Abstract
We investigated the effects of supplementing arginine (Arg) and branched-chain amino acids (BCAA) in broilers fed reduced-protein diets and challenged with Eimeria spp. All birds were fed the same starter diet meeting Cobb 500 nutrient specifications from d 1 to 9. Four grower diets: positive control (PC) with 20.0% crude protein (CP); reduced-protein negative control (NC) with 17.5% CP; or NC supplemented with Arg or BCAA at 50% above recommendations (ARG or BCAA) were fed to the birds from d 9 to 28. Birds were allocated in a 2 × 4 factorial arrangement (4 diets, each with or without challenge), with 8 replicates per treatment. On d 14, the challenge groups were orally gavaged with mixed Eimeria spp. Intestinal permeability was higher (P < 0.05) in NC than PC, whereas the permeability of ARG and BCAA groups did not differ significantly from PC. On d 28, a significant interaction (P < 0.01) was observed in CD8+: CD4+ ratios in cecal tonsils (CT), Eimeria challenge increased the ratios in all groups except for the ARG group. On d 21, a significant interaction was found for CD4+CD25+ percentages in CT (P < 0.01) that Eimeria challenge increased the percentages only in PC and NC groups. On d 21 and 28, significant interactions (P < 0.01) were found for macrophage nitric oxide (NO) production. In nonchallenged birds, NO was higher in the ARG group than other groups, but in challenged birds, NO was higher in both ARG and BCAA groups. On d 21, a significant interaction was found for bile anticoccidial IgA concentrations (P < 0.05) that Eimeria challenge increased IgA only in NC and ARG groups. The results suggest that a reduced-protein diet exacerbates the impact of the Eimeria challenge on intestinal integrity, but this could be mitigated by Arg and BCAA supplementations. Arginine and BCAA supplementations in reduced-protein diets could be beneficial for broilers against Eimeria infection by enhancing the immune responses. The beneficial effects of Arg supplementation tended to be more pronounced compared to BCAA supplementation.
Key words: Arginine, branched-chain amino acid, coccidiosis, Eimeria, broiler
INTRODUCTION
Coccidiosis, caused by the protozoan parasite of the genus Eimeria, has been a persistent challenge to the poultry industry, causing substantial financial losses worldwide annually (Blake et al., 2020). The impact of coccidiosis in chickens can be severe, with damaged intestinal integrity, increased inflammation, and disturbed immune responses causing a decline in growth and, in some cases, even high mortality (Castro et al., 2020a; Teng et al., 2020; Sharma et al., 2022). Anticoccidial drugs have long been used to prevent coccidiosis (Mesa-Pineda et al., 2021). However, the emergence of drug resistance (Abbas et al., 2011) and public unease about the usage of antibiotics in animal production (Chapman et al., 2005) have raised concerns about the continued use and efficacy of the drugs. Vaccinating birds against coccidiosis has been proven effective, but the difficulty and cost of vaccine implementation present some drawbacks to this method (Mesa-Pineda et al., 2021). The limitations of both methods have necessitated the exploration of new approaches to control or reduce the impact of coccidiosis. One promising solution is through nutritional interventions, such as incorporating feed additives including functional amino acids in the diets of broilers to minimize intestinal damage and facilitate recovery (Santos et al., 2022).
Arginine, as an essential amino acid for poultry, is not only important for the growth and development of broiler chickens but also plays an important role in the immune system and tissue recovery (Nirgiotis et al., 1991; Stechmiller et al., 2005; Lee et al., 2023). Arginine metabolism occurs via 2 well-regulated pathways: the first pathway, where Arg is metabolized by nitric oxide (NO) synthase to produce NO, is activated in response to inflammation or pathogen infections, and the second pathway, where Arg is metabolized by arginase into ornithine, is active during growth and tissue repair (Stechmiller et al., 2005; Morris, 2007; Martí and Reith, 2021; Lee et al., 2023). Nitric oxide has been demonstrated to be an immune system modulator with direct toxic effects on protozoan parasites (Alvarez et al., 2011). Ornithine, along with its downstream metabolites, polyamines, and collagen, has been shown to be critical in the process of wound healing and tissue recovery (Albina et al., 1990; Stechmiller et al., 2005). Both pathways could be beneficial in minimizing the impacts of coccidiosis, either by reducing the severity of the infection or by promoting host recovery.
Branched-chain amino acids (BCAA), namely leucine, isoleucine, and valine, are also essential amino acids. Besides their well-documented roles in protein synthesis (Kimball and Jefferson, 2001), studies have shown that BCAA are involved in modulating immune responses and intestinal health (Kim et al., 2022). Several studies have demonstrated the beneficial effects of BCAA supplementation on the development of villi (Chang et al., 2015; Allameh and Toghyani, 2019). Additionally, BCAA provides the amino groups for the synthesis of glutamine, which is considered the major fuel source for epithelial cells to maintain the gut barrier functions (Wu, 2009; Rao and Samak, 2012). Branched-chain amino acids have also been reported to be an important energy source for immune cells (Fan et al., 2015; Nie et al., 2018), and given the high dependence of the immune system on protein synthesis for producing cytokines, immunoglobulins, immune cells, and other immune molecules (Calder, 2006; Li et al., 2007), BCAA are also considered essential for normal immune functions (Bifari and Nisoli, 2017). Moreover, BCAA are the key regulators of the mechanistic target of rapamycin (mTOR) pathway which regulates protein synthesis and cell proliferation (Moberg et al., 2016; Zhang et al., 2017; Kim et al., 2022). Several studies have shown that the disruption of the mTOR pathway would lead to damage in the intestinal epithelial barrier functions (Fujishita et al., 2008; Sampson et al., 2016), whereas its activation could improve intestinal integrity by enhancing the tight junction protein expressions (Shao et al., 2017). In addition, the mTOR pathway plays an important role in the immune system by promoting differentiation, activation, and functions of lymphocytes (Powell et al., 2012) as well as regulating the innate immunity (Weichhart et al., 2015). Therefore, BCAA supplementation could potentially promote intestinal health and enhance immune function by modulating the mTOR pathway.
Lowering the protein content in broiler diets is a cost-saving measure due to the increasingly expensive protein sources. In addition, reducing protein content can lead to reduced nitrogen excretion and lower ammonia emissions, lessening the environmental impact (Lemme et al., 2019). However, research has indicated that reducing the protein content of broiler diets may negatively impact performance (Bregendahl et al., 2002; Dean et al., 2006). On the other hand, research has also shown that when essential amino acid requirements were met by crystalline amino acid supplementations in reduced-proteins diets, broilers could maintain normal growth, suggesting that adequate supplementation of essential amino acids could be of more importance than meeting the protein requirement in broiler diets (van Harn et al., 2019; Attia et al., 2020; Teng et al., 2021).
We aimed to investigate the effects of supplementing reduced-protein diets with Arg or BCAA on intestinal health and immune parameters in broilers challenged with Eimeria spp. We hypothesized that supplementations of Arg and BCAA in reduced-protein diets could improve intestinal integrity and immune responses of broilers challenged with Eimeria spp. due to the modulating effects of Arg and BCAA on the immune system and intestinal health described above.
MATERIALS AND METHODS
All the animal experiment procedures used in this study were approved by the Institutional Animal Care and Use Committee of the University of Georgia (A2021 12-012).
Birds, Diets, and Eimeria Challenge
A total of 1,280 one-day-old male Cobb chicks were allocated into 8 treatments in a randomized complete block design. The 8 treatments were in a 2 × 4 factorial arrangement (8 replicated pens per group with 20 birds per pen), with diet and Eimeria challenge as main factors. The study was conducted for 35 d, and chickens were raised in floor pens with ad libitum access to feed and water. The temperature and lighting programs followed the Cobb 500 Broiler Management Guide (Cobb-Vantress, 2018a).
All birds were fed the same starter diet (as crumbs) from d0-9 and the same finisher diet (as pellets) from d 28 to 35. From d 9 to 28, four experimental grower diets (as pellets) were fed to the birds. The experimental diets included a corn-soybean meal-based control diet (PC) with 20.0% crude protein content; a reduced-protein negative control (NC) with 17.5% crude protein content, a NC supplemented with Arg at 50% above breeder recommendations (ARG), and a NC supplemented with BCAA including leucine, isoleucine, and valine at 50% above breeder recommendations whereas maintaining the ratios among the BCAA consistent with the other grower diets (BCAA). For the PC diet, the protein content and essential amino acids including BCAA and Arg met the Cobb 500 recommendations (Cobb-Vantress, 2018b). For the reduced protein diets (NC, ARG, and BCAA), essential amino acids were supplemented and balanced to meet breeder recommendations with the exception of Arg and BCAA in their respective diets, which were supplemented at 50% above the recommendations. The feedstuffs and chemical composition of the diets are shown in Table 1. The birds were fed the experimental grower diets without any challenge from d 9 to14 to allow them to adapt to the diet change.
Table 1.
Ingredient formulation and nutrient and energy composition (g/kg) of experimental diets.
