Skip to main content
NCBI home page
EMBO Reports logoLink to EMBO Reports
. 2023 Mar 30;24(6):e55873. doi: 10.15252/embr.202255873

Frizzled receptors facilitate Tiki inhibition of Wnt signaling at the cell surface

Mingyi Li 1,2, † , Jing Zheng 1,2, † , Dong Luo 1,2, † , Kai Xu 3, Ren Sheng 4, Bryan T MacDonald 5, Xi He 6, Xinjun Zhang 1,2,7,✉
PMCID: PMC10240186  PMID: 36994853

Abstract

The membrane‐tethered protease Tiki antagonizes Wnt3a signaling by cleaving and inactivating Wnt3a in Wnt‐producing cells. Tiki also functions in Wnt‐receiving cells to antagonize Wnt signaling by an unknown mechanism. Here, we demonstrate that Tiki inhibition of Wnt signaling at the cell surface requires Frizzled (FZD) receptors. Tiki associates with the Wnt‐FZD complex and cleaves the N‐terminus of Wnt3a or Wnt5a, preventing the Wnt‐FZD complex from recruiting and activating the coreceptor LRP6 or ROR1/2 without affecting Wnt‐FZD complex stability. Intriguingly, we demonstrate that the N‐terminus of Wnt3a is required for Wnt3a binding to LRP6 and activating β‐catenin signaling, while the N‐terminus of Wnt5a is dispensable for recruiting and phosphorylating ROR1/2. Both Tiki enzymatic activity and its association with the Wnt‐FZD complex contribute to its inhibitory function on Wnt5a. Our study uncovers the mechanism by which Tiki antagonizes Wnt signaling at the cell surface and reveals a negative role of FZDs in Wnt signaling by acting as Tiki cofactors. Our findings also reveal an unexpected role of the Wnt3a N‐terminus in the engagement of the coreceptor LRP6.

Keywords: FZD, LRP6, ROR1/2, Tiki, Wnt

Subject Categories: Signal Transduction

Tiki associates with the Wnt‐FZD complex on the cell surface, cleaves the N‐terminus of FZD‐bound Wnt3a or Wnt5a, and prevents the Wnt‐FZD complex from binding to and activating coreceptors LRP6 or ROR1/2. This study uncovers the mechanism of Tiki function in Wnt‐receiving cells.

graphic file with name EMBR-24-e55873-g010.jpg

Introduction

Wnt proteins constitute an evolutionarily conserved family of secreted glycosylated and lipidated ligands that play essential roles in embryogenesis, adult tissue homeostasis, and regeneration (Clevers et al, 2014; Nusse & Clevers, 2017; Steinhart & Angers, 2018; Rim et al, 2022). At the cellular level, Wnt ligands activate several intracellular signaling pathways, notably the Wnt/β‐catenin and Wnt/planar cell polarity (PCP) pathways, by inducing and activating different receptor and coreceptor complexes at the plasma membrane (MacDonald & He, 2012; van Amerongen, 2012; Jiang & Cong, 2016). The Frizzled (FZD) family of seven‐pass transmembrane proteins serves as indispensable primary receptors for Wnt ligands and binds to Wnt proteins through the amino terminal cysteine‐rich domain (CRD) with high affinity (Janda et al, 2012; MacDonald & He, 2012; Wang et al, 2016; Hirai et al, 2019). Structural studies revealed that Wnt proteins bind to FZD‐CRD at two distinct sites via their palmitoleic acid lipid group and carboxyl region to form the Wnt‐FZD complex (Janda et al, 2012; MacDonald & He, 2012; Hirai et al, 2019). The specificity of Wnt signaling is largely determined by Wnt‐FZD complexes binding to different coreceptors, including the low‐density lipoprotein receptor‐related proteins LRP5/6 and the retinoic acid‐related orphan receptor ROR1/2 (van Amerongen, 2012; Jiang & Cong, 2016; Stricker et al, 2017). It is well established that so‐called canonical Wnts, such as Wnt3a, bind to FZD and further form a complex with LRP5/6 to induce LRP5/6 phosphorylation by recruiting cytoplasmic proteins, including DVL, Axin, GSK3, and CKI (MacDonald et al, 2009; Nusse & Clevers, 2017). Phosphorylated LRP5/6 directly inhibits the β‐catenin destruction complex consisting of Axin, GSK3, and APC and stabilizes β‐catenin (MacDonald et al, 2009; Kim et al, 2013). β‐Catenin is further translocated into the nucleus and binds to TCF/LEF‐1 family transcription factors to activate the gene expression essential for cell growth and cell fate determination. On the contrary, noncanonical Wnts, such as Wnt5a, bind to FZD and may form a complex with ROR1/2 to induce ROR1/2 phosphorylation through an apparently analogous mechanism used by the canonical pathway (Yamamoto et al, 2007; Grumolato et al, 2010; Mattes et al, 2018). Although the intracellular signaling directly downstream of ROR1/2 phosphorylation is not well defined, ROR1/2 phosphorylation was reported to contribute to the activation of the PCP pathway to regulate cell migration and polarity (Yamamoto et al, 2007; Grumolato et al, 2010; Mattes et al, 2018).

Wnt signaling pathways are tightly controlled by multiple extracellular Wnt regulators, many of which function through direct binding to Wnt ligands or receptors to selectively inhibit downstream Wnt signaling (Cruciat & Niehrs, 2013; Rim et al, 2022). In addition, there are two classes of enzymatic inhibitors that directly modify Wnt ligands: Notum and Tiki (Zhang et al, 2012, 2015; Kakugawa et al, 2015). The Wnt deacylase Notum removes the palmitoleoyl lipid modification to prevent Wnt association with the FZD receptor, while Tiki endopeptidases target the Wnt amino termini. Tiki proteins are evolutionarily conserved among the animal kingdom, and most vertebrates have two Tiki genes named Tiki1 and Tiki2, except for rodents, which only have the Tiki2 gene (Zhang et al, 2012; Reis et al, 2014). Tiki proteins were initially characterized as single‐pass transmembrane proteins with a large conserved extracellular TIKI/GumN domain that serves as an enzymatic core (Bazan et al, 2013; Zhang et al, 2016). In Wnt‐expressing cells, Tiki cleaves the amino terminus of Wnt3a and causes Wnt3a to form an oxidized oligomer that is incapable of binding to FZD or LRP6 receptors (Zhang et al, 2012). Tiki also functions in Wnt‐receiving cells to antagonize Wnt signaling (Zhang et al, 2012). Our recent study characterizes Tiki proteins as glycosylphosphatidylinositol‐anchored proteins (GPI‐APs) that are enriched at the detergent‐resistant membrane microdomains at the plasma membrane, suggesting a major role of Tiki proteins on the cell surface (Li et al, 2022). However, how Tiki proteins function at the plasma membrane in Wnt‐receiving cells remains unknown.

Herein, we established a correlation between Tiki and FZD receptors at the plasma membrane of Wnt‐receiving cells. Tiki cleaves Wnt3a or Wnt5a only after either binds to FZD receptors at the cell surface. Tiki cleavage of Wnt3a or Wnt5a does not affect Wnt‐FZD complex formation but prevents the Wnt‐FZD complex from recruiting and activating coreceptors LRP5/6 or ROR1/2, thereby antagonizing both canonical and noncanonical Wnt pathways.

