcone in safflower. Frontiers in Plant Science. 2017;8(1):1409–1419. doi: 10.3389/fpls.2017.01409. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jiang C.G., Schommer C.K., Kim S.Y., Suh D.Y. Cloning and characterization of chalcone synthase from the moss, Physcomitrella patens. Phytochemistry. 2006;67(23):2531–2540. doi: 10.1016/j.phytochem.2006.09.030. [DOI] [PubMed] [Google Scholar]
- Kumar S., Pandey A.K. Chemistry and biological activities of flavonoids: An overview. The Scientific World Journal. 2013;2013:1–16. doi: 10.1155/2013/162750. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lei W., Tang S.H., Luo K.M., Sun M. Molecular cloning and expression profiling of a chalcone synthase gene from hairy root cultures of Scutellaria viscidula Bunge. Genetics and Molecular Biology. 2010;33(2):285–291. doi: 10.1590/S1415-47572010005000031. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ma H., Wang W.P., Xu S.F., Wang L., Wang X.L. Potassium 2-(1-hydroxypentyl)-benzoate improves depressive-like behaviors in rat model. Acta Pharmaceutica Sinica B. 2018;8(6):881–888. doi: 10.1016/j.apsb.2018.08.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nie P.H., Zhang L., Zhang W.H., Rong W.F., Zhi J.M. The effects of hydroxysafflor yellow A on blood pressure and cardiac function. Journal of Ethnopharmacology. 2012;139:746–750. doi: 10.1016/j.jep.2011.11.054. [DOI] [PubMed] [Google Scholar]
- Shinozaki J., Kenmoku H., Nihei K., Masuda K., Noji M., Konno K.…Kazuma K. Cloning and functional analysis of three chalcone synthases from the flowers of safflowers Carthamus tinctorius. Natural Product Communications. 2016;11(6):707–882. [PubMed] [Google Scholar]
- Sun W., Meng X., Liang L., Jiang W., Huang Y., He J.…Wang L. Molecular and biochemical analysis of chalcone synthase from Freesia hybrid in flavonoid biosynthetic pathway. PLos One. 2015;10(3):1–18. doi: 10.1371/journal.pone.0119054. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tuteja J.H., Clough S.J., Chan W.C., Vodkin L.O. Tissue-specific gene silencing mediated by a naturally occurring chalcone synthase gene cluster in Glycine max. Plant Cell. 2004;16(1):819–835. doi: 10.1105/tpc.021352. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang Z.B., Yu Q.B., Shen W.X., El Mohtar C.A., Zhao X.C., Gmitter F.G., Jr Functional study of CHS gene family members in citrus revealed a novel CHS gene affecting the production of flavonoids. BMC Plant Biology. 2018;18(1):189–199. doi: 10.1186/s12870-018-1418-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Winkel-Shirley B. Biosynthesis of flavonoids and effects of stress. Current Opinion in Plant Biology. 2002;5(3):218–223. doi: 10.1016/s1369-5266(02)00256-x. [DOI] [PubMed] [Google Scholar]
- Xian, B., Wang, R.; Jiang, H. J., Zhou, Y. F., Yan, J., Huang X. L., Chen, J., Wu, Q. H., Chen, C., Xi, Z.Q., Ren, C. X., & Pei, J.(2022). Comprehensive review of two groups of flavonoids in Carthamus tinctorius L.. Biomedicine & Pharmacotherapy, 153 (2022), 113462. [DOI] [PubMed]