| Starter | Grower (d 9–28) |
Finisher | ||||
|---|---|---|---|---|---|---|
| Ingredients | (d 0–9) | PC1 | NC1 | ARG | BCAA1 | (d 28–35) |
| Corn | 536 | 610 | 716 | 711 | 708 | 653 |
| Soybean meal | 363 | 303 | 193 | 193 | 194 | 235 |
| Soybean oil | 44.0 | 48.9 | 33.6 | 33.1 | 27.5 | 46.0 |
| Corn starch | 30.0 | 34.5 | ||||
| Cellulose filler | 6.20 | |||||
| L-Lysine HCl | 0.20 | 2.50 | 5.80 | 5.80 | 5.80 | 1.32 |
| DL-Methionine | 1.20 | 2.90 | 3.90 | 3.90 | 3.90 | 1.30 |
| L-Threonine | 0.30 | 1.10 | 2.50 | 2.50 | 2.50 | 0.70 |
| L-Tryptophan | 0.40 | 0.40 | 0.40 | |||
| Glycine | 1.40 | 1.50 | 1.50 | |||
| L-Phenylalanine | 0.80 | 0.80 | 0.80 | |||
| L-Arginine | 0.50 | 3.20 | 8.30 | 3.20 | ||
| L-Leucine | 5.90 | |||||
| L-Isoleucine | 1.50 | 1.50 | 5.10 | |||
| L-Valine | 0.10 | 1.90 | 1.90 | 6.00 | ||
| Dicalcium phosphate | 10.0 | 16.7 | 17.3 | 17.3 | 17.3 | 7.45 |
| Limestone | 9.00 | 3.80 | 4.20 | 4.20 | 4.20 | 8.10 |
| Sodium chloride | 2.80 | 2.30 | 1.20 | 1.20 | 1.20 | 3.00 |
| Sodium bicarbonate | 2.00 | 2.70 | 5.00 | 5.00 | 5.00 | 2.00 |
| Potassium carbonate | 3.00 | 3.10 | 3.10 | |||
| Vitamin premix2 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 |
| Trace mineral premix3 | 0.80 | 0.80 | 0.80 | 0.80 | 0.80 | 0.80 |
| Phytase4 | 0.10 | 0.03 | 0.03 | 0.03 | 0.03 | 0.03 |
| Titanium dioxide | 3.00 | 3.00 | 3.00 | 3.00 | ||
| Total | 1,000 | 1,000 | 1,000 | 1,000 | 1,000 | 1,000 |
| Calculated nutrients (g/kg) and energy | ||||||
| Protein | 220 | 203 | 175 | 185 | 183 | 171 |
| ME, kcal/kg | 3,038 | 3,089 | 3,115 | 3,111 | 3,116 | 3,169 |
| Ca | 7.23 | 6.80 | 6.81 | 6.81 | 6.81 | 5.88 |
| Available P | 2.99 | 4.08 | 4.03 | 4.03 | 4.03 | 2.35 |
| Digestible amino acids | ||||||
| Lysine | 12.4 | 12.6 | 12.2 | 12.1 | 12.1 | 9.73 |
| Methionine | 4.60 | 6.03 | 6.48 | 6.48 | 6.47 | 4.05 |
| Total sulfur amino acids | 8.17 | 9.31 | 9.17 | 9.15 | 9.14 | 6.91 |
| Threonine | 8.71 | 8.60 | 8.23 | 8.22 | 8.21 | 7.03 |
| Arginine | 14.9 | 13.6 | 12.6 | 17.5 | 12.6 | 10.8 |
| Leucine | 18.8 | 17.3 | 14.3 | 14.3 | 20.1 | 15.2 |
| Isoleucine | 9.58 | 8.47 | 7.85 | 7.84 | 11.4 | 7.08 |
| Valine | 10.5 | 9.52 | 9.19 | 9.18 | 13.2 | 8.01 |
| Analyzed amino acids, g/kg | ||||||
| Protein | 221 | 205 | 174 | 189 | 183 | 179 |
| Lysine | 12.7 | 13.2 | 12.8 | 13.3 | 12.8 | 10.7 |
| Methionine | 4.30 | 5.70 | 6.00 | 6.30 | 6.20 | 4.10 |
| Total sulfur amino acids | 7.70 | 9.00 | 8.70 | 9.10 | 8.90 | 7.10 |
| Threonine | 8.80 | 8.60 | 8.30 | 8.80 | 8.50 | 7.50 |
| Arginine | 14.2 | 13.2 | 12.3 | 17.1 | 12.6 | 11.2 |
| Leucine | 18.2 | 16.9 | 14.1 | 14.7 | 19.1 | 15.4 |
| Isoleucine | 9.50 | 8.60 | 7.80 | 8.30 | 11.0 | 7.40 |
| Valine | 10.2 | 9.40 | 8.90 | 9.30 | 12.6 | 8.10 |
| Amino acid ratios to lysine | ||||||
| Lysine | 100 | 100 | 100 | 100 | 100 | 100 |
| Methionine | 37.1 | 43.2 | 46.9 | 47.4 | 48.4 | 38.3 |
| Total sulfur amino acids | 65.9 | 68.2 | 68 | 68.4 | 69.5 | 66.4 |
| Threonine | 70.2 | 65.2 | 64.8 | 66.2 | 66.4 | 70.1 |
| Arginine | 120 | 100 | 96.1 | 129 | 98.4 | 105 |
| Leucine | 152 | 128 | 110 | 111 | 149 | 144 |
| Isoleucine | 77.3 | 65.2 | 60.9 | 62.4 | 85.9 | 69.2 |
| Valine | 84.7 | 71.2 | 69.5 | 69.9 | 98.4 | 75.7 |
PC, positive control with 20.0% crude protein content; NC, negative control with 17.5% crude protein content; ARG, negative control supplemented with arginine at 50% above breeder recommendations; BCAA, negative control supplemented with BCAA at 50% above breeder recommendations.
Vitamin premix: Supplemented per kg of diet: thiamin mononitrate, 2.4 mg; nicotinic acid, 44 mg; riboflavin, 4.4 mg; D-Ca pantothenate, 12 mg; vitamin B12 (cobalamin), 12.0 g; pyridoxine HCl, 4.7 mg; D-biotin, 0.11 mg; folic acid, 5.5 mg; menadione sodium bisulfite complex, 3.34 mg; choline chloride, 220 mg; cholecalciferol, 27.5 g; transretinyl acetate, 1,892 g; α tocopheryl acetate, 11 mg; ethoxyquin, 125 mg.
Mineral premix: Supplemented as per kg of diet: manganese (MnSO4.H2O), 60 mg; iron (FeSO4.7H2O), 30 mg; zinc (ZnO), 50 mg; copper (CuSO4.5H2O), 5 mg; iodine (ethylene diaminedihydroiodide), 0.15 mg; selenium (NaSeO3), 0.3 mg.
For starter diet Quantum Blue phytase was included at 0.10 g/kg; For grower and finisher diets phytase provided by Adisseo was included at 0.03 g/kg.
On d 14, the birds in the challenged groups were orally gavaged with a solution containing 12,500 sporulated oocysts of Eimeria maxima, 12,500 sporulated oocysts of Eimeria tenella, and 62,500 sporulated oocysts of Eimeria acervulina suspended in 1 mL of distilled water. The nonchallenged groups were orally gavaged with 1 mL of distilled water. On d 21 and 28, two birds per pen were randomly selected and euthanized for sample collection. Jejunal tissue samples were collected from both birds for morphometric analysis. Bile was collected from both birds and pooled together for measuring IgA concentrations. Ileal tissue samples, cecal tonsils (CT), spleen, and cecal contents were collected from 1 bird per pen for gene expression, immune parameter, and short-chain fatty acid (SCFA) profile analyses.
Intestinal Permeability and Morphology
On d 21, 1 bird per pen was gavaged with 1 mL of fluorescein isothiocyanate dextran (FITC-d; 2.2 mg/mL, MW 4000; Sigma-Aldrich, St. Louis, MO) to measure intestinal permeability. Birds were euthanized 2 h after the gavage, and blood was collected by cardiac puncture immediately after euthanasia. The blood was centrifuged at 1,000 × g for 15 min (Eppendorf Centrifuge 5430R, Eppendorf, Hamburg, Germany), and 100 μL of serum was used to determine the FITC-d concentration following the method described previously (Sharma et al., 2022).
On d 21 and 28, approximately 2 cm segment of the jejunum was collected and fixed in 10% formalin after rinsing with PBS. After fixation, the jejunal tissues were cut into short sections and embedded in paraffin. Four μm sections were stained with hematoxylin and eosin. The intestinal morphology of each sample was observed and captured under a light microscope with 2 magnification (BZ-X800, Keyence Inc., Itasca, IL). The villus height (VH), crypt depth (CD), and villus height to crypt depth ratio (VH:CD) were determined using the methods described by Teng et al. (2020).
Reverse Transcription and Real-time PCR Analysis
On d 21 and 28, jejunal and ileal tissues and CT were collected and snap-frozen in liquid nitrogen. The tissues were subsequently homogenized with a MiniBeadBeater-16 (BioSpec Products Inc., Bartlesville, OK), and RNA was extracted using QIAzol Lysis Reagents (Qiagen, Germantown, MD) per the manufacturer's protocol. RNA concentrations were determined by a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, MA). All extracted RNA samples were diluted to a uniform concentration and reverse-transcribed to cDNA using high-capacity cDNA synthesis kits (Applied BioSystems, Life Technologies, CA). The cDNA samples were then mixed with SYBR Green Master Mix (Bio-Rad Laboratories, Hercules, CA), and reverse and forward primers for the real-time PCR analysis performed in duplicates in a Step One thermocycler (Applied Biosystem, Foster City, CA). The 2−ΔΔCt method was used to analyze target gene expression over a housekeeping gene β-actin (Livak and Schmittgen, 2001). Primer sequences for tested genes are listed in Table 2.
Table 2.
List of primer sequences used for real-time PCR.
| Gene symbol1 | Accession number | Forward primer | Reverse primer |
|---|---|---|---|
| Beta-actin2 | NM_205518.2 | CAACACAGTGCTGTCTGGTGGTA | ATCGTACTCCTGCTTGCTGATCC |
| CLDN1 | NM_001013611.2 | TGGAGGATGACCAGGTGAAGA | CGAGCCACTCTGTTGCCATA |
| CLDN3 | NM_204202.2 | CCATCATCCGGGATTTCTAC | GGGGCTCACACATAGTTCCT |
| OCLN | NM_205128.1 | ACGGCAGCACCTACCTCAA | GGCGAAGAAGCAGATGAG |
| ZO1 | XM_046925213.1 | AGGTGAAGTGTTTCGGGTTG | CCTCCTGCTGTCTTTGGAAG |
| ZO2 | NM_001396728.1 | GGCAAATCATTGAGCAGGA | ATTGATGGTGGCTGTAAAGAG |
| IL4 | NM_001398460.1 | CTTATGCAAAGCCTCCACAA | TGGTGGAAGAAGGTACGTAGG |
| IL1β | NM_204524.2 | TGCCTGCAGAAGAAGCCTCG | GACGGGCTCAAAAACCTCCT |
| TNFα | MF000729.1 | CGTGGTTCGAGTCGCTGTAT | CCGTGCAGGTCGAGGTACT |
| IFNγ | NM_205149.2 | CACATATCTGAGGAGCTCTATAC | GTTCATTCGCGGCTTTG |
| TGFβ1 | NM_001318456.1 | ATGAGTATTGGGCCAAAG | ACGTTGAACACGAAGAAG |
| IL10 | NM_001004414.4 | AGCAGATCAAGGAGACGTTC | ATCAGCAGGTACTCCTCGAT |
| mTOR | XM_417614.8 | AAAGCAGCTCTTCCACCAAA | TGGCTCGTGCCAACATACTA |
| 4EBP1 | XM_424384.8 | GCCCAATTGTGGAGGAGTTA | GCACGTGCTTTAGATGTCCA |
| S6K1 | NM_001030721.2 | TACTGGGCAAAGGTGGCTAT | ATTCCGCTCTGCTTTTGTGT |
CLDN1, claudin-1; CLDN3, claudin-3; OCLN, occludin; ZO1, zonula occludens-1; ZO2, zonula occludens-2; IL4, interleukin-4; IL1β, interleukin-1β; TNFα, tumor necrosis factor α; IFNγ, interferon-γ; TGFβ1, transforming growth factor β 1; IL10, interleukin-10; mTOR, mechanistic target of rapamycin; 4EBP1, eukaryotic translation initiation factor 4E binding protein 1; S6KB1, ribosomal protein S6 kinase β1.
Housekeeping gene.
Analysis of CD4+, CD8+, and CD4+CD25+ T Lymphocytes
On d 21 and 28, CT and spleen were collected in 1.5 mL of Roswell Park Memorial Institute (RPMI) media and stored on ice. Single-cell suspensions of the CT and spleen (1 106 cells) were generated as described previously (Shanmugasundaram and Selvaraj, 2012). For CD4+ and CD8+ cell analysis, the cells were incubated with primary phycoerythrin-conjugated mouse antichicken CD4 (Southern Biotech, Birmingham, AL) at 1:250 or FITC-conjugated mouse antichicken CD8 (Southern Biotech) at 1:450 dilutions, and unlabeled mouse IgG at 1:100 dilution in a 96-well plate for 20 min at 4°C. For CD4+CD25+ cell analysis, the cells were incubated with 1 µg/mL mouse antichicken CD25 antibody (Shanmugasundaram and Selvaraj, 2011) and unlabeled mouse IgG at 1:100 dilution in a 96-well plate for 50 min at 4°C, followed by incubation with a 1:250 dilution of FITC-conjugated mouse antichicken CD4 (Southern Biotech) for 20 min at 4°C. After incubation, cells were washed 3 times by centrifugation at 400g for 5 min to remove unbound antibodies using a wash buffer (1 PBS, 2 mM EDTA, 1.5% FBS). A flow cytometer (Guava EasyCyte, Millipore, Billerica, MA) was used to analyze the cells. CD8+:CD4+ ratios were calculated (Shanmugasundaram and Selvaraj, 2012), and CD4+CD25+ cells (regulatory T cells [Tregs]) were expressed as a percentage of CD4+ cells to facilitate comparisons (Shanmugasundaram and Selvaraj, 2011).