Results

Tiki may be associated with FZDs

To explore the mechanism by which Tiki regulates Wnt signaling in Wnt‐receiving cells, we searched for TIKI2‐interacting proteins at the plasma membrane by utilizing an enzyme‐catalyzed proximity labeling approach, which has advantages for labeling insoluble proteins (Kim & Roux, 2016; Branon et al, 2018). For this purpose, a miniTurbo (mTB) biotin ligase and an HA tag were inserted into the TIKI2 sequence before the GPI anchor (TIKI2‐mTB; Fig EV1A). As a control, a GFP‐mTB‐expressing vector was generated by replacing the TIKI2 extracellular region of TIKI2‐mTB with an enhanced green fluorescent protein (EGFP). We first confirmed that both TIKI2‐mTB and GFP‐mTB were correctly expressed at the cell surface as GPI‐APs, as both proteins could be released from the cell surface by phosphatidylinositol‐specific phospholipase C (PI‐PLC; Fig EV1B). TOPFLASH reporter results revealed that TIKI2‐mTB functionally inhibited Wnt3a‐induced Wnt signaling when expressed in Wnt‐receiving cells (Fig EV1C). To identify potential TIKI2‐interacting proteins at the plasma membrane, HEK293 cells stably expressing TIKI2‐mTB or GFP‐mTB were labeled with biotin, and the biotinylated proteins were captured by Neutravidin beads. Silver staining revealed that in addition to TIKI2‐mTB, multiple endogenous proteins were specifically biotinylated (Fig EV1D). The samples were subjected to mass spectrometry analysis for protein identification. We selected membrane proteins specifically biotinylated in TIKI2‐mTB‐expressing cells for further verification (Fig EV1E). To our surprise, FZD2 appeared in this list, suggesting that TIKI2 may associate with FZD receptors.

Figure EV1. TIKI2 may be associated with FZDs.

Figure EV1

Open in a new tab
  1. Schematic of the TIKI2‐miniTurbo (TIKI2‐mTB) and GFP‐miniTurbo (GFP‐mTB) fusion proteins. MiniTurbo and HA tags were inserted before the GPI cleavage site.
  2. GFP‐mTB and TIKI2‐mTB are GPI‐anchored proteins. HEK293T cells expressing GFP‐mTB or TIKI2‐mTB were treated with PI‐PLC, and CM and WCLs were subjected to immunoblotting with the indicated antibodies.
  3. TIKI2‐mTB inhibits Wnt3a‐induced TOPFLASH reporter expression.
  4. SDS–PAGE and silver staining analysis of proteins captured by NeutrAvidin beads. Arrows indicate GFP‐mTB and TIKI2‐mTB fusion proteins.
  5. Cell surface proteins in TIKI2‐mTB mass spectrometry.

Data information: Data in (B and C) are representative of three biological replicates. Mean ± SD, n = 3, ns, not significant, ***P < 0.01, Student's t‐test (C).

Source data are available online for this figure.

FZDs facilitate Tiki cleavage of Wnt proteins at the cell surface

Although Tiki efficiently inhibits exogenous Wnt3a‐induced β‐catenin signaling when expressed in Wnt‐responsive cells (Zhang et al, 2012; Li et al, 2022), the mechanism by which Tiki functions at the cell surface remains unknown. As FZDs are high‐affinity Wnt receptors (MacDonald & He, 2012; Sun et al, 2021), TIKI may bind to FZDs and prevent Wnt binding to FZDs or cleave FZD‐bound Wnt proteins and inactivate them. To examine these possibilities, we first cocultured HEK293T cells expressing FZD5 alone (red) and HEK293T cells expressing both FZD5 and TIKI2 (TIKI2 + FZD5; green) and treated the cells with HA‐Wnt3a‐ or HA‐Wnt5a‐conditioned media (CM). The cells were subjected to immunostaining with an anti‐HA antibody to visualize cell surface‐bound HA‐Wnt proteins. The results showed that red cells (expressing FZD5 alone), but not green cells (expressing both FZD5 and TIKI2), were labeled by the anti‐HA antibody (Fig 1A), indicating that both Wnt3a and Wnt5a bind to FZD5 on the cell surface, while TIKI2 either cleaves the amino termini of FZD5‐bound Wnts, prevents Wnt binding to FZD5, or modifies FZD5 or its expression on the cell surface. Next, control, FZD5‐, or TIKI2 + FZD5‐expressing HEK293T cells were incubated with HA‐Wnt3a CM and then subjected to flow cytometry analysis to detect the cell surface‐bound HA‐Wnt3a and cell surface‐expressed V5‐FZD5 proteins using anti‐HA and anti‐V5 antibodies. The results showed that TIKI2 expression reduced the HA signal but had no effect on the V5 signal (Fig 1B), suggesting that TIKI2 does not affect FZD5 expression on the cell surface. As the Wnt3a or Wnt5a antibody is not suitable for immunostaining, to examine whether TIKI2 cleaves the amino termini of FZD5‐bound Wnts or prevents Wnt binding to FZD5, we next performed immunoblotting to detect cell surface‐bound Wnts using both anti‐HA and anti‐Wnt3a or anti‐Wnt5a antibodies. The results revealed that FZD5‐expressing cell‐bound HA‐Wnt3a or HA‐Wnt5a could be detected by both anti‐HA and anti‐Wnt antibodies, while in the presence of TIKI2 expression, the HA signals were lost, and the Wnt signals appeared at smaller molecular weight positions compared with those in FZD5‐expressing cells (Fig 1C). These results suggest that TIKI2 cleaves the amino termini of FZD5‐bound Wnt3a and Wnt5a but does not affect Wnt‐FZD5 interactions. We also examined HA‐Wnt3a and HA‐Wnt5a in CM after incubation with FZD5‐expressing or TIKI2 + FZD5‐expressing cells and found that they were not cleaved (Fig 1D), implying that Tiki cleaves FZD5‐bound Wnt3a and Wnt5a and that cleavage does not affect Wnt‐FZD complex stability.

Figure 1. FZDs facilitate Tiki cleavage of Wnt proteins on the cell surface.

Figure 1

Open in a new tab
  1. Top: Schematic of HA‐Wnt3a or HA‐Wnt5a proteins. Bottom: Immunofluorescence of HA‐Wnts bound to HEK293T cells. HEK293T cells expressing FZD5 alone (red) or coexpressing FZD5 and TIKI2 (green) were cocultured and treated with HA‐Wnt3a or HA‐Wnt5a CM and were subjected to immunostaining with an anti‐HA antibody. Scale bars, 20 μm.
  2. Flow cytometry analysis of HA‐Wnt3a and V5‐FZD5 on the cell surface. Control HEK293T (Con), HEK293T cells expressing V5‐FZD5 alone (FZD5) or coexpressing V5‐FZD5 and TIKI2 (FZD5 + TIKI2) were treated with HA‐Wnt3a CM and were subjected to flow cytometry analysis with anti‐HA or anti‐V5 antibodies to detect HA‐Wnt3a or V5‐FZD5 on the cell surface.
  3. Control HEK293T cells and HEK293T cells expressing V5‐FZD5 alone or coexpressing V5‐FZD5 and TIKI2 were treated with HA‐Wnt3a or HA‐Wnt5a CM. Cells were washed with PBS twice, and WCLs were immunoblotted with the indicated antibodies. * Indicates a nonspecific band.
  4. HA‐Wnt3a or HA‐Wnt5a CM before and after treating cells (after treatment) in (C) were immunoblotted with the indicated antibodies.
  5. Wild‐type TIKI2 but not TIKI2‐H2A (an enzymatic dead mutant) cleaved Wnt3a and Wnt5a on the cell surface.
  6. TIKI1 cleaved Wnt3a and Wnt5a on the cell surface.
  7. HEK293T cells expressing FZD alone or coexpressing FZD and TIKI2 were treated with Wnt3a or Wnt5a CM. Cells were washed with PBS twice, and WCLs were subjected to immunoblotting with the indicated antibodies.

Data information: All data are representative of three biological replicates.

Source data are available online for this figure.

We next found that TIKI2‐H2A, an enzymatically dead mutant (Zhang et al, 2016), cleaved neither Wnt3a nor Wnt5a at the cell surface when coexpressed with FZD5, suggesting that TIKI2 cleavage of Wnts at the cell surface relies on its enzymatic activity (Fig 1E). We further confirmed that TIKI1, the close homolog of TIKI2, could also cleave Wnt3a and Wnt5a at the cell surface in the presence of FZD5 (Fig 1F). Finally, to examine whether other FZDs also facilitate Tiki cleavage of Wnts at the cell surface, each of the 10 FZDs was expressed alone or together with TIKI2, and the cells were incubated with Wnt3a or Wnt5a CM. Whole cell lysates (WCLs) were subjected to immunoblotting to examine Wnt cleavage. The results indicated that except for FZD2, 3, and 6, which were expressed at low levels, all other FZDs facilitated TIKI2 cleavage of Wnt3a or Wnt5a, as visualized by mobility shifts of Wnts on SDS–PAGE (Fig 1G). We noted that FZD2‐, FZD3‐, and FZD6‐expressing cells did not obviously bind Wnt3a or Wnt5a compared with control cells (Fig 1G), possibly due to their low expression levels at the cell surface, as suggested by the flow cytometry analysis (Fig EV2). Based on the above results, we conclude that FZDs facilitate Tiki cleavage of Wnts at the plasma membrane in Wnt‐receiving cells.