Analysis of Macrophage Nitric Oxide Production
On d 21 and 28, spleens were collected in 3 mL of RPMI media and stored on ice. Single cell suspensions were generated as described previously (Shanmugasundaram and Selvaraj, 2012). The cells were then resuspended in 8 mL of RPMI-1640 media supplemented with 4% fetal bovine serum, 2% chicken serum, and 1% penicillin and streptomycin. The cells were incubated for 24 h in T75 cell culture flasks (Southern Labware, Cumming, GA). After incubation, macrophages were removed via trypsinization (5 mL of 0.4% trypsin with 0.025% EDTA) and counted by a cell counter (Invitrogen, Thermo Fisher Scientific, Lenexa, KS). The cells (106 cells/mL) were stimulated with 20 μg/mL of coccidial antigen and incubated for 48 h at 37°C and 5% CO2. Following incubation, plates were centrifuged at 450 g for 5 min, and the supernatant was collected. The RICCA color reagent for nitrite determination (RICCA Chemical Solutions, Arlington, TX) was added to the supernatant, and absorbance was measured at 540 nm using an Epoch microplate spectrophotometer (BioTek, VT). On the same plate as the samples, a standard curve with 0, 7.825, 15.625, 31.25, 62.5, 125, 250, and 500 μmol/L sodium nitrite was created using Gen5 software (Epoch plate reader, BioTek, VT). Nitrite concentrations were measured by comparing to the standard curve generated as described previously (Shanmugasundaram et al., 2013).
Bile Anticoccidial IgA Analysis
On d 21 and 28, bile was collected and snap-frozen in liquid nitrogen and stored at -80°C. Specific anticoccidial immunoglobin A antibodies (IgA) were measured via ELISA. Coccidial antigens were generated by lysing the Eimeria spp. from the inoculum used for challenge through 6 cycles of bead beating (BioSpec Products Inc., Bartlesville, OK), freezing, and thawing. Flat-bottomed, high-binding 96-well plates (Greiner Bio-One, Monroe, NC) were coated with 100 μL/well of 10 μg/mL coccidial antigen in 0.1 M carbonate buffer (pH 9.6) and incubated overnight at 4°C. The plates were then washed 3 times with the wash buffer (0.05% Tween 20 in PBS, pH 7.4). For blocking, 8% nonfat dry milk in the wash buffer (200 μL/well) was added, and the plates were incubated for 90 min at 37°C. The plates were then washed 3 times. Bile samples were diluted 1:800 in PBS containing 8% nonfat dry milk and 0.1 % Tween-20 (VWR, Radnor, PA) and added to the plates at 100 μL/well. After incubation at 37°C for 90 min, the plates were washed 3 times with the wash buffer. HRP-conjugated polyclonal goat antichicken IgA (Bethyl Laboratories, Montgomery, TX) was diluted 1:100,000 with 5% nonfat dry milk in the wash buffer and added to the plates at 100 μL/well. The substrate solution, 3, 3, 5, 5-tetramethylbenzidine, (Sigma-Aldrich, St. Louis, MO) was added to the plates at 100 μL/well. The reaction was stopped by 1 M HCl (100 μL/well). Absorbance was measured at 450 nm using a microplate reader (Spectramax M5, Molecular Devices, San Jose, CA), and antibody concentrations were reported as optical density (Cason et al., 2023).
Cecal SCFA Profile Analysis
Short-chain fatty acid profiles were analyzed according to the method described previously (Lourenco et al., 2020). Cecal contents were collected on d 21 and 28, and the samples were snap-frozen in liquid nitrogen and stored at -80°C. Once thawed, 0.5 g samples were homogenized in 3 mL of distilled water for 1 min. The resulting samples were then centrifuged at 10,000 × g for 10 min, 1 mL of the supernatant was removed into a new centrifuge tube with 0.2 mL of a metaphosphoric acid solution (25% wt./vol), and samples were frozen overnight. After thawing, samples were centrifuged at 10,000 × g for 10 min, and 800 μL of the supernatant was combined with 1600 μL ethyl acetate. The mixture was vigorously homogenized for 10 s and allowed to settle for 5 min. The top layer was transferred to a screw-thread vial and analyzed in a gas chromatograph (Shimadzu GC-2010 plus; Shimadzu Corporation, Kyoto, Japan) equipped with an autoinjector (AOC-20i; Shimadzu Corporation, Kyoto, Japan). A capillary column (Zebron ZB-FFAP; 30 m × 0.32 mm × 0.25 μm; Phenomenex Inc., Torrance, CA) was used for the separation of the SCFA. The sample injection volume was set at 1 mL, and helium was used as the carrier gas. The column temperature was initially set at 110°C and gradually increased to 200°C over a period of 6 min. The flame ionization detector was set at 350°C. The samples’ peak heights were compared to actual standards’ peak heights to determine the amounts of SCFAs in the samples.
Statistical Analysis
All data analyses were performed in R software (version 4.2.2, R Foundation for Statistical Computing, Vienna, Austria). The normality of the residuals for all data was checked by Shapiro–Wilk test. A natural log transformation was performed on NO on d 28, CT Treg on d 28, and IgA on d 28 to obtain a normal residual distribution. These data are presented as back-transformed means with their confidence intervals. A 2-way ANOVA was conducted for all data except for the histology data to examine the main effects (diet and Eimeria challenge) and their interaction. For the histology data, a 2-way ANCOVA was performed with the body weight (BW) at sampling as a covariate to account for a priori differences in performance (Sakkas et al., 2018; Taylor et al., 2022). When significant differences were observed, Tukey's multiple comparison test was applied to separate and compare the treatment means. The significance level was set at P < 0.05.
RESULTS
Intestinal Permeability and Morphology
On d 21 and 28, no significant dietary effects or diet by challenge interactive effects were found for intestinal morphology (Table 3). On d 21, birds challenged with Eimeria had lower VH (P = 0.003) and VH:CD (P < 0.001) and higher CD (P < 0.001) compared to the nonchallenged birds. On d 28, Eimeria challenge increased CD (P = 0.049) and decreased VH:CD (P = 0.031) but had no significant effect on VH.
Table 3.
Effects of reduced-protein diets supplemented with arginine or branched chain amino acids on jejunal morphology in broiler chickens challenged with Eimeria spp. on d 21 and 28.
| D 21 |
D 28 |
||||||
|---|---|---|---|---|---|---|---|
| VH1 | CD1 | VH:CD1 | VH | CD | VH:CD | ||
| Means for the main effect of challenge2 | |||||||
| NCG (-) | 1,153a | 168b | 7.14a | 1,440 | 160b | 9.19a | |
| CG (+) | 984b | 236a | 4.45b | 1,378 | 192a | 7.38b | |
| Means for the main effect of diets3 | |||||||
| PC | 1,073 | 201 | 5.60 | 1,434 | 184 | 8.05 | |
| NC | 1,106 | 199 | 6.23 | 1,343 | 177 | 7.74 | |
| ARG | 1,032 | 209 | 5.63 | 1,446 | 164 | 9.11 | |
| BCAA | 1,063 | 199 | 5.72 | 1415 | 179 | 8.24 | |
| Means for the interaction effect | |||||||
| - | PC | 1,102 | 174 | 6.52 | 1,442 | 179 | 8.32 |
| - | NC | 1,251 | 162 | 7.96 | 1,333 | 155 | 8.65 |
| - | ARG | 1,070 | 160 | 7.09 | 1,582 | 153 | 10.4 |
| - | BCAA | 1,189 | 177 | 6.97 | 1,404 | 153 | 9.40 |
| + | PC | 1,044 | 229 | 4.67 | 1,425 | 189 | 7.79 |
| + | NC | 962 | 236 | 4.49 | 1,353 | 200 | 6.83 |
| + | ARG | 994 | 257 | 4.16 | 1,311 | 174 | 7.82 |
| + | BCAA | 936 | 220 | 4.47 | 1,425 | 205 | 7.08 |
| Source of variation | |||||||
| Challenge | 0.003 | <0.001 | <0.001 | 0.478 | 0.049 | 0.031 | |
| Diet | 0.700 | 0.943 | 0.735 | 0.481 | 0.332 | 0.151 | |
| Interaction | 0.140 | 0.446 | 0.518 | 0.102 | 0.260 | 0.330 | |
| SEM | 64.3 | 17.2 | 0.593 | 75.5 | 13.7 | 0.709 | |
Means within a column lacking a common superscript differ (P < 0.05).
VH, villus height (μm); CD, crypt depth (μm).
NCG, nonchallenged group; CG, challenged group.
PC, positive control with 20.0% crude protein content; NC, negative control with 17.5% crude protein content; ARG, negative control supplemented with arginine at 50% above breeder recommendation; BCAA, negative control supplemented with BCAA at 50% above breeder recommendation.
There was no diet by challenge interactive effect observed for intestinal permeability. Eimeria challenge significantly increased (P < 0.01) intestinal permeability (Figure 1A). Birds in the NC group had significantly higher permeability than those in the PC group (P < 0.05), whereas the intestinal permeability of the ARG and BCAA groups did not differ significantly from the PC group (Figure 1B).
Figure 1.
Effects of reduced-protein diets supplemented with arginine or branched chain amino acids on intestinal permeability in broilers chickens challenged with Eimeria spp. Intestinal permeability was determined by fluorescein isothiocyanate dextran concentration in serum on d 21. PC, positive control with 20.0% crude protein; NC, negative control with 17.5% crude protein; ARG and BCAA, negative control supplemented with arginine or BCAA. The error bars represent the SEM values. Bars without a common letter differ significantly. P-values: P-challenge < 0.001, P-diet = 0.047, P-interaction = 0.453.
Gene Expression of Tight Junction Proteins, Cytokines, and mTOR Pathway Related Genes
The housekeeping gene β-actin was not affected by challenge or treatments. There was no diet by challenge interactive effects observed on mRNA expression of tight junction proteins on both d 21 and 28 (Table 4). On d 21, the mRNA expression of claudin-1 (CLDN1) (P < 0.001) and occludin (OCLN) (P = 0.005) was significantly higher in the Eimeria challenged birds than the nonchallenged birds. The ARG group tended to have higher mRNA expression of CLDN1 (P = 0.061) than the other treatment groups. On d 28, the mRNA expression of claudin-3 (CLDN3) (P < 0.001) and OCLN (P = 0.009) was lower in the challenged birds than the nonchallenged birds. There was a tendency of diet by challenge interactive effect (P = 0.096); the mRNA expression of CLDN3 tended to be higher in the ARG group than the other treatment groups in the nonchallenged birds but not in the challenged birds.
Table 4.
Effects of reduced-protein diets supplemented with arginine or branched-chain amino acids on gene expression of tight junction proteins and mTOR pathway related genes in broiler chickens challenged with Eimeria spp. on d 21 and 28.
| D 21 |
D 28 |
||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CLDN11 | CLDN31 | OCLN1 | ZO11 | ZO21 | mTOR1 | 4EBP11 | S6K11 | CLDN1 | CLDN3 | OCLN | ZO1 | ZO2 | mTOR | 4EBP1 | S6K1 | ||
| Means for the main effect of challenge2 | |||||||||||||||||
| NCG (-) | 1.03b | 1.03 | 1.06b | 1.13 | 1.08 | 1.26 | 1.19 | 1.02 | 1.07 | 1.18a | 0.92a | 1.05 | 1.04 | 1.03 | 1.07 | 1.01 | |
| CG (+) | 1.42a | 1.06 | 1.31a | 1.14 | 1.10 | 1.10 | 1.30 | 0.91 | 0.99 | 0.78b | 0.74b | 1.03 | 0.97 | 0.95 | 1.06 | 1.03 | |
| Means for the main effect of diets3 | |||||||||||||||||
| PC | 1.12 | 1.01 | 1.15 | 1.05 | 1.05 | 1.06 | 1.10 | 0.93 | 1.07 | 0.92 | 0.88 | 1.05 | 1.02 | 1.00 | 1.07 | 1.02 | |
| NC | 1.27 | 1.05 | 1.21 | 1.12 | 1.07 | 1.21 | 1.40 | 0.99 | 1.00 | 0.98 | 0.82 | 1.08 | 1.05 | 1.03 | 1.06 | 1.04 | |
| ARG | 1.42 | 1.07 | 1.17 | 1.11 | 1.06 | 1.24 | 1.23 | 0.93 | 1.04 | 1.11 | 0.81 | 1.00 | 1.00 | 0.97 | 1.04 | 0.98 | |
| BCAA | 1.09 | 1.06 | 1.20 | 1.19 | 1.17 | 1.21 | 1.26 | 1.01 | 0.99 | 0.91 | 0.81 | 1.02 | 0.98 | 0.97 | 1.08 | 1.02 | |
| Means for the interaction effect | |||||||||||||||||
| - | PC | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 |
| - | NC | 1.08 | 1.12 | 1.08 | 1.21 | 1.03 | 1.25 | 1.22 | 0.97 | 1.11 | 1.19 | 0.86 | 1.05 | 1.11 | 1.03 | 1.07 | 1.01 |
| - | ARG | 1.14 | 1.04 | 1.16 | 1.15 | 1.12 | 1.36 | 1.24 | 1.07 | 1.18 | 1.45 | 0.94 | 1.09 | 1.07 | 1.06 | 1.12 | 1.03 |
| - | BCAA | 0.92 | 0.96 | 1.00 | 1.15 | 1.15 | 1.42 | 1.30 | 1.05 | 0.98 | 1.07 | 0.86 | 1.05 | 1.00 | 1.03 | 1.09 | 1.02 |
| + | PC | 1.25 | 1.02 | 1.30 | 1.10 | 1.10 | 1.12 | 1.20 | 0.87 | 1.15 | 0.85 | 0.76 | 1.10 | 1.04 | 1.00 | 1.15 | 1.11 |
| + | NC | 1.47 | 0.98 | 1.34 | 1.15 | 1.11 | 1.16 | 1.58 | 1.00 | 0.90 | 0.77 | 0.77 | 1.10 | 0.98 | 1.02 | 1.04 | 1.07 |
| + | ARG | 1.71 | 1.10 | 1.19 | 1.06 | 1.00 | 1.12 | 1.15 | 0.80 | 0.90 | 0.78 | 0.69 | 0.90 | 0.92 | 0.88 | 0.96 | 0.92 |
| + | BCAA | 1.26 | 1.16 | 1.40 | 1.24 | 1.19 | 1.01 | 1.29 | 0.96 | 1.00 | 0.75 | 0.75 | 0.99 | 0.95 | 0.92 | 1.08 | 1.03 |
| Source of variation | |||||||||||||||||
| Challenge | <0.001 | 0.739 | 0.005 | 0.862 | 0.677 | 0.310 | 0.171 | 0.112 | 0.375 | <0.001 | 0.009 | 0.672 | 0.150 | 0.064 | 0.790 | 0.656 | |
| Diet | 0.061 | 0.973 | 0.946 | 0.371 | 0.475 | 0.830 | 0.077 | 0.787 | 0.909 | 0.190 | 0.838 | 0.824 | 0.783 | 0.769 | 0.885 | 0.660 | |
| Interaction | 0.664 | 0.657 | 0.441 | 0.609 | 0.544 | 0.636 | 0.150 | 0.573 | 0.301 | 0.096 | 0.724 | 0.390 | 0.557 | 0.356 | 0.135 | 0.370 | |
| SEM | 0.133 | 0.134 | 0.117 | 0.092 | 0.084 | 0.211 | 0.115 | 0.099 | 0.125 | 0.102 | 0.089 | 0.090 | 0.074 | 0.057 | 0.065 | 0.064 | |
Means within a column lacking a common superscript differ (P < 0.05).
CLDN1, claudin-1; CLDN3, claudin-3; OCLN, occludin; ZO1, zonula occludens-1; ZO2, zonula occludens-2; mTOR, mechanistic target of rapamycin; 4EBP1, eukaryotic translation initiation factor 4E binding protein 1; S6KB1, ribosomal protein S6 kinase β1.
NCG, nonchallenged group; CG, challenged group.
PC, positive control with 20.0% crude protein content; NC, negative control with 17.5% crude protein content; ARG, negative control supplemented with arginine at 50% above breeder recommendations; BCAA, negative control supplemented with BCAA at 50% above breeder recommendations.
No dietary effects or diet by challenge interactive effect were observed for the mRNA expression of cytokines (Table 5). On d 21, Eimeria challenged birds had higher mRNA expression of IL4 (P = 0.013) and interferon-γ (IFNγ) (P = 0.030) whereas lower mRNA expression of IL10 (P = 0.001) compared to the nonchallenged birds. On d 28, the challenged birds had significantly higher mRNA expression of IL4 (P = 0.029) and transforming growth factor-β1 (TGFβ1) (P = 0.021) but lower mRNA expression of IL1β (P = 0.001) compared to the nonchallenged birds.
Table 5.
Effects of reduced-protein diets supplemented with arginine or branched-chain amino acids on gene expression of cytokines and mTOR pathway related genes in broiler chickens challenged with Eimeria spp. on d 21 and 28.
| D 21 |
D 28 |
||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| IL41 | IL1β1 | TNFα1 | IFNγ1 | TGFβ11 | IL101 | mTOR1 | 4EBP11 | S6K11 | IL4 | IL1β | TNFα | IFNγ | TGFβ1 | IL10 | mTOR | 4EBP1 | S6K1 | ||
| Means for the main effect of challenge2 | |||||||||||||||||||
| NCG (-) | 0.94b | 0.96 | 1.06 | 0.92b | 0.97 | 0.97a | 1.01 | 0.99 | 0.96 | 1.34b | 1.05a | 1.02 | 0.98 | 0.97b | 0.83 | 0.97 | 1.02 | 0.97 | |
| CG (+) | 1.17a | 0.93 | 1.11 | 1.25a | 0.93 | 0.71b | 0.90 | 1.01 | 1.00 | 1.63a | 0.81b | 0.97 | 0.87 | 1.09a | 0.75 | 0.96 | 1.04 | 0.98 | |
| Means for the main effect of diets3 | |||||||||||||||||||
| PC | 1.00 | 0.92 | 1.04 | 1.10 | 0.93 | 0.82 | 0.93 | 1.00 | 0.99 | 1.23 | 0.94 | 0.98 | 1.08 | 1.01 | 0.87 | 0.95 | 0.98 | 0.95 | |
| NC | 1.20 | 0.96 | 1.21 | 0.99 | 1.01 | 0.94 | 1.02 | 1.02 | 1.02 | 1.55 | 0.91 | 0.99 | 0.92 | 1.00 | 0.75 | 1.01 | 1.11 | 0.98 | |
| ARG | 1.01 | 0.89 | 1.03 | 1.25 | 0.91 | 0.78 | 0.86 | 0.98 | 0.98 | 1.59 | 0.88 | 1.02 | 0.97 | 1.04 | 0.68 | 0.97 | 1.06 | 0.99 | |
| BCAA | 0.99 | 1.02 | 1.05 | 0.96 | 0.94 | 0.84 | 0.99 | 1.00 | 0.94 | 1.55 | 1.00 | 0.97 | 0.74 | 1.07 | 0.85 | 0.93 | 0.96 | 0.97 | |
| Means for the interaction effect | |||||||||||||||||||
| - | PC | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 |
| - | NC | 1.11 | 0.91 | 1.16 | 1.00 | 0.99 | 1.01 | 1.08 | 0.95 | 0.97 | 1.40 | 1.01 | 0.99 | 0.92 | 0.91 | 0.61 | 0.98 | 1.08 | 0.98 |
| - | ARG | 0.83 | 0.93 | 1.05 | 0.85 | 0.94 | 0.86 | 0.90 | 1.03 | 1.00 | 1.54 | 0.95 | 1.03 | 1.08 | 0.94 | 0.68 | 1.00 | 1.07 | 1.00 |
| - | BCAA | 0.78 | 1.01 | 1.03 | 0.81 | 0.96 | 1.01 | 1.05 | 1.01 | 0.89 | 1.40 | 1.21 | 1.04 | 0.91 | 1.03 | 1.01 | 0.91 | 0.93 | 0.92 |
| + | PC | 1.00 | 0.84 | 1.08 | 1.20 | 0.87 | 0.61 | 0.87 | 1.00 | 0.98 | 1.46 | 0.87 | 0.97 | 1.15 | 1.03 | 0.74 | 0.90 | 0.97 | 0.91 |
| + | NC | 1.30 | 1.01 | 1.26 | 0.98 | 1.04 | 0.88 | 0.96 | 1.09 | 1.07 | 1.70 | 0.80 | 0.99 | 0.92 | 1.08 | 0.88 | 1.03 | 1.14 | 0.99 |
| + | ARG | 1.20 | 0.84 | 1.02 | 1.65 | 0.89 | 0.69 | 0.83 | 0.94 | 0.96 | 1.65 | 0.79 | 1.02 | 0.85 | 1.14 | 0.69 | 0.94 | 1.05 | 0.99 |
| + | BCAA | 1.17 | 1.04 | 1.08 | 1.09 | 0.91 | 0.67 | 0.94 | 1.00 | 0.98 | 1.69 | 0.78 | 0.89 | 0.57 | 1.11 | 0.69 | 0.95 | 0.99 | 1.02 |
| Source of variation | |||||||||||||||||||
| Challenge | 0.013 | 0.708 | 0.380 | 0.030 | 0.183 | 0.001 | 0.066 | 0.740 | 0.514 | 0.029 | 0.001 | 0.459 | 0.422 | 0.021 | 0.379 | 0.645 | 0.736 | 0.936 | |
| Diet | 0.276 | 0.638 | 0.105 | 0.433 | 0.177 | 0.398 | 0.220 | 0.948 | 0.636 | 0.199 | 0.608 | 0.922 | 0.338 | 0.755 | 0.371 | 0.622 | 0.127 | 0.830 | |
| Interaction | 0.395 | 0.676 | 0.848 | 0.204 | 0.303 | 0.546 | 0.974 | 0.292 | 0.627 | 0.842 | 0.385 | 0.848 | 0.557 | 0.584 | 0.067 | 0.541 | 0.829 | 0.210 | |
| SEM | 0.130 | 0.101 | 0.080 | 0.198 | 0.047 | 0.103 | 0.079 | 0.058 | 0.065 | 0.185 | 0.096 | 0.096 | 0.185 | 0.069 | 0.122 | 0.060 | 0.069 | 0.043 | |
Means within a column lacking a common superscript differ (P < 0.05).
IL4, interleukin-4; IL1β, interleukin-1β; TNFα, tumor necrosis factor α; IFNγ, interferon-γ; TGFβ1, transforming growth factor β 1; IL10, interleukin-10; mTOR, mechanistic target of rapamycin; 4EBP1, eukaryotic translation initiation factor 4E binding protein 1; S6KB1, ribosomal protein S6 kinase β1.
NCG, nonchallenged group; CG, challenged group.
PC, positive control with 20.0% crude protein content; NC, negative control with 17.5% crude protein content; ARG, negative control supplemented with arginine at 50% above breeder recommendations; BCAA, negative control supplemented with BCAA at 50% above breeder recommendations.