Figure EV2. Cell surface expression of FZDs.

Figure EV2

Open in a new tab

HEK293T cells expressing individual V5‐FZD were subjected to flow cytometry analysis with an anti‐V5 antibody to detect the cell surface expression of FZDs.

Data information: All data are representative of three biological replicates.

The FZD extracellular domain and TIKI2 GumN domain are required for Wnt protein cleavage at the cell surface

To examine whether the extracellular domains of FZDs (FZDN) are sufficient for promoting Tiki cleavage of Wnts at the cell surface, each of the amino terminal extracellular domains of FZD1, FZD5, or FZD8 was fused with a GPI anchor (Fig 2A) and was expressed alone or together with TIKI2 to examine Wnt cleavage. The results showed that the expression of FZD1N, FZD5N, or FZD8N‐GPI was sufficient to promote TIKI2 cleavage of Wnt3a and Wnt5a (Fig 2B). To further support that Tiki‐mediated cleavage of Wnt3a and Wnt5a on the cell surface specifically requires FZDs, we examined another Wnt‐binding protein, Afamin (Mihara et al, 2016). Afamin was fused with a GPI anchor and was expressed alone or together with TIKI2 in HEK293T cells. As shown in Fig EV3A and B, Afamin‐GPI increased the amounts of cell surface‐bound Wnt3a and Wnt5a (to a lesser extent) but did not facilitate their cleavage in the presence of TIKI2. Furthermore, we observed significant amounts of Wnt3a and Wnt5a bound to control cells (without FZD5N‐GPI or Afamin‐GPI expression) that were not cleaved by TIKI2 (Fig EV3A and B). These results further support that FZDs specifically facilitate Tiki cleavage of Wnt3a and Wnt5a on the cell surface.

Figure 2. The FZD extracellular domain and Tiki‐GumN domain are required for Wnt cleavage on the cell surface.

Figure 2

Open in a new tab
  1. Schematic of FZD and FZDN‐GPI (FZD extracellular domain fused with a GPI anchor).
  2. HEK293T cells expressing FZDN‐GPI alone or together with TIKI2 were treated with Wnt3a or Wnt5a CM. Cells were washed with PBS twice, and WCLs were subjected to immunoblotting with the indicated antibodies.
  3. Schematic of TIKI2 and GumN‐GPI (TIKI2 mutant lacking the region between the GumN domain and GPI anchor).
  4. HEK293T cells expressing FZD5 alone or together with GumN‐GPI were treated with Wnt3a or Wnt5a CM. Cells were washed with PBS twice, and WCLs were subjected to immunoblotting with the indicated antibodies.

Data information: Data are representative of three biological replicates (B, D).

Source data are available online for this figure.

Figure EV3. FZD specifically facilitates Tiki cleavage of Wnt3a or Wnt5a.

Figure EV3

Open in a new tab
  • A, B
    FZD5N‐GPI, but not Afamin‐GPI, facilitates TIKI2 cleavage of Wnt3a or Wnt5a on the cell surface. HEK293T cells expressing Afamin‐GPI or FZD5N‐GPI alone or together with TIKI2 were treated with Wnt3a or Wnt5a CM. Cells were washed with PBS, and WCLs were subjected to immunoblotting with the indicated antibodies. Note that control cells (without Afamin‐GPI or FZD5N‐GPI expression) also absorb significant amounts of Wnt3a or Wnt5a (likely through extracellular matrix) that cannot be cleaved by TIKI2, further suggesting that TIKI cleavage of Wnt3a or Wnt5a on the cell surface specifically relies on FZD.
  • C, D
    FZD7‐CRD, but not Afamin, facilitates Wnt3a or Wnt5a cleavage in vitro. The indicated CM containing IgG FC or FC fusion proteins was first mixed with Wnt3a or Wnt5a CM and precipitated with rProtein G agarose. The agarose was then incubated with control or TIKI2N CM at 37°C overnight, and the mixtures were subjected to immunoblotting with the indicated antibodies. Note that Wnt3a or Wnt5a bound to FZD7‐CRD, but not Afamin, was cleaved by TIKI2N as judged by band shift.
  • E
    TIKI does not cleave Wnt3a C77A. The indicated CM was mixed and incubated at 37°C overnight, and the mixtures were subjected to immunoblotting with the indicated antibodies.

Data information: All data are representative of three biological replicates.

Source data are available online for this figure.

The extracellular region of TIKI contains a large conserved TIKI/GumN domain followed by a linker region, and the GumN domain was predicted to contain enzymatically active residues (Zhang et al, 2012, 2016; Bazan et al, 2013). To examine whether the GumN domain alone is sufficient to cleave Wnt proteins at the cell surface, we constructed a GumN‐GPI‐expressing vector in which the linker region of TIKI2 was deleted (Fig 2C). As shown in Fig 2D, GumN‐GPI was sufficient to cleave Wnt3a and Wnt5a at the cell surface in the presence of FZD5.

FZD‐CRD facilitates Tiki cleavage of Wnt proteins in vitro

To further confirm that FZD‐CRD facilitates Tiki cleavage of Wnt proteins, we set up an in vitro assay using TIKI2N (the extracellular domain of TIKI2) and FZD‐CRDs in CM. Wnt3a or Wnt5a CM was mixed with each of the 10 FZD‐CRD‐containing CM or control CM in the presence of TIKI2N CM and incubated at 37°C overnight. The mixtures were then subjected to SDS–PAGE and immunoblotting analysis, and the cleavage of Wnt3a or Wnt5a was visualized by band shifts. The results indicated that TIKI2N cleaved Wnt3a in the presence of FZD1 or 7‐CRD and cleaved Wnt5a in the presence of FZD1, 5, 7, or 8‐CRD (Fig 3A and B), suggesting that FZD‐CRD directly facilitates TIKI cleavage of Wnts in vitro. The FZD‐CRDs that did not show activity in promoting TIKI2N cleavage of Wnts might be due to inefficient binding to Wnt3a, Wnt5a, or TIKI2N in vitro. We further showed that although Afamin binds to both Wnt3a and Wnt5a in vitro, it could not facilitate TIKI2N cleavage of Wnt3a and Wnt5a (Fig EV3C and D). Wnt proteins are hydrophobic in CM due to lipid modification (Willert et al, 2003). It is possible that FZD‐CRD specifically binds to and covers the lipid chain on Wnts and thus makes Wnts hydrophilic to facilitate Tiki cleavage. To examine this possibility, we used Wnt3a C77A, a Wnt3a mutant that forms hydrophilic oligomers in CM (Zhang et al, 2012), in the in vitro assay. As shown in Fig EV3E, TIKI2N did not cleave Wnt3a C77A with or without FZD7‐CRD, suggesting that making Wnt3a hydrophilic is not sufficient for Tiki cleavage. It is also possible that oligomerization of Wnt3a C77A prevents its cleavage by Tiki.

Figure 3. FZD‐CRD is required for Tiki cleavage of Wnt proteins in vitro .

Figure 3

Open in a new tab
  • A, B
    The indicated CM was mixed and incubated at 37°C overnight and subjected to immunoblotting with the indicated antibodies. Note that TIKI2N cleaved Wnt3a in the presence of FZD1‐CRD or FZD7‐CRD, and TIKI2N cleaved Wnt5a in the presence of FZD1, 5, 7, or 8‐CRD.

Data information: All data are representative of three biological replicates.

Source data are available online for this figure.