There were no significant effects observed for the intestinal and CT mRNA expressions of mTOR pathway related genes on d 21 and 28, regardless of challenge or diet. On d 21, the NC group tended to have higher (P = 0.077) intestinal mRNA expressions of eukaryotic translation initiation factor 4E binding protein 1 (4EBP1) than the PC group (Table 4). The mRNA expressions of mTOR tended to be higher in the nonchallenged birds than the challenged birds in the ileum on d 28 and in the CT on d 21 (Table 5) (P = 0.066 and 0.064, respectively), indicating that mTOR signaling appeared to be affected by Eimeria infection.
Short Chain Fatty Acid Profile in Cecal Content
No interactive effect was observed for all cecal content SCFAs on d 21 and 28. Eimeria challenge decreased (P < 0.001) unbranched SCFA (acetate, propionate, butyrate) and total SCFA concentrations on d 21 (Table 6). Conversely, Eimeria challenge increased (P < 0.001) branched SCFA (isobutyrate and isovalerate) concentrations. On d 28, unbranched SCFA and total SCFA levels were lower (P < 0.001), and branched SCFA tended to be lower (P = 0.076) in the challenged birds than the nonchallenged birds (Table 7).
Table 6.
Effects of reduced-protein diets supplemented with arginine or branched-chain amino acids on short-chain fatty acid profile in cecal content in broiler chickens challenged with Eimeria spp. on d 21.
| Acetate | Propionate | Isobutyrate | Butyrate | Isovalerate | Valerate | Caproate | SCFA1 | BSCFA1 | Total SCFA | ||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Means for the main effect of challenge2 | |||||||||||
| NCG (-) | 51.9a | 2.66a | 0.29b | 10.7a | 0.31b | 0.63 | 0.003b | 65.9a | 0.60b | 66.5a | |
| CG (+) | 27.8b | 1.80b | 0.44a | 3.09b | 0.78a | 0.51 | 0.045a | 33.2b | 1.22a | 34.5b | |
| Means for the main effect of diets3 | |||||||||||
| PC | 44.2 | 2.32 | 0.38 | 7.95 | 0.57 | 0.61 | 0.01 | 55.1 | 0.95 | 56.0 | |
| NC | 39.4 | 2.14 | 0.31 | 6.86 | 0.48 | 0.55 | 0.05 | 48.9 | 0.79 | 49.8 | |
| ARG | 36.9 | 2.23 | 0.37 | 6.56 | 0.57 | 0.57 | 0.02 | 46.3 | 0.94 | 47.2 | |
| BCAA | 38.9 | 2.23 | 0.40 | 6.27 | 0.57 | 0.55 | 0.01 | 47.9 | 0.97 | 48.9 | |
| Means for the interaction effect | |||||||||||
| - | PC | 56.6 | 2.74 | 0.32 | 11.7 | 0.36 | 0.64 | 0.00 | 71.8 | 0.68 | 72.4 |
| - | NC | 54.2 | 2.69 | 0.25 | 11.3 | 0.28 | 0.71 | 0.00 | 68.9 | 0.53 | 69.4 |
| - | ARG | 46.1 | 2.30 | 0.24 | 10.1 | 0.27 | 0.55 | 0.00 | 59.0 | 0.51 | 59.5 |
| - | BCAA | 50.5 | 2.92 | 0.36 | 9.85 | 0.35 | 0.63 | 0.01 | 63.9 | 0.71 | 64.6 |
| + | PC | 31.7 | 1.89 | 0.45 | 4.16 | 0.77 | 0.58 | 0.02 | 38.4 | 1.22 | 39.6 |
| + | NC | 24.6 | 1.60 | 0.37 | 2.43 | 0.68 | 0.40 | 0.11 | 29.0 | 1.04 | 30.1 |
| + | ARG | 27.7 | 2.15 | 0.50 | 3.07 | 0.88 | 0.59 | 0.04 | 33.6 | 1.37 | 35.0 |
| + | BCAA | 27.3 | 1.54 | 0.44 | 2.70 | 0.80 | 0.47 | 0.02 | 32.0 | 1.23 | 33.3 |
| Source of variation | |||||||||||
| Challenge | <0.001 | 0.012 | 0.016 | <0.001 | <0.001 | 0.059 | 0.035 | <0.001 | <0.001 | <0.001 | |
| Diet | 0.195 | 0.987 | 0.740 | 0.433 | 0.783 | 0.914 | 0.363 | 0.234 | 0.762 | 0.251 | |
| Interaction | 0.434 | 0.601 | 0.717 | 0.815 | 0.774 | 0.256 | 0.258 | 0.456 | 0.754 | 0.459 | |
| SEM | 3.43 | 0.469 | 0.083 | 1.08 | 0.110 | 0.089 | 0.024 | 4.48 | 0.190 | 4.58 | |
Means within a column lacking a common superscript differ (P < 0.05).
SCFA, unbranched short chain fatty acids (acetate, propionate, butyrate, valerate, caproate); BSCFA, branched short chain fatty acids (isobutyrate, isovalerate); Total SCFA, total short chain fatty acids.
NCG, nonchallenged group; CG, challenged group.
PC, positive control with 20.0% crude protein content; NC, negative control with 17.5% crude protein content; ARG, negative control supplemented with arginine at 50% above breeder recommendations; BCAA, negative control supplemented with BCAA at 50% above breeder recommendations.
Table 7.
Effects of reduced-protein diets supplemented with arginine or branched-chain amino acids on short-chain fatty acid profile in cecal content in broiler chickens challenged with Eimeria spp. on d 28.
| Acetate | Propionate | Isobutyrate | Butyrate | Isovalerate | Valerate | Caproate | SCFA1 | BSCFA1 | Total SCFA | ||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Means for the main effect of challenge2 | |||||||||||
| NCG (-) | 60.9a | 3.22a | 0.42 | 9.74a | 0.51a | 0.73a | 0.01 | 74.6 | 0.92 | 75.5a | |
| CG (+) | 48.3b | 2.42b | 0.36 | 7.70b | 0.40b | 0.52b | 0.01 | 58.9 | 0.76 | 59.7b | |
| Means for the main effect of diets3 | |||||||||||
| PC | 60.2 | 2.97 | 0.42 | 9.34 | 0.53 | 0.69 | 0.00 | 73.2 | 0.96 | 74.2 | |
| NC | 53.4 | 2.77 | 0.41 | 8.21 | 0.46 | 0.62 | 0.02 | 65.0 | 0.87 | 65.9 | |
| ARG | 51.2 | 2.56 | 0.36 | 8.54 | 0.41 | 0.59 | 0.00 | 62.9 | 0.78 | 63.7 | |
| BCAA | 53.4 | 2.98 | 0.36 | 8.80 | 0.40 | 0.60 | 0.03 | 65.8 | 0.76 | 66.6 | |
| Means for the interaction effect | |||||||||||
| - | PC | 70.3 | 3.66 | 0.47 | 11.2 | 0.61 | 0.84 | 0.00 | 86.0 | 1.08 | 87.0 |
| - | NC | 61.3 | 3.35 | 0.49 | 8.65 | 0.56 | 0.75 | 0.04 | 74.1 | 1.05 | 75.2 |
| - | ARG | 55.5 | 2.82 | 0.35 | 9.62 | 0.42 | 0.68 | 0.00 | 68.7 | 0.78 | 69.4 |
| - | BCAA | 56.3 | 3.04 | 0.36 | 9.52 | 0.43 | 0.65 | 0.00 | 69.5 | 0.79 | 70.3 |
| + | PC | 50.1 | 2.29 | 0.38 | 7.51 | 0.46 | 0.54 | 0.00 | 60.5 | 0.84 | 61.3 |
| + | NC | 45.5 | 2.20 | 0.34 | 7.77 | 0.36 | 0.48 | 0.00 | 56.0 | 0.70 | 56.7 |
| + | ARG | 46.9 | 2.29 | 0.37 | 7.45 | 0.40 | 0.50 | 0.00 | 57.1 | 0.78 | 57.9 |
| + | BCAA | 50.5 | 2.92 | 0.36 | 8.08 | 0.37 | 0.55 | 0.05 | 62.1 | 0.73 | 62.9 |
| Source of variation | |||||||||||
| Challenge | <0.001 | 0.008 | 0.247 | 0.027 | 0.021 | 0.001 | 0.832 | <0.001 | 0.076 | <0.001 | |
| Diet | 0.175 | 0.694 | 0.693 | 0.839 | 0.166 | 0.623 | 0.468 | 0.247 | 0.390 | 0.237 | |
| Interaction | 0.315 | 0.406 | 0.569 | 0.719 | 0.496 | 0.634 | 0.184 | 0.359 | 0.512 | 0.347 | |
| SEM | 4.23 | 0.406 | 0.048 | 1.27 | 0.045 | 0.085 | 0.021 | 5.34 | 0.128 | 5.36 | |
Means within a column lacking a common superscript differ (P < 0.05).
SCFA, unbranched short-chain fatty acids (acetate, propionate, butyrate, valerate, caproate); BSCFA, branched short-chain fatty acids (isobutyrate, isovalerate); Total SCFA, total short-chain fatty acids.
NCG, nonchallenged group; CG, challenged group.
PC, positive control with 20.0% crude protein content; NC, negative control with 17.5% crude protein content; ARG, negative control supplemented with arginine at 50% above breeder recommendations; BCAA, negative control supplemented with BCAA at 50% above breeder recommendations.
Cecal Tonsil CD4+, CD8+ Cell Percentages and CD8+:CD4+ Cell Ratio
On d 21, no dietary effects or diet by challenge interactive effect were found for the CD8+ cell percentage. The percentage was significantly higher (P < 0.001) in the Eimeria challenged birds than the nonchallenged birds (Figure 2A). On d 28, a significant interactive effect (P = 0.003) was observed (Figure 2B) that the CD8+ cell percentage was not increased by Eimeria challenge only in the ARG group, but it was increased in all other treatments. Furthermore, the BCAA group had a higher (P = 0.003) percentage than the ARG group but only in the challenged birds. For the CD8+:CD4+ ratio, no diet by challenge interactive effect was observed on d 21. The ratio was significantly higher (P < 0.001) in the Eimeria challenged birds than the nonchallenged birds (Figure 2C), and there was a trend (P = 0.072) for the ratio to be lower in the ARG groups compared to the other treatment groups. On d 28, an interactive effect (P = 0.001) was observed (Figure 2D) that Eimeria challenge did not increase the CD8+:CD4+ ratio in the ARG group, whereas it significantly increased the ratios in all other treatment groups, indicating that ARG treatment had anti-inflammatory effects. Moreover, the BCAA group had a higher (P = 0.001) ratio than the ARG group but only in the challenged birds. No significant challenge, diet or interactive effects were found for CD4+ cell percentage on both time points.
Figure 2.
Effects of reduced-protein diets supplemented with arginine or branched chain amino acids on cecal tonsil CD8+ cell percentage and CD8+:CD4+ ratio in broiler chickens challenged with Eimeria spp. A flow cytometry method was used to analyze the cells on d 21 and 28. PC, positive control with 20.0% crude protein; NC, negative control with 17.5% crude protein; ARG and BCAA, negative control supplemented with arginine or BCAA. The error bars represent the SEM values. Bars without a common letter differ significantly and the asterisk (*) in C denoted significant difference. (A), P-values: P-challenge < 0.001, P-diet = 0.324, P-interaction = 0.883. (B), P-values: P-challenge < 0.001, P-diet = 0.260, P-interaction = 0.003. (C), P-values: P-challenge < 0.001, P-diet = 0.072, P-interaction = 0.474. (D), P-values: P-challenge < 0.001, P-diet = 0.444, P-interaction = 0.001.
Cecal Tonsil CD25+CD4+ Cell Percentage (Tregs)
On d 21, a significant diet by challenge interactive effect (P = 0.01) was observed for Tregs (Figure 3A) that Eimeria challenge increased Tregs in the PC and NC groups but not in the ARG and BCAA groups. On d 28, Tregs were significantly higher (P < 0.001) in the challenged birds than the nonchallenged birds, and a tendency of diet by challenge interactive effect (P = 0.089) was observed (Figure 3B).
Figure 3.
Effects of reduced-protein diets supplemented with arginine or branched chain amino acids on cecal tonsil CD25+CD4+ cell (Tregs) percentage in broiler chickens challenged with Eimeria spp. Tregs was presented as percentage of CD4+ cells on d 21 and 28. PC, positive control with 20.0% crude protein; NC, negative control with 17.5% crude protein; ARG and BCAA, negative control supplemented with arginine or BCAA. The error bars represent the SEM values. (A), Bars without a common letter differ significantly. P-values: P-challenge < 0.001, P-diet = 0.646, P-interaction = 0.010. (B), The asterisk (*) denoted significant difference. P-values: P-challenge < 0.001, P-diet = 0.507, P-interaction = 0.089.
Macrophage Nitric Oxide Production
A significant diet by challenge interactive effect (P < 0.001) was found for macrophage NO production on both d 21 and 28. On d 21, in the nonchallenge birds, NO was higher in the ARG group compared to the other treatment groups (Figure 4A). However, in the challenged birds, NO concentrations were higher in both ARG and BCAA groups than the NC and PC groups, and NO was higher in the ARG group than the BCAA group. Additionally, NO was higher in the challenged birds than the nonchallenged birds only in the ARG and BCAA groups. On d 28, NO remained to be higher in the ARG group than the other groups in the nonchallenge birds (Figure 4B). Whereas in the challenged birds, NO concentrations were higher in the ARG and BCAA groups than the PC and NC groups. Furthermore, NO concentrations were higher in the challenged birds than the nonchallenged birds only in the PC and BCAA groups.
Figure 4.
Effects of reduced-protein diets supplemented with arginine or branched chain amino acids on macrophage nitric oxide (NO) production in broiler chickens challenged with Eimeria spp. Macrophage NO production was measured on d 21 and 28. PC, positive control with 20.0% crude protein; NC, negative control with 17.5% crude protein; ARG and BCAA, negative control supplemented with arginine or BCAA at 50% above requirement. The error bars represent the SEM values. Bars without a common letter differ significantly. (A), P-values: P-challenge < 0.001, P-diet < 0.001, P-interaction < 0.001. (B), P-values: P-challenge < 0.001, P-diet < 0.001, P-interaction < 0.001.
Bile Anticoccidial IgA Concentrations
A significant interactive effect (P = 0.022) was found for bile anticoccidial IgA on d 21, where Eimeria challenge significantly increased bile IgA only in the NC and ARG groups (Figure 5A). Furthermore, IgA in the NC group was significantly higher than that in the PC and BCAA only in the challenged birds. On d 28, a challenge effect was observed, with Eimeria challenge increasing (P < 0.001) bile IgA (Figure 5B).
Figure 5.
Effects of reduced-protein diets supplemented with arginine or branched chain amino acids on bile anticoccidial IgA in broiler chickens challenged with Eimeria spp. Bile IgA was measured by ELISA on d 21 and 28. PC, positive control with 20.0% crude protein; NC, negative control with 17.5% crude protein; ARG and BCAA, negative control supplemented with arginine or BCAA. The error bars represent the SEM values. Bars without a common letter differ significantly. (A), P-values: P-challenge < 0.001, P-diet = 0.117, P-interaction = 0.022. (B), P-values: P-challenge = 0.001, P-diet = 0.684, P-interaction = 0.716.
DISCUSSION
The objectives of this study were to examine the effects of Arg or BCAA supplementation in reduced-protein diets on intestinal health and immune responses in Eimeria-challenged broilers. In addition, we aimed to assess the potential interaction effects between dietary treatments and challenge on these parameters. The results of the current study reaffirmed the reported adverse effects of Eimeria challenge on intestinal integrity, morphology, and tight junction protein gene expression (Hong et al., 2006; Castro et al., 2020b; Yadav et al., 2020; Choi et al., 2022; Teng et al., 2023), as well as its effects on immune responses and SCFA profiles (Shanmugasundaram et al., 2013; Walston et al., 2016; Lin and Olukosi, 2021). More importantly, our findings suggested that Arg or BCAA supplementation in reduced-protein diets may have beneficial effects on intestinal integrity and immune functions of Eimeria challenged broiler chickens fed reduced-protein diets.
To provide some context for the observations in this current study, a brief summary of the overall performance data on d 35 was presented as follows (Ajao et al., 2023). No interactive effects were observed for the overall performance. The nonchallenge groups showed better growth performance than the challenge groups, with higher BW, BW gain, feed intake, and lower feed conversion ratio (FCR, P < 0.001). The BW of the PC group (2,500 g) was not significantly higher than the ARG group (2,435 g). However, it was significantly higher (P < 0.001) compared to the NC and BCAA groups (2,394 g and 2,355 g, respectively), indicating that ARG supplementation improved BW under the Eimeria challenge condition. No significant differences were found for FCR among the groups.
The NC diet exacerbated the negative effects of the Eimeria challenge on intestinal integrity, as demonstrated by a higher intestinal permeability compared to the PC group in the current study. This observation aligned with previous studies (Chen et al., 2016; Barekatain et al., 2019b). However, supplementing Arg or BCAA in NC partially compensated for the loss of intestinal integrity caused by the reduced-protein diet in the current study. Previous research had also demonstrated improvement in intestinal permeability by Arg supplementation (Costa et al., 2014; Castro et al., 2020a; Barekatain et al., 2021). Collectively, our results and the previous studies suggested that a sufficient supply of dietary protein is crucial for preserving intestinal integrity in broiler chickens infected with coccidiosis. Nonetheless, our research indicated that it might be possible to fulfill this requirement to some extent by Arg or BCAA supplementation. The mechanism by which this occurred may be through the ability of Arg and BCAA to promote intestinal development or modulate immune responses (Li et al., 2007; Nie et al., 2018; Martí and Reith, 2021; Kim et al., 2022), leading to a reduction in the severity of the Eimeria infection.
We evaluated the effects of Arg and BCAA supplementation on promoting intestinal development by measuring intestinal morphology and mRNA expressions of the tight junction proteins in the current study. Although no differences in intestinal morphology were found as a result of the dietary treatments, we observed that Arg supplementation tended to increase the mRNA expression of CLDN1 on d 21 and CLDN3 in nonchallenged birds on d28. These findings, along with results observed in previous studies (Barekatain et al., 2019a; Castro et al., 2020a; Dao et al., 2022), suggested beneficial effects of Arg supplementation on intestinal integrity. However, even though BCAA had beneficial effects on intestinal permeability, no BCAA effects were observed in the mRNA expression of all tested genes in this current study. It is possible that the changes in tight junction protein gene expression induced by BCAA supplementation might have occurred at earlier time points to improve intestinal integrity; thus, we observed no differences in these parameters despite an improvement in intestinal permeability in the BCAA group. Another possible explanation could be that BCAA supplementation exerts its effects through modulating immune responses rather than affecting gut barrier functions. Further studies are needed to explore and better understand the mechanisms underlying the effects of Arg and BCAA supplementation on intestinal structure and barrier functions.
Similar to previous studies, the CD8+ cell percentage and CD8+: CD4+ ratio increased during Eimeria challenge, as this is a typical response of the immune system to combat pathogens (Dalloul et al., 2002; Schneiders et al., 2020). However, a persistently elevated CD8+: CD4+ ratio resulting from a consistently higher CD8+ cells may indicate a weakened immune system because it can be a sign of CD8+ T cell exhaustion, which would result in reduced effectiveness in pathogen clearance (Gao et al., 2009; McBride and Striker, 2017; Rha and Shin, 2021). Our results showed that the ARG groups tended to have a lower CD8+:CD4+ ratio compared to the other treatment groups on d 21, and the increased CD8+ cell percentage and CD8+:CD4+ ratio caused by the Eimeria challenge persisted on d 28 in all treatment groups except for the ARG group. A prior study has shown that elevated Arg levels could cause a metabolic shift from glycolysis to oxidative phosphorylation in activated T cells, leading to improved T cell viability and functions (Geiger et al., 2016). This might explain the lowered CD8+ cell percentage and improvement of CD8+: CD4+ ratios in the ARG group in the current study, suggesting the potential of Arg supplementation in enhancing immune responses, specifically T cell functions.
Although Tregs are usually associated with immune suppression, certain parasites, such as Eimeria, are capable of stimulating Tregs as a mechanism to evade host immune responses (Selvaraj, 2013; Grenier et al., 2016; Walston et al., 2016). Our study found an interactive effect between Eimeria challenge and dietary treatments, where Eimeria challenge increased Tregs only in the PC and NC groups but not in the ARG and BCAA groups. Furthermore, the lower Tregs in the ARG group tended to persist to d 28. These results suggested a suppressive effect of Arg and BCAA on the activation of Tregs caused by Eimeria infection. Previous research has shown that Tregs can suppress macrophage NO production in animals infected with protozoans (Wei and Tabel, 2008; Walston et al., 2016). Therefore, it is plausible that the higher macrophage NO production in the ARG and BCAA groups compared to the PC and NC groups in the challenged birds observed in the current study was caused by the suppressive effects of Arg and BCAA on Treg activation. Taken together, our results suggested that Arg and BCAA could have beneficial effects on immune responses against Eimeria infection by suppressing Treg stimulation and elevating NO production. Given the well-established relationship between Arg and NO metabolism (Morris, 2007; Wu, 2009; Martí and Reith, 2021), it is worth noting that our study found higher NO production in the ARG group compared to the BCAA group, which indicate that Arg supplementation can be a better nutritional strategy to defend against pathogens.
IgA as a secretory antibody provides a first line of defense against pathogens invading and damaging the intestinal mucosa (Davison et al., 2008). Aligned with previous research findings (Lillehoj and Trout, 1993; Perez-Carbajal et al., 2010), we observed an increase in the IgA production caused by Eimeria challenge on d 28. However, it was noteworthy that the increase in bile IgA caused by the Eimeria challenge was only significant in the NC and ARG groups, but not in the PC and BCAA groups on d 21. It was reported that IgA synthesis is related to NO production (Tezuka and Ohteki, 2019), and 1 study showed that IgA production was decreased in NO synthase knock-out mice (Tezuka et al., 2007). The observed increase of IgA in the ARG group could potentially be attributed to the important role of Arg in NO production.
Previous studies have suggested that BCAA supplementation can affect the mTOR pathway (Zhang et al., 2017; Kim et al., 2022). However, in this current study, there were no significant dietary effects on intestinal and CT expressions of mTOR pathway related genes, consistent with Chen et al. (2016). It has been reported that the mTOR pathway is more sensitive to BCAA in the skeletal muscle (Yoshizawa et al., 2013) where the majority of its uptake occurs (Holeček, 2018). Consequently, BCAA supplementation could primarily benefit the skeletal muscle for protein synthesis rather than intestinal epithelial cells and immune cells, especially during Eimeria infection, where nutrient availability is reduced due to anorexia (Taylor et al., 2022). This could potentially explain the absence of effects of BCAA supplementation on mTOR pathway in the intestine and CT, which might in turn account for the limited impact of BCAA supplementation on intestinal health and immune response. Future studies should explore this hypothesis and investigate the effects of BCAA supplementation on the mTOR pathway in skeletal muscles, such as the breast muscle under Eimeria challenge.