Tiki interacts with the Wnt‐FZD complex

We next performed in vitro coimmunoprecipitation experiments to examine the potential interaction between Tiki and the Wnt‐FZD complex. As shown in Fig 4A, FZD7‐CRD precipitated TIKI2N only in the presence of Wnt3a or Wnt5a, suggesting that Tiki likely associates with FZD‐CRD indirectly through Wnt proteins. To further examine the interaction between TIKI2N and Wnt proteins, we performed coimmunoprecipitation experiments by mixing TIKI2N CM and Wnt3a or Wnt5a CM in the presence or absence of FZD7‐CRD CM. As shown in Fig 4B, a weak Wnt3a signal and no Wnt5a signal could be detected in TIKI2N precipitates in the absence of FZD7‐CRD, while in the presence of FZD7‐CRD, TIKI2N could efficiently precipitate both Wnt3a and Wnt5a. These results suggest that Wnt protein binding to FZD‐CRD facilitates Tiki recognition and cleavage of Wnt proteins.

Figure 4. Tiki interacts with the Wnt‐FZD complex.

Figure 4

Open in a new tab
  1. FZD7‐CRD associates with TIKI2N in the presence of Wnt3a or Wnt5a. The indicated CM was mixed and precipitated with rProtein G agarose at 4°C overnight, and the precipitates and inputs were subjected to immunoblotting with the indicated antibodies.
  2. FZD7‐CRD enhanced the interaction between TIKI2N and Wnt3a or Wnt5a. The indicated CM was mixed and precipitated with anti‐FLAG antibody agarose at 4°C overnight, and the precipitates and inputs were subjected to immunoblotting with the indicated antibodies. Note that the Wnt5a band in lane 3 on the Wnt5a blot of FLAG IP is the endogenous Wnt5a that is present in 293T CM and is coprecipitated with TIKI2N in the presence of FZD7‐CRD.

Data information: All data are representative of three biological replicates.

Source data are available online for this figure.

Tiki inhibits Wnt‐induced coreceptor LRP6 and ROR1/2 phosphorylation in Wnt‐receiving cells

The above results suggest that Tiki cleaves Wnt proteins on the cell surface in the presence of FZDs, but cleavage does not affect Wnt‐FZD complex formation and stability. We hypothesized that Tiki cleavage of Wnts on the cell surface might prevent the Wnt‐FZD complex from binding to and activating coreceptors LRP6 or ROR1/2. As shown in Fig 5A, immunoblotting results revealed that TIKI2 expression effectively inhibited Wnt3a CM‐induced LRP6 phosphorylation and cytosolic β‐catenin accumulation. TIKI2‐H2A, the enzymatic dead mutant, had no effect on either LRP6 phosphorylation or β‐catenin accumulation, implying that the effect of Tiki on Wnt3a relies on Tiki enzymatic activity. On the contrary, neither TIKI2 nor TIKI2‐H2A inhibited Wnt3a CM‐induced DVL2 phosphorylation (upper bands in DVL2 blot; Fig 5A). Interestingly, TIKI2 or TIKI2‐H2A expression increased the basal level of DVL2 phosphorylation (control CM treatment; Fig 5A).

Figure 5. Tiki inhibits Wnt‐induced coreceptor LRP6 and ROR1/2 phosphorylation in Wnt‐receiving cells.

Figure 5

Open in a new tab
  • A, B
    TIKI2 overexpression inhibited Wnt3a‐induced LRP6 phosphorylation and cytosolic β‐catenin accumulation or Wnt5a‐induced ROR1/2 phosphorylation but not DVL2 phosphorylation. TIKI2‐H2A overexpression had a minimal effect on Wnt3a‐induced LRP6 phosphorylation or cytosolic β‐catenin accumulation but exhibited obvious inhibition of Wnt5a‐induced ROR1/2 phosphorylation, although it was weaker than that of TIKI2. Control U2OS cells or U2OS cells expressing TIKI2 or TIKI2‐H2A were treated with Wnt3a CM (A) or Wnt5a CM (B), and WCLs or cytosolic extracts were subjected to immunoblotting with the indicated antibodies.
  • C
    Control U2OS cells or U2OS cells expressing ZNRF3 or TIKI2 were treated with Wnt5a CM. WCLs were subjected to immunoblotting with the indicated antibodies. Note that ZNRF3 inhibited both ROR1/2 and DVL2 phosphorylation, while TIKI2 inhibited ROR1/2 but not DVL2 phosphorylation. The inhibition of ZNRF3 on Wnt5a‐induced ROR1/2 phosphorylation is much weaker than that of TIKI2.
  • D
    Endogenous TIKI2 inhibits Wnt5a signaling in U2OS cells. WCLs from WT or TIKI2 knockout (KO) cells were subjected to immunoblotting with the indicated antibodies.
  • E, F
    TIKI2 KO enhanced Wnt signaling induced by Wnt3a or Wnt5a CM. WT or TIKI2 KO cells were treated with IWP‐2 overnight and then treated with increasing doses of Wnt3a (E) or Wnt5a (F) CM for 2 h. WCLs were subjected to immunoblotting with the indicated antibodies.

Data information: All data are representative of three biological replicates.

Source data are available online for this figure.

It has been reported that Wnt5a induces ROR1/2 phosphorylation by coupling FZD receptors and ROR1/2 coreceptors (Grumolato et al, 2010). As Tiki cleaves Wnt5a on the cell surface in the presence of FZD, we next examined whether TIKI2 inhibits Wnt5a‐induced ROR1/2 phosphorylation. Immunoblotting results revealed that TIKI2 expression effectively inhibited the basal level of ROR1 phosphorylation and Wnt5a‐induced ROR1 and ROR2 phosphorylation, as visualized by band shifts (Fig 5B). We noted that TIKI2‐H2A expression also inhibited Wnt5a‐induced ROR1/2 phosphorylation, although less effectively than TIKI2, implying that both TIKI2 enzymatic activity and its association with Wnt5a‐FZD contribute to TIKI2 function on Wnt5a (Fig 5B). Neither TIKI2 nor TIKI2‐H2A inhibited Wnt5a‐induced DVL2 phosphorylation (Fig 5B). ZNRF3 was previously reported to inhibit Wnt signaling by targeting FZD receptors for ubiquitination and degradation (Hao et al, 2012). We compared the effects of TIKI2 and ZNRF3 overexpression on Wnt5a‐induced phosphorylation of ROR1/2 and DVL2. As shown in Fig 5C, ZNRF3 expression inhibited Wnt5a‐induced DVL2 and ROR1/2 phosphorylation, while TIKI2 expression exhibited minimal inhibition of DVL2 phosphorylation but strong inhibition of ROR1/2 phosphorylation, implying that TIKI2 and ZNRF3 inhibit Wnt signaling through distinct mechanisms.

These results together further suggest that Tiki cleavage of Wnt3a and Wnt5a abolishes phosphorylation and activation of coreceptors LRP6 and ROR1/2, but Tiki‐cleaved Wnts could still activate FZD receptors and FZD‐mediated downstream signaling, such as phosphorylation of DVL2.

To study the function of endogenous Tiki, we first examined TIKI1/2 expression in HeLa and U2OS cells. Reverse transcription PCR and quantitative PCR results revealed that HeLa cells expressed both TIKI1 and TIKI2, while U2OS cells mainly expressed TIKI2 (Fig EV4A and B). We then generated TIKI2 knockout U2OS cells by using a CRISPR–Cas9‐mediated genomic editing approach. Successful knockout of TIKI2 was verified by genomic PCR and sequencing (Fig EV4C). As shown in Fig 5D, U2OS cells expressed endogenous WNT5A, which exhibited two bands in wild‐type cells, and TIKI2 knockout resulted in an increase in the upper band and a reduction in the lower band, suggesting that WNT5A is cleaved by endogenous TIKI2 in U2OS cells. Furthermore, TIKI2 knockout also resulted in elevations in the phosphorylation levels of ROR1/2 and DVL2 (Fig 5D), suggesting that endogenous TIKI2 inhibits WNT5A‐induced signaling in WNT‐producing cells.

Figure EV4. TIKI1 and TIKI2 expression in HeLa and U2OS cells and verification of TIKI2 knockout in U2OS cells.

Figure EV4

Open in a new tab
  • A, B
    Reverse transcription PCR and quantitative PCR examination of TIKI1/2 expression in HeLa and U2OS cells.
  • C
    Genomic sequencing results of TIKI2 knockout clones. The sgRNA targeting sequence is highlighted.