In summary, our findings suggest that feeding a reduced-protein diet to infected birds may exacerbate the effects of Eimeria infection on intestinal health by increasing intestinal permeability. However, Arg and BCAA supplementation was found to partially compensate for this negative impact and exert beneficial effects on the immune response of broilers. Furthermore, the effects of Arg supplementation tended to be more pronounced than those of BCAA supplementation.
Acknowledgments
ACKNOWLEDGMENTS
This work was funded by ADISSEO (Grant No. FR82439436569) through a research grant awarded to Ilias Kyriazakis, Oluyinka A. Olukosi, and Woo K. Kim.
DISCLOSURES
The authors declare no conflicts of interest.
REFERENCES
- Abbas R.Z., Iqbal Z., Blake D., Khan M.N., Saleemi M.K. Anticoccidial drug resistance in fowl coccidia: the state of play revisited. World's Poult. Sci. J. 2011;67:337–350. [Google Scholar]
- Ajao, A., G. Liu, J. Taylor, T. Applegate, R. Selvaraj, M. E. E. Ball, I. Kyriazakis, W. K. Kim, O. Olukosi. 2023. Delineating the phase-specific effects of functional amino acids during infection and recovery of broiler chickens challenged with a mixed coccidian infection. International Poultry Scientific Forum. M68. (Abstr.)
- Albina J.E., Mills C.D., Henry W.L., Jr., Caldwell M.D. Temporal expression of different pathways of 1-arginine metabolism in healing wounds. J. Immunol. 1990;144:3877–3880. [PubMed] [Google Scholar]
- Allameh S., Toghyani M. Effect of dietary valine supplementation to low protein diets on performance, intestinal morphology and immune responses in broiler chickens. Livest. Sci. 2019;229:137–144. [Google Scholar]
- Alvarez M.N., Peluffo G., Piacenza L., Radi R. Intraphagosomal peroxynitrite as a macrophage-derived cytotoxin against internalized Trypanosoma cruzi: consequences for oxidative killing and role of microbial peroxiredoxins in infectivity. J. Biol. Chem. 2011;286:6627–6640. doi: 10.1074/jbc.M110.167247. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Attia Y.A., Bovera F., Wang J., Al-Harthi M.A., Kim W.K. Multiple amino acid supplementations to low-protein diets: effect on performance, carcass yield, meat quality and nitrogen excretion of finishing broilers under hot climate conditions. Animals (Basel) 2020;10:973. doi: 10.3390/ani10060973. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Barekatain R., Chalvon-Demersay T., McLaughlan C., Lambert W. Intestinal barrier function and performance of broiler chickens fed additional arginine, combination of arginine and glutamine or an amino acid-based solution. Animals (Basel) 2021;11:2416. doi: 10.3390/ani11082416. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Barekatain R., Chrystal P.V., Howarth G.S., McLaughlan C.J., Gilani S., Nattrass G.S. Performance, intestinal permeability, and gene expression of selected tight junction proteins in broiler chickens fed reduced protein diets supplemented with arginine, glutamine, and glycine subjected to a leaky gut model. Poult. Sci. 2019;98:6761–6771. doi: 10.3382/ps/pez393. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Barekatain R., Nattrass G., Tilbrook A.J., Chousalkar K., Gilani S. Reduced protein diet and amino acid concentration alter intestinal barrier function and performance of broiler chickens with or without synthetic glucocorticoid. Poult. Sci. 2019;98:3662–3675. doi: 10.3382/ps/pey563. [DOI] [PubMed] [Google Scholar]
- Bifari F., Nisoli E. Branched-chain amino acids differently modulate catabolic and anabolic states in mammals: a pharmacological point of view. Br. J. Pharmacol. 2017;174:1366–1377. doi: 10.1111/bph.13624. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Blake D.P., Knox J., Dehaeck B., Huntington B., Rathinam T., Ravipati V., Ayoade S., Gilbert W., Adebambo A.O., Jatau I.D., Raman M., Parker D., Rushton J., Tomley F.M. Re-calculating the cost of coccidiosis in chickens. Vet. Res. 2020;51:115. doi: 10.1186/s13567-020-00837-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bregendahl K., Sell J.L., Zimmerman D.R. Effect of low-protein diets on growth performance and body composition of broiler chicks. Poult. Sci. 2002;81:1156–1167. doi: 10.1093/ps/81.8.1156. [DOI] [PubMed] [Google Scholar]
- Calder P.C. Branched-chain amino acids and immunity. J. Nutr. 2006;136:288S–293S. doi: 10.1093/jn/136.1.288S. [DOI] [PubMed] [Google Scholar]
- Cason E.E., Al Hakeem W.G., Adams D., Shanmugasundaram R., Selvaraj R. Effects of synbiotic supplementation as an antibiotic growth promoter replacement on cecal Campylobacter jejuni load in broilers challenged with C. jejuni. J. Appl. Poult. Res. 2023;32 [Google Scholar]
- Castro F.L.S., Teng P.-Y., Yadav S., Gould R.L., Craig S., Pazdro R., Kim W.K. The effects of L-Arginine supplementation on growth performance and intestinal health of broiler chickens challenged with Eimeria spp. Poult. Sci. 2020;99:5844–5857. doi: 10.1016/j.psj.2020.08.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Castro F.L.S., Tompkins Y.H., Pazdro R., Kim W.K. The effects of total sulfur amino acids on the intestinal health status of broilers challenged with Eimeria spp. Poult. Sci. 2020;99:5027–5036. doi: 10.1016/j.psj.2020.06.055. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chang Y., Cai H., Liu G., Chang W., Zheng A., Zhang S., Liao R., Liu W., Li Y., Tian J. Effects of dietary leucine supplementation on the gene expression of mammalian target of rapamycin signaling pathway and intestinal development of broilers. Anim. Nutr. 2015;1:313–319. doi: 10.1016/j.aninu.2015.11.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chapman H.D., Roberts B., Shirley M.W., Williams R.B. Guidelines for evaluating the efficacy and safety of live anticoccidial vaccines, and obtaining approval for their use in chickens and turkeys. Avian Pathol. 2005;34:279–290. doi: 10.1080/03079450500178378. [DOI] [PubMed] [Google Scholar]
- Chen X., Naehrer K., Applegate T.J. Interactive effects of dietary protein concentration and aflatoxin B1 on performance, nutrient digestibility, and gut health in broiler chicks. Poult. Sci. 2016;95:1312–1325. doi: 10.3382/ps/pew022. [DOI] [PubMed] [Google Scholar]
- Choi J., Tompkins Y.H., Teng P.-Y., Gogal R.M., Kim W.K. Effects of tannic acid supplementation on growth performance, oocyst shedding, and gut health of in broilers infected with Eimeria Maxima. Animals. 2022;12:1378. doi: 10.3390/ani12111378. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cobb-Vantress. 2018a. Cobb500 Broiler Performance & Nutrition Supplement, https://www.cobb-vantress.com/assets/5a88f2e793/Broiler-Performance-Nutrition-Supplement.pdf. Accessed March 04, 2022.
- Cobb-Vantress. 2018b. Cobb Broiler Management Guide, https://www.cobb-vantress.com/assets/Cobb-Files/045bdc8f45/Broiler-Guide-2021-min.pdf. Accessed March 04, 2022.
- Costa K.A., Soares A.D., Wanner S.P., Santos R., Fernandes S.O., Martins Fdos S., Nicoli J.R., Coimbra C.C., Cardoso V.N. L-arginine supplementation prevents increases in intestinal permeability and bacterial translocation in male Swiss mice subjected to physical exercise under environmental heat stress. J. Nutr. 2014;144:218–223. doi: 10.3945/jn.113.183186. [DOI] [PubMed] [Google Scholar]
- Dalloul R.A., Lillehoj H.S., Shellem T.A., Doerr J.A. Effect of vitamin A deficiency on host intestinal immune response to Eimeria acervulina in broiler chickens. Poult. Sci. 2002;81:1509–1515. doi: 10.1093/ps/81.10.1509. [DOI] [PubMed] [Google Scholar]
- Dao T.H., Sharma N.K., Daneshmand A., Kumar A., Bradbury E., Wu S.-B., Swick R. Supplementation of reduced protein diets with l-arginine and l-citrulline for broilers challenged with subclinical necrotic enteritis. 1. Growth, carcass yield, and intestinal lesion scores. Animal Prod. Sci. 2022;62:1236–1249. [Google Scholar]
- Davison F., Kaspers B., Schat K.A. Avian Immunology. Academic Press; London, United Kingdom: 2008. Structure and evolution of avian immunoglobulins; pp. 107–127. [Google Scholar]
- Dean D.W., Bidner T.D., Southern L.L. Glycine supplementation to low protein, amino acid-supplemented diets supports optimal performance of broiler chicks. Poult. Sci. 2006;85:288–296. doi: 10.1093/ps/85.2.288. [DOI] [PubMed] [Google Scholar]
- Fan P., Li L., Rezaei A., Eslamfam S., Che D., Ma X. Metabolites of dietary protein and peptides by intestinal microbes and their impacts on gut. Curr. Protein Pept. Sci. 2015;16:646–654. doi: 10.2174/1389203716666150630133657. [DOI] [PubMed] [Google Scholar]
- Fujishita T., Aoki K., Lane H.A., Aoki M., Taketo M.M. Inhibition of the mTORC1 pathway suppresses intestinal polyp formation and reduces mortality in Apc Δ716 mice. Proc. Natl. Acad. Sci. 2008;105:13544–13549. doi: 10.1073/pnas.0800041105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gao J., Zhang H.J., Wu S.G., Yu S.H., Yoon I., Moore D., Gao Y.P., Yan H.J., Qi G.H. Effect of Saccharomyces cerevisiae fermentation product on immune functions of broilers challenged with Eimeria tenella. Poult. Sci. 2009;88:2141–2151. doi: 10.3382/ps.2009-00151. [DOI] [PubMed] [Google Scholar]
- Geiger R., Rieckmann J.C., Wolf T., Basso C., Feng Y., Fuhrer T., Kogadeeva M., Picotti P., Meissner F., Mann M., Zamboni N., Sallusto F., Lanzavecchia A. L-Arginine modulates T cell metabolism and enhances survival and anti-tumor activity. Cell. 2016;167:829–842.e813. doi: 10.1016/j.cell.2016.09.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Grenier B., Dohnal I., Shanmugasundaram R., Eicher S.D., Selvaraj R.K., Schatzmayr G., Applegate T.J. Susceptibility of broiler chickens to coccidiosis when fed subclinical doses of deoxynivalenol and fumonisins—special emphasis on the immunological response and the mycotoxin interaction. Toxins. 2016;8:231. doi: 10.3390/toxins8080231. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Holeček M. Branched-chain amino acids in health and disease: metabolism, alterations in blood plasma, and as supplements. Nutr. Metab. (Lond) 2018;15:33. doi: 10.1186/s12986-018-0271-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hong Y.H., Lillehoj H.S., Lillehoj E.P., Lee S.H. Changes in immune-related gene expression and intestinal lymphocyte subpopulations following Eimeria maxima infection of chickens. Vet. Immunol. Immunopathol. 2006;114:259–272. doi: 10.1016/j.vetimm.2006.08.006. [DOI] [PubMed] [Google Scholar]
- Kim W.K., Singh A.K., Wang J., Applegate T. Functional role of branched chain amino acids in poultry: a review. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2022.101715. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kimball S.R., Jefferson L.S. Regulation of protein synthesis by branched-chain amino acids. Curr. Opin. Clin. Nutr. Metab. Care. 2001;4:39–43. doi: 10.1097/00075197-200101000-00008. [DOI] [PubMed] [Google Scholar]