Data information: Data in (A and B) are representative of three biological replicates. Mean ± SD in (B).

To examine whether endogenous TIKI2 inhibits Wnt signaling in Wnt‐receiving cells, WT and TIKI2 knockout U2OS cells were first treated with IWP‐2, a porcupine inhibitor (Chen et al, 2009), to block endogenous WNT production and then treated with Wnt3a or Wnt5a CM. Immunoblotting results revealed that TIKI2 knockout enhanced Wnt3a‐induced LRP6 phosphorylation and cytosolic β‐catenin accumulation or Wnt5a‐induced ROR1/2 phosphorylation but had little effect on DVL2 phosphorylation (Fig 5E and F). These results suggest that endogenous TIKI2 antagonizes both the canonical and noncanonical Wnt pathways in Wnt‐receiving cells.

Tiki prevents Wnt‐induced FZD and coreceptor LRP6 or ROR1/2 complex formation on the cell surface

To examine whether Tiki inhibits Wnt‐induced FZD and coreceptor complex formation on the cell surface, we performed a proximity biotin labeling assay by using HEK293A cells stably expressing FZD7 fused with mTB on its carboxyl terminus. As shown in Fig 6, in the presence of biotin, endogenous LRP6, and ROR1/2 were biotinylated in HEK293A‐FZD7‐mTB cells, and their biotinylation signals were significantly increased by Wnt3a or Wnt5a, suggesting that Wnt3a or Wnt5a could induce FZD7 to form complexes with LRP6 or ROR1/2, respectively. TIKI2 expression efficiently inhibited Wnt3a‐ or Wnt5a‐induced LRP6 or ROR1/2 biotinylation (Fig 6B). We noted that both IWP‐2 and TIKI2 inhibited basal biotinylation of ROR1/2, implying that basal ROR1/2 biotinylation is dependent on endogenous Wnt (Fig 6B). Neither IWP‐2 nor TIKI2 inhibited basal biotinylation of LRP6, suggesting that FZD7 and LRP6 may have a weak interaction independent of Wnt (Fig 6B). Together, these results suggest that Tiki inhibits Wnt‐induced FZD and coreceptor complex formation on the surface of Wnt‐receiving cells.

Figure 6. Tiki prevents Wnt‐induced FZD and coreceptor LRP6 or ROR1/2 complex formation on the surface of Wnt‐receiving cells.

Figure 6

Open in a new tab
  1. Verification of HEK293A cells expressing FZD7‐mTB or FZD7‐mTB together with TIKI2. The indicated HEK293A cells were cultured in the presence or absence of biotin, and WCLs were subjected to immunoblotting with the indicated antibodies.
  2. TIKI2 inhibits Wnt3a‐ or Wnt5a‐induced FZD7 and LRP6 or ROR1/2 complex formation on the cell surface. HEK293A cells stably expressing FZD7‐mTB or FZD7‐mTB together with TIKI2 were treated with control, Wnt3a, or Wnt5a CM with or without biotin. WCLs were precipitated with Neutravidin beads to enrich the biotinylated proteins. The precipitates and inputs were subjected to immunoblotting with the indicated antibodies. IWP‐2 was used to inhibit endogenous Wnt protein production.

Data information: All data are representative of three biological replicates.

Source data are available online for this figure.

As Tiki cleaves the amino terminus of Wnt3a and Wnt5a and inhibits Wnt‐induced FZD and coreceptor complex formation, we hypothesized that the amino terminus of Wnt3a or Wnt5a may be involved in recruiting and activating coreceptors. We previously reported that Tiki‐cleaved Wnt3a in Wnt‐producing cells forms oxidized oligomers in CM that no longer bind to either FZD or LRP6 (Zhang et al, 2012). The oligomerization hampers further characterization of the amino terminus of Wnt3a. Interestingly, we found that Tiki‐cleaved Wnt3a on the cell surface in Wnt‐receiving cells in the presence of FZD did not form oligomers (Fig 7A), suggesting that binding to the FZD‐CRD may protect Tiki‐cleaved Wnt3a from forming oligomers. Indeed, we found that coexpression of FZD7‐CRD in TIKI2‐ and Wnt3a‐expressing cells significantly increased the amount of monomeric Wnt3a in CM (Fig 7B). As high amounts of FZD7‐CRD inhibit Wnt3a activity, we titrated the amount of FZD7‐CRD and chose an amount that was sufficient to produce monomeric TIKI2‐cleaved Wnt3a in CM without a significant effect on the activity of wild‐type Wnt3a (Fig 7B). We found that monomeric TIKI2‐cleaved Wnt3a (Wnt3a(FZD7‐CRD + TIKI2)) was inactive in inducing cytosolic β‐catenin accumulation compared with wild‐type Wnt3a (Wnt3a(FZD7CRD); Fig 7B). We next performed coimmunoprecipitation by mixing LRP6N (extracellular domain of LRP6) CM with the indicated control or Wnt3a CM. As shown in Fig 7C, FZD7‐CRD coprecipitated with LRP6N in the presence of wild‐type Wnt3a but not TIKI2‐cleaved Wnt3a, suggesting that the amino terminus of Wnt3a is required for binding to LRP6.

Figure 7. The amino terminus of Wnt3a is required for interacting with LRP6 and activating β‐catenin signaling.

Figure 7

Open in a new tab
  1. TIKI2 cleavage of Wnt3a on the cell surface does not cause Wnt3a to form oxidized oligomers. WCL samples in Fig 1C were analyzed by nonreducing SDS–PAGE and were immunoblotted with Wnt3a antibody.
  2. FZD7‐CRD keeps TIKI2‐cleaved Wnt3a from Wnt‐producing cells in monomers, but monomeric TIKI2‐cleaved Wnt3a is inactive. The CM from HEK293T cells expressing Wnt3a, Wnt3a plus TIKI2, Wnt3a plus FZD7‐CRD, or Wnt3a plus FZD7‐CRD and TIKI2 were analyzed by nonreducing or reducing SDS–PAGE and were immunoblotted with the indicated antibodies. The CM was also used to treat U2OS cells, and the cytosolic extracts were subjected to immunoblotting with the indicated antibodies.
  3. TIKI2‐cleaved Wnt3a in complex with FZD7‐CRD no longer binds to LRP6. The CM in (B) was precipitated with rProtein G agarose, and the precipitates were incubated with LRP6N CM. The precipitated proteins were subjected to immunoblotting with the indicated antibodies.

Data information: All data are representative of three biological replicates.

Source data are available online for this figure.

To examine whether the amino terminus of Wnt5a is required for recruiting and activating ROR1/2, we first analyzed Tiki‐cleaved Wnt5a from Wnt‐producing cells. To our surprise, TIKI2 cleavage did not cause Wnt5a to form oxidized oligomers in CM (Fig 8A), and TIKI2‐cleaved Wnt5a (Wnt5a (TIKI2)) was as active as wild‐type Wnt5a in inducing ROR1/2 phosphorylation (Fig 8B). Furthermore, TIKI2 and TIKI2‐H2A expression efficiently inhibited TIKI2‐cleaved Wnt5a‐induced ROR1/2 phosphorylation (Fig 8C). These results suggest that the amino terminus of Wnt5a is not required for recruiting and activating coreceptor ROR1/2 and that Tiki antagonizes Wnt5a signaling mainly through its interaction with the Wnt5a‐FZD complex on the surface of Wnt‐receiving cells.

Figure 8. The amino terminus of Wnt5a is not required for Wnt5a activity.

Figure 8

Open in a new tab
  1. TIKI2 cleavage of Wnt5a in Wnt‐producing cells does not cause Wnt5a to form oxidized oligomers. The CM from control HEK293T cells or HEK293T cells expressing HA‐Wnt5a alone or together with TIKI2 was analyzed by nonreducing or reducing SDS–PAGE and immunoblotted with the indicated antibodies. Note that Wnt5a in CM exhibits both monomers and oxidized oligomers.
  2. TIKI2‐cleaved Wnt5A from Wnt‐producing cells is still active in inducing the phosphorylation of ROR1/2. U2OS cells were treated with the CM in (A), and the WCLs were subjected to immunoblotting with the indicated antibodies.
  3. TIKI2‐cleaved Wnt5a‐induced ROR1/2 phosphorylation is inhibited by TIKI2 and TIKI2‐H2A. Control U2OS cells or U2OS cells expressing TIKI2 or TIKI2‐H2A were treated with TIKI2‐cleaved Wnt5a CM, and the WCLs were subjected to immunoblotting with the indicated antibodies.