- Lee J.T., Rochell S.J., Kriseldi R., Kim W.K., Mitchell R.D. Functional properties of amino acids: Improve health status and sustainability. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2022.102288. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lemme A., Hiller P., Klahsen M., Taube V., Stegemann J., Simon I. Reduction of dietary protein in broiler diets not only reduces n-emissions but is also accompanied by several further benefits. J. App. Poult Res. 2019;28:867–880. [Google Scholar]
- Li P., Yin Y.-L., Li D., Woo Kim S., Wu G. Amino acids and immune function. Br J Nutr. 2007;98:237–252. doi: 10.1017/S000711450769936X. [DOI] [PubMed] [Google Scholar]
- Lillehoj H.S., Trout J.M. Coccidia: a review of recent advances on immunity and vaccine development. Avian Pathol. 1993;22:3–31. doi: 10.1080/03079459308418897. [DOI] [PubMed] [Google Scholar]
- Lin Y., Olukosi O.A. Exogenous enzymes influenced Eimeria-induced changes in cecal fermentation profile and gene expression of nutrient transporters in broiler chickens. Animals. 2021;11:2698. doi: 10.3390/ani11092698. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- Lourenco J.M., Kieran T.J., Seidel D.S., Glenn T.C., d. Silveira M.F., Callaway T.R., Stewart R.L., Jr. Comparison of the ruminal and fecal microbiotas in beef calves supplemented or not with concentrate. PLoS One. 2020;15 doi: 10.1371/journal.pone.0231533. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Martí I.L.A.A., Reith W. Arginine-dependent immune responses. Cell. Mol. Life Sci. 2021;78:5303–5324. doi: 10.1007/s00018-021-03828-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- McBride J.A., Striker R. Imbalance in the game of T cells: what can the CD4/CD8 T-cell ratio tell us about HIV and health? PLoS Pathog. 2017;13 doi: 10.1371/journal.ppat.1006624. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mesa-Pineda C., Navarro-Ruíz J.L., López-Osorio S., Chaparro-Gutiérrez J.J., Gómez-Osorio L.M. Chicken coccidiosis: from the parasite lifecycle to control of the disease. Front. Vet. Sci. 2021;8 doi: 10.3389/fvets.2021.787653. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Moberg M., Apró W., Ekblom B., Hall G.v., Holmberg H.-C., Blomstrand E. Activation of mTORC1 by leucine is potentiated by branched-chain amino acids and even more so by essential amino acids following resistance exercise. Am. J. Physiol. Cell Physiol. 2016;310:C874–C884. doi: 10.1152/ajpcell.00374.2015. [DOI] [PubMed] [Google Scholar]
- Morris S.M., Jr. Arginine metabolism: boundaries of our knowledge. J. Nutr. 2007;137:1602S–1609S. doi: 10.1093/jn/137.6.1602S. [DOI] [PubMed] [Google Scholar]
- Nie C., He T., Zhang W., Zhang G., Ma X. Branched chain amino acids: beyond nutrition metabolism. Int. J. Mol. Sci. 2018;19:954. doi: 10.3390/ijms19040954. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nirgiotis J.G., Hennessey P.J., Andrassy R.J. The effects of an arginine-free enteral diet on wound healing and immune function in the postsurgical rat. J. Pediatr. Surg. 1991;26:936–941. doi: 10.1016/0022-3468(91)90840-p. [DOI] [PubMed] [Google Scholar]
- Perez-Carbajal C., Caldwell D., Farnell M., Stringfellow K., Pohl S., Casco G., Pro-Martinez A., Ruiz-Feria C.A. Immune response of broiler chickens fed different levels of arginine and vitamin E to a coccidiosis vaccine and Eimeria challenge. Poult. Sci. 2010;89:1870–1877. doi: 10.3382/ps.2010-00753. [DOI] [PubMed] [Google Scholar]
- Powell J.D., Pollizzi K.N., Heikamp E.B., Horton M.R. Regulation of immune responses by mTOR. Annu. Rev. Immunol. 2012;30:39–68. doi: 10.1146/annurev-immunol-020711-075024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rao R., Samak G. Role of glutamine in protection of intestinal epithelial tight junctions. J. Epithel. Biol. Pharmacol. 2012;5(Suppl. 1-M7):47–54. doi: 10.2174/1875044301205010047. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rha M.S., Shin E.C. Activation or exhaustion of CD8+ T cells in patients with COVID-19. Cell. Mol. Immunol. 2021;18:2325–2333. doi: 10.1038/s41423-021-00750-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sakkas P., Oikeh I., Blake D.P., Nolan M.J., Bailey R.A., Oxley A., Rychlik I., Lietz G., Kyriazakis I. Does selection for growth rate in broilers affect their resistance and tolerance to Eimeria maxima? Vet. Parasitol. 2018;258:88–98. doi: 10.1016/j.vetpar.2018.06.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sampson L.L., Davis A.K., Grogg M.W., Zheng Y. mTOR disruption causes intestinal epithelial cell defects and intestinal atrophy postinjury in mice. FASEB J. 2016;30:1263. doi: 10.1096/fj.15-278606. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Santos R.R., Velkers F.C., Vernooij J.C.M., Star L., Heerkens J.L.T., van Harn J., de Jong I.C. Nutritional interventions to support broiler chickens during Eimeria infection. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2022.101853. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schneiders G.H., Foutz J.C., Milfort M.C., Ghareeb A.F.A., Fuller A.L., Rekaya R., Williams S.M., Aggrey S.E. Heat stress reduces sexual development and affects pathogenesis of Eimeria maxima in meat-type chickens. Sci. Rep. 2020;10:10736. doi: 10.1038/s41598-020-67330-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Selvaraj R.K. Avian CD4+CD25+ regulatory T cells: Properties and therapeutic applications. Dev. Comp. Immunol. 2013;41:397–402. doi: 10.1016/j.dci.2013.04.018. [DOI] [PubMed] [Google Scholar]
- Shanmugasundaram R., Selvaraj R.K. Regulatory T cell properties of chicken CD4+CD25+ cells. J. Immunol. 2011;186:1997–2002. doi: 10.4049/jimmunol.1002040. [DOI] [PubMed] [Google Scholar]
- Shanmugasundaram R., Selvaraj R.K. Effect of killed whole yeast cell prebiotic supplementation on broiler performance and intestinal immune cell parameters. Poult. Sci. 2012;91:107–111. doi: 10.3382/ps.2011-01732. [DOI] [PubMed] [Google Scholar]
- Shanmugasundaram R., Sifri M., Selvaraj R.K. Effect of yeast cell product (CitriStim) supplementation on broiler performance and intestinal immune cell parameters during an experimental coccidial infection. Poult. Sci. 2013;92:358–363. doi: 10.3382/ps.2012-02776. [DOI] [PubMed] [Google Scholar]
- Shao Y., Wolf P.G., Guo S., Guo Y., Gaskins H.R., Zhang B. Zinc enhances intestinal epithelial barrier function through the PI3K/AKT/mTOR signaling pathway in Caco-2 cells. J. Nutr. Biochem. 2017;43:18–26. doi: 10.1016/j.jnutbio.2017.01.013. [DOI] [PubMed] [Google Scholar]
- Sharma M.K., Liu G., White D.L., Tompkins Y.H., Kim W.K. Effects of mixed Eimeria challenge on performance, body composition, intestinal health, and expression of nutrient transporter genes of Hy-Line W-36 pullets (0-6 wks of age) Poult. Sci. 2022;101 doi: 10.1016/j.psj.2022.102083. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stechmiller J.K., Childress B., Cowan L. Arginine supplementation and wound healing. Nutr. Clin. Pract. 2005;20:52–61. doi: 10.1177/011542650502000152. [DOI] [PubMed] [Google Scholar]
- Taylor J., Sakkas P., Kyriazakis I. Starving for nutrients: anorexia during infection with parasites in broilers is affected by diet composition. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2021.101535. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Teng P.-Y., Choi J., Yadav S., Tompkins Y.H., Kim W.K. Effects of low-crude protein diets supplemented with arginine, glutamine, threonine, and methionine on regulating nutrient absorption, intestinal health, and growth performance of Eimeria-infected chickens. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2021.101427. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Teng P.-Y., Liu G., Choi J., Yadav S., Wei F., Kim W.K. Effects of levels of methionine supplementations in forms of L or DL-methionine on the performance, intestinal development, immune response, and antioxidant system in broilers challenged with Eimeria spp. Poult. Sci. 2023;102:102586. doi: 10.1016/j.psj.2023.102586. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Teng P.-Y., Yadav S., Castro F.L.d.S., Tompkins Y.H., Fuller A.L., Kim W.K. Graded Eimeria challenge linearly regulated growth performance, dynamic change of gastrointestinal permeability, apparent ileal digestibility, intestinal morphology, and tight junctions of broiler chickens. Poult. Sci. 2020;99:4203–4216. doi: 10.1016/j.psj.2020.04.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tezuka H., Abe Y., Iwata M., Takeuchi H., Ishikawa H., Matsushita M., Shiohara T., Akira S., Ohteki T. Regulation of IgA production by naturally occurring TNF/iNOS-producing dendritic cells. Nature. 2007;448:929–933. doi: 10.1038/nature06033. [DOI] [PubMed] [Google Scholar]
- Tezuka H., Ohteki T. Regulation of IgA production by intestinal dendritic cells and related cells. Front. Immunol. 2019;10(Review):1891. doi: 10.3389/fimmu.2019.01891. [DOI] [PMC free article] [PubMed] [Google Scholar]
- van Harn J., Dijkslag M.A., van Krimpen M.M. Effect of low protein diets supplemented with free amino acids on growth performance, slaughter yield, litter quality, and footpad lesions of male broilers. Poult. Sci. 2019;98:4868–4877. doi: 10.3382/ps/pez229. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Walston M.W.S., Shanmugasundaram R., Selvaraj R.K. Effect of infection with mixed Eimeria species on T cells and T regulatory cell properties. J. Appl. Poult. Res. 2016;25:407–413. [Google Scholar]
- Wei G., Tabel H. Regulatory T cells prevent control of experimental African trypanosomiasis. J. Immunol. 2008;180:2514–2521. doi: 10.4049/jimmunol.180.4.2514. [DOI] [PubMed] [Google Scholar]
- Weichhart T., Hengstschläger M., Linke M. Regulation of innate immune cell function by mTOR. Nat. Rev. Immunol. 2015;15:599–614. doi: 10.1038/nri3901. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wu G. Amino acids: metabolism, functions, and nutrition. Amino Acids. 2009;37:1–17. doi: 10.1007/s00726-009-0269-0. [DOI] [PubMed] [Google Scholar]
- Yadav S., Teng P.-Y., Souza dos Santos T., Gould R.L., Craig S.W., Lorraine Fuller A., Pazdro R., Kim W.K. The effects of different doses of curcumin compound on growth performance, antioxidant status, and gut health of broiler chickens challenged with Eimeria species. Poult. Sci. 2020;99:5936–5945. doi: 10.1016/j.psj.2020.08.046. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yoshizawa F., Mochizuki S., Sugahara K. Differential dose response of mTOR signaling to oral administration of leucine in skeletal muscle and liver of rats. Biosci. Biotechnol. Biochem. 2013;77:839–842. doi: 10.1271/bbb.120737. [DOI] [PubMed] [Google Scholar]
- Zhang S., Zeng X., Ren M., Mao X., Qiao S. Novel metabolic and physiological functions of branched chain amino acids: a review. J. Anim. Sci. Biotechnol. 2017;8:10. doi: 10.1186/s40104-016-0139-z. [DOI] [PMC free article] [PubMed] [Google Scholar]