Data information: All data are representative of three biological replicates.

Source data are available online for this figure.

Discussion

Tiki proteins can efficiently inhibit Wnt signaling in Wnt‐receiving cells when expressed in Xenopus embryos or cultured cells (Zhang et al, 2012; Li et al, 2022), but whether and how Tiki cleaves Wnt proteins and inhibits Wnt signaling at the cell surface is unknown. In our previous studies, TIKI2N purified from whole cell lysate (WCL) cleaved both Wnt3a protein and the peptide substrate derived from the amino terminus of Wnt3a in an in vitro assay, while TIKI2N purified from CM cleaved only the peptide substrate but not the Wnt3a protein (Zhang et al, 2012, 2016; Fig 3). We speculated that additional proteins associated with Tiki in the WCL but not in CM may be required for Tiki function in cleaving Wnts. In the current study, by using a proximity labeling approach, we were surprised to find that TIKI2 is associated with FZD receptors. We further demonstrated that FZD receptors facilitate Tiki cleavage of Wnt3a and Wnt5a both at the cell surface and in vitro. Our study uncovered a negative role of FZDs in Wnt signaling by acting as Tiki cofactors beyond their role as Wnt receptors (Fig 9).

Figure 9. Schematic model for Tiki function in Wnt‐receiving cells.

Figure 9

Open in a new tab

Wnt proteins are secreted by Wnt‐producing cells and reach adjacent cells via paracrine signaling. In the absence of Tiki expression, Wnt proteins promote FZD to form complexes with coreceptors LRP5/6 or ROR1/2 and induce phosphorylation of coreceptors and DVL to activate either canonical or noncanonical signaling pathways. In Tiki‐expressing cells, Tiki associates with the Wnt‐FZD complex on the cell surface and cleaves Wnt proteins, which prevents the Wnt‐FZD complex from binding to and activating coreceptors. Tiki cleavage of Wnt does not affect Wnt‐FZD complex stability or its function in DVL phosphorylation.

As Wnt proteins are lipidated and hydrophobic, their secretion and transportation in the extracellular space are dependent on binding to chaperone proteins such as Swim, Afamin, or glypicans (Mulligan et al, 2012; Mihara et al, 2016; McGough et al, 2020) or incorporation into exosomes or lipid particles (Panakova et al, 2005; Korkut et al, 2009; Gross et al, 2012; Kaiser et al, 2019). The fact that FZD‐CRD promotes the interaction between TIKI2N and Wnt3a or Wnt5a and that TIKI2N interacts with FZD‐CRD in a Wnt3a‐ or Wnt5a‐dependent manner suggests that binding to FZD‐CRD may cause conformational changes in Wnt3a and Wnt5a, which may become more accessible to cleavage by Tiki. Afamin, which binds to Wnt3a and Wnt5a, does not facilitate Tiki cleavage of Wnt, indicating that FZD function in Tiki cleavage of Wnt is specific.

Our study suggests that Tiki antagonizes Wnt3a and Wnt5a in different manners. We previously reported that Tiki cleavage of Wnt3a in Wnt‐producing cells causes Wnt3a to form oxidized oligomers in CM that cannot bind to either FZD or LRP6 (Zhang et al, 2012). In this study, we demonstrate that Tiki functions on the cell surface of Wnt‐receiving cells to cleave FZD‐bound Wnt3a and prevent the Wnt3a‐FZD complex from recruiting and activating the coreceptor LRP6. The function of Tiki on Wnt3a mainly relies on its enzymatic activity. Thus, Tiki antagonizes Wnt3a activity in both cell‐autonomous (in Wnt‐receiving cells) and cell‐nonautonomous (in Wnt‐producing cells) ways. Interestingly, Tiki cleavage of Wnt5a in Wnt‐producing cells does not cause Wnt5a to form oxidized oligomers or affect Wnt5a activity. In Wnt‐receiving cells, Tiki cleaves FZD‐bound Wnt5a and prevents the Wnt5a‐FZD complex from recruiting and phosphorylating coreceptors ROR1/2, but this function of Tiki largely depends on the Tiki and Wnt5a‐FZD interaction rather than Tiki enzymatic activity. Thus, Tiki antagonizes Wnt5a activity only in a cell‐autonomous way (in Wnt‐receiving cells). There are 19 Wnt proteins in mammals, and among them, Wnt3a and Wnt5a are the two best‐characterized Wnts due to their good expression and secretion in cell lines. Given that Tiki differentially regulates Wnt3a and Wnt5a and that Tiki interaction with Wnt5a‐FZD contributes to its inhibition of Wnt5a, whether and how Tiki regulates other Wnt proteins remains to be further elucidated, and simple Tiki cleavage is not sufficient to predict Tiki activity on individual Wnt (Zhang et al, 2016).

Our results further suggest that the Wnt3a amino terminal region may have an unexpected role in interacting with the FZD coreceptor LRP6. This role may have escaped detection because the deletion of this region results in misfolded Wnt proteins as oxidized oligomers (Zhang et al, 2012). In this study, we managed to produce monomeric Tiki‐cleaved Wnt3a from Wnt‐producing cells by coexpressing FZD7‐CRD and showed that this kind of Wnt3a no longer binds to and activates LRP6 (Fig 7). It was reported that the linker region between the amino terminal domain and the carboxyl terminal domain of Wnt3a is required for binding to LRP6 and activating Wnt/β‐catenin signaling (Chu et al, 2013). We are currently not sure whether the amino terminus of Wnt3a is directly involved in contacting LRP6 or controls the conformation of Wnt3a to expose its linker region that directly contacts LRP6. On the contrary, Tiki‐cleaved Wnt5a from Wnt‐producing cells is still active in inducing ROR1/2 phosphorylation (Fig 8), suggesting that the amino terminus of Wnt5a is dispensable for its activity and engagement with coreceptors ROR1/2. Both the amino terminal region and the linker region are less well conserved among Wnt family members and thus may determine the coreceptor and signaling specificity.

Materials and Methods

Plasmids

TIKI2N‐FLAG‐His, HA‐TIKI1, HA‐TIKI2, mouse Wnt3a and Wnt3a(C77A) were described previously (Zhang et al, 2012, 2016). The TIKI2‐H2A mutant was generated via a PCR‐based site‐directed mutagenesis method using an HA‐TIKI2 construct as the template as previously described (Zhang et al, 2016). HA‐Wnt3a and HA‐Wnt5a (an HA tag was inserted after the signal peptide) were generated by PCR and subcloned into pcDNA3.1 (Zhang et al, 2012). TIKI2‐miniTurbo plasmids were generated by inserting miniTurbo biotin ligase into the HA‐TIKI2 plasmid before the TIKI2 GPI ω‐site. GFP‐miniTurbo plasmids were generated by replacing the TIKI2‐miniTurbo extracellular domain with GFP. V5‐tagged full‐length FZD1‐10 and FC‐tagged FZD1‐10CRD were cloned into the pCS2+ vector. FZD5N‐GPI, FZD8N‐GPI, GumN‐GPI, and Afamin‐GPI were generated by replacing the TIKI2 extracellular domain with the indicated fragments and subcloned into the pCS2+ vector. V5‐FZD7‐miniTurbo plasmids were constructed by fusing miniTurbo biotin ligase to the C terminus of V5‐FZD7 and subcloned into the pCDH lentiviral vector. The plasmid containing sgTIKI2 was constructed in the lentiCRISPRv2 vector (sequence in the reagent). All plasmids were transformed into Escherichia coli DH5α (Vazyme) for amplification and extracted with a FastPure Plasmid Mini Kit (Vazyme).

Cell culture

HEK293 cells, HEK293T cells, HEK293A cells, U2OS cells, mouse fibroblast L‐cells (CRL‐2648), and L‐cells that stably expressed Wnt3A (ATCC, CRL‐2647) or Wnt5a cells (ATCC, CRL‐2814) were cultured in Dulbecco's modified Eagle's medium (DMEM; BOSTER) supplemented with 10% (v/v) FBS (Genial), 100 units/ml penicillin and 100 μg/ml streptomycin (BOSTER). HeLa cells were grown in minimum essential medium (MEM; BOSTER) supplemented with 10% (v/v) FBS (Genial), 100 units/ml penicillin, and 100 μg/ml streptomycin (BOSTER). All cells were grown in a humidified incubator at 37°C and 5% CO2.

Biotin labeling with miniTurbo and mass spectrometry

Biotin labeling was performed as previously described (Branon et al, 2018). HEK293 cells stably expressing GFP‐mTB or TIKI2‐mTB were cultured in DMEM with 10% FBS. Cells were labeled with 200 μm biotin for 6 h before harvest. Labeling was stopped by transferring the cells to ice and washing them with ice‐cold PBS. Cells were detached from the dishes by gently pipetting a stream of PBS directly onto the cells, and then, pellets were collected by centrifuging the resulting cell suspension at 500 × g for 3 min. Cell pellets were washed with PBS five times and lysed in 5 ml RIPA lysis buffer by gentle pipetting and incubating for 5 min at 4°C. Lysates were clarified by centrifugation at 14,000 × g for 10 min at 4°C. The supernatant of the lysates was incubated with 100 μl of NeutrAvidin agarose beads (Pierce) at 4°C with slow rotation for 16 h. The beads were subsequently washed twice with 1 ml of RIPA lysis buffer, once with 1 ml of 1 M KCl, once with 1 ml of 0.1 M Na2CO3, once with 1 ml of 2 M urea in 10 mM Tris–HCl pH 8.0, and twice with 1 ml RIPA lysis buffer. After enrichment, biotinylated proteins were eluted by boiling the beads in 120 μl of 2× protein loading buffer (125 mM Tris–HCl pH 6.8, 2% SDS, 10% glycerol) supplemented with 2 mM biotin. The eluted proteins were separated on SDS–PAGE gels and stained using a Silver Stain Kit (Beyotime) to ensure that the enrichment of biotinylated proteins was successful. Mass spectrum analysis was performed by Beijing Genomics Institute.

To examine the effects of TIKI2 on Wnt3a‐ or Wnt5a‐induced FZD7 interaction with LRP6 or ROR1/2. HEK293A cells stably expressing FZD7‐mTB or FZD7‐mTB together with TIKI2 were treated with Wnt3a or Wnt5a CM containing 200 μM biotin for 2 h. Cell lysates were obtained and then incubated with NeutrAvidin beads as described above, and eluted protein samples were analyzed by immunoblot.

Dual‐luciferase assay

The TOPFLASH reporter assay was performed as described previously (Zhang et al, 2016). Briefly, HEK293T cells were plated into 24‐well plates and transfected the following day with a total of 250 ng of DNA per well (100 ng of TOPFLASH, 5 ng of thymidine kinase promoter Renilla, 125 ng of pCS2+, and 20 ng of the indicated plasmids). The lysates were collected 36 h posttransfection after treatment for 6 h with Wnt3a‐containing medium and analyzed by a Dual‐Luciferase Reporter Kit (Vigorous Biotechnology).

Immunofluorescence

To detect Wnt protein binding on the cell surface in HEK293T cells, cells were seeded on 12‐well plates for 24 h. Then, FZD5 alone (coexpressed with mCherry) and TIKI2 with FZD5 (coexpressed with GFP) were transfected using VigoFect (Vigorous Biotechnology). Sixteen hours after transfection, GPF‐expressing cells and mCherry‐expressing cells were digested by trypsin and mixed at 1:1. Mixed cells were seeded on coverslips in a 24‐well plate for 24 h. After treatment with HA‐Wnt3a‐ or HA‐Wnt5a‐containing medium for 2 h, the cells were washed with PBS before fixation with 4% paraformaldehyde for 10 min at room temperature. After washing with PBS three times, the cells were blocked with blocking buffer (5% normal donkey serum in PBS) for 1 h at room temperature. Primary anti‐HA‐mouse (GNI4110‐HA) or anti‐V5‐rabbit (CST#13202) antibodies were used at 1:200 and 1:1,000, respectively, in blocking buffer and incubated overnight. Then, the coverslips were washed with PBS three times before incubation with secondary anti‐mouse Alexa555 (Beyotime) and anti‐rabbit Alexa647 (Beyotime) antibodies in blocking buffer for 1 h at room temperature. Cells were further washed with PBS three times and incubated with DAPI (Yeasen) for 5 min. Images were captured on an Olympus FV3000 confocal microscope.

Flow cytometry

FZD5 alone (coexpressed with GFP) or FZD5 and TIKI2 (coexpressed with GFP) were transfected into HEK293T cells. Thirty‐six hours after transfection, the cells were treated with HA‐Wnt3a‐containing medium for 2 h. After washing with PBS once, the samples were collected by gently pipetting a stream of PBS directly onto the cells. The cells were transferred into 1.5 ml Eppendorf tubes, and the cells were collected by centrifugation at 500 × g for 3 min at 4°C. Plated cells were blocked with blocking buffer (5% normal donkey serum in PBS) for 1 h on ice. After blocking, primary anti‐HA‐rabbit (CST#3724) or anti‐V5‐rabbit (CST#13202) antibodies were directly added to the cells at 1:1,000 and incubated on ice for 2 h. Primary antibodies were removed by centrifugation at 500 × g for 3 min at 4°C. Secondary anti‐rabbit Alexa647 (Beyotime) antibody was added to the cells at 1:400 in blocking buffer and incubated for 1 h on ice. After washing with PBS, the cells were stained with propidium iodide (PI) and then analyzed using a Beckman CytoFLEX flow cytometer. PI‐negative cells are displayed in histogram plots. Note that only GFP‐positive cells were considered desirable cells because they were successfully transfected.

Immunoblots

Cells were plated into 24‐well plates and transfected with the indicated plasmids the following day. Thirty‐six hours after transfection, the cells were treated with Wnt‐containing medium or soluble drugs before collection. After washing with PBS, cells were directly lysed with 2× protein loading buffer (125 mM Tris–HCl pH 6.8, 2% SDS, 10% glycerol, 0.004% bromophenol blue, 8% β‐mercaptoethanol), boiled for 5 min and separated by SDS–PAGE. Cytosolic proteins were extracted with 0.015% digitonin in PBS containing protease inhibitor. After proteins were transferred to PVDF membranes, samples were blocked in TBST buffer (10 mM Tris–HCl pH 7.5, 150 mM NaCl, 0.05% Tween‐20) with 5% nonfat dried milk for 1 h at room temperature and probed overnight at 4°C with primary antibodies. The PVDF membranes were washed three times and probed with anti‐rabbit or anti‐mouse peroxidase‐conjugated antibodies. After washing three times, the specific protein bands were visualized using the ECL‐immunoblotting chemiluminescence system (GE Healthcare Life Sciences).

For in vitro analysis, secretory proteins were expressed in HEK293T cells by transfection. Cells were refreshed 24 h after transfection. The secretory protein‐containing medium was collected for another 24 h and cleared by centrifugation at 10,000 × g for 5 min at 4°C. Then, the indicated secretory protein‐containing medium was mixed and incubated as described. After the complete reaction, 5× protein loading buffer was added to the medium and boiled before being pipetted into SDS–PAGE gels. The proteins were analyzed by immunoblots as described above.

The primary antibodies used in this study were purchased from the following company: Cell Signaling Technology: HA (#3724, 1:1,000), Wnt3a (#2721), Wnt5a/b (#2530), V5 (#13202), phospho‐LRP6 (#2568), LRP6 (#2560), ROR1 (#16540), and DVL2 (#3224). Santa Cruz Biotechnology: ROR2 (H‐1), MYC (9E10). GNI Group: HA (GNI4110‐HA), FLAG (GNI4110‐FG). Beyotime: IgG (H + L)‐HRP (A0201), Streptavidin‐HRP (A0303). ABclonal: β‐actin (AC026), β‐tubulin (AC015). Proteintech: β‐catenin (51067‐2‐AP). TIKI2 mouse monoclonal antibody was generated with the purified TIKI2N protein from a conditioned medium of transfected HEK293T cells, and this antibody could only detect overexpressed TIKI2.

Immunoprecipitation

To examine the potential interaction between TIKI and the Wnt‐FZD complex. The indicated secretory protein‐containing medium was mixed and incubated at 4°C overnight. The mixtures were immunoprecipitated with rProtein G beads for 16 h at 4°C with slow rotation. Then, the beads were transferred into a new tube after washing with PBS buffer five times, and the proteins on the beads were eluted with 2× protein loading buffer. Immunoblot analysis was performed as described above.

To examine wild‐type Wnt3a or Tiki‐cleaved Wnt3a in mediating the FZD7CRD and LRP6N interaction in vitro, HEK293T cells were transfected with control (Con), Wnt3a (Wnt3a), Wnt3a plus TIKI2 (Wnt3a + TIKI2), Wnt3a plus FZD7CRD (Wnt3a + FZD7CRD), Wnt3a plus FZD7CRD and TIKI2 (Wnt3a + FZD7CRD + TIKI2) plasmids. The secretory protein‐containing medium was purified by rProtein G beads for 16 h at 4°C with slow rotation. The beads were then washed three times with PBS containing 0.2% NP40 and incubated with equal volumes of LRP6N medium for 16 h at 4°C with slow rotation. The beads were transferred into a new tube after washing six times with PBS containing 0.2% NP40, and the bound proteins were eluted with 2× protein loading buffer. The eluted proteins were then analyzed by immunoblotting.

Quantitative RT–PCR

Total RNA was isolated from cells using RNA‐easy Isolation Reagent (Vazyme) according to the manufacturer's protocol. First‐strand cDNA was prepared from 1 μg of total RNA using HiScript III RT SuperMix (Vazyme). AceQ qPCR SYBR Green Master Mix (Vazyme) was used to amplify TIKI1 or TIKI2 and normalized to ACTB in a CFX96 real‐time system qRT–PCR machine (Bio‐Rad). The data were analyzed as described previously (Zhang et al, 2012).

Lentivirus packaging and generation of a stable cell line

HEK293T cells were seeded on 6 mm dishes and transfected with a total of 2 μg plasmid composed of 1 μg transfer vector, 750 ng psPAX2, and 250 ng pMD2.G 24 h later. The day after transfection, the cells were refreshed with DMEM containing 10% FBS. Virus‐containing medium was collected 48 h after refreshment and clarified by centrifugation at 12,000 × g for 15 min. Virus‐containing medium was divided into Eppendorf tubes and stored at −80°C before use.

To generate stable cell lines, wild‐type cells were seeded on 6 mm dishes, and a virus‐containing medium mixed with fresh medium was added to the cells 24 h later in the presence of 8 μg/ml polybrene. Forty‐eight hours after infection, the medium was refreshed with 2 μg/ml puromycin to screen resistant cells. After uninfected cells were completely eliminated by antibiotics, they were maintained with a common medium without antibiotics, and the following experiments were performed.

Generation of U2OS TIKI2 knockout cells

U2OS cells were infected with lentivirus encoding guide RNAs (GTCCAGCTCAAAGTAGACAC) targeting exon 2 of TIKI2. Forty‐eight hours after infection, the cells were cultured in a medium containing 2 μg/ml puromycin for the selection of infected cells. Monoclonal cell populations were isolated in 96‐well plates by limiting dilution. To screen for TIKI2 KO cells, genomic DNA was isolated, and sgRNA target regions were PCR amplified and sequenced. PCR products that showed multiple peaks around the target site in the chromatogram were then subcloned into the pUC19 vector. Individual colonies were sequenced to verify frameshift indels.

Statistical analysis

All experiments were repeated at least three times to ensure the reproducibility of the results. The significance of differences was determined using the Student's t‐test, and a P value < 0.01 was considered significant.

Author contributions

This project was conceived and initiated by Xinjun Zhang and Xi He when Xinjun Zhang was a postdoctoral fellow in Xi He's laboratory and was finished by Mingyi Li, Jing Zheng and Dong Luo in Xinjun Zhang's laboratory. Mingyi Li: Data curation; validation; investigation; methodology; writing – original draft. Jing Zheng: Data curation; validation; investigation; methodology. Dong Luo: Data curation; validation; investigation; methodology. Kai Xu: Resources; project administration. Ren Sheng: Resources; methodology. Bryan T MacDonald: Writing – review and editing. Xi He: Resources; supervision; funding acquisition; writing – review and editing. Xinjun Zhang: Conceptualization; data curation; supervision; funding acquisition; investigation; visualization; methodology; writing – original draft; writing – review and editing.

Disclosure and competing interests statement

The authors declare that they have no conflict of interest.

Supporting information

Expanded View Figures PDF

Click here for additional data file. (4.5MB, pdf)

Source Data for Expanded View

Click here for additional data file. (469.4KB, zip)

PDF+

Click here for additional data file. (12.2MB, pdf)

Source Data for Figure 1

Click here for additional data file. (2.9MB, pdf)

Source Data for Figure 2

Click here for additional data file. (1.2MB, pdf)

Source Data for Figure 3

Click here for additional data file. (735.1KB, pdf)

Source Data for Figure 4

Click here for additional data file. (1.2MB, pdf)

Source Data for Figure 5

Click here for additional data file. (2MB, pdf)

Source Data for Figure 6

Click here for additional data file. (1.1MB, pdf)

Source Data for Figure 7

Click here for additional data file. (1.2MB, pdf)

Source Data for Figure 8

Click here for additional data file. (1MB, pdf)

Acknowledgements

This work was supported by a grant from the National Natural Science Foundation of China (81870620 to XZ), by the Fundamental Research Funds for the Central Universities, HUST (2021GCRC033 to XZ), by start funding from Sichuan Provincial People's Hospital (to XZ), and by the National Institutes of Health (R01GM57603 (completed) and R35GM134953/MIRA to XH).

EMBO reports (2023) 24: e55873

Data availability

The mass spectrometry data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD040942 (https://www.ebi.ac.uk/pride/archive/projects/PXD040942).

References

  1. Bazan JF, Macdonald BT, He X (2013) The TIKI/TraB/PrgY family: a common protease fold for cell signaling from bacteria to metazoa? Dev Cell 25: 225–227 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Branon TC, Bosch JA, Sanchez AD, Udeshi ND, Svinkina T, Carr SA, Feldman JL, Perrimon N, Ting AY (2018) Efficient proximity labeling in living cells and organisms with TurboID. Nat Biotechnol 36: 880–887 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Chen B, Dodge ME, Tang W, Lu J, Ma Z, Fan CW, Wei S, Hao W, Kilgore J, Williams NS et al (2009) Small molecule‐mediated disruption of Wnt‐dependent signaling in tissue regeneration and cancer. Nat Chem Biol 5: 100–107 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chu ML, Ahn VE, Choi HJ, Daniels DL, Nusse R, Weis WI (2013) Structural studies of Wnts and identification of an LRP6 binding site. Structure 21: 1235–1242 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Clevers H, Loh KM, Nusse R (2014) Stem cell signaling. An integral program for tissue renewal and regeneration: Wnt signaling and stem cell control. Science 346: 1248012 [DOI] [PubMed] [Google Scholar]
  6. Cruciat CM, Niehrs C (2013) Secreted and transmembrane wnt inhibitors and activators. Cold Spring Harb Perspect Biol 5: a015081 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Gross JC, Chaudhary V, Bartscherer K, Boutros M (2012) Active Wnt proteins are secreted on exosomes. Nat Cell Biol 14: 1036–1045 [DOI] [PubMed] [Google Scholar]
  8. Grumolato L, Liu G, Mong P, Mudbhary R, Biswas R, Arroyave R, Vijayakumar S, Economides AN, Aaronson SA (2010) Canonical and noncanonical Wnts use a common mechanism to activate completely unrelated coreceptors. Genes Dev 24: 2517–2530 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Hao HX, Xie Y, Zhang Y, Charlat O, Oster E, Avello M, Lei H, Mickanin C, Liu D, Ruffner H et al (2012) ZNRF3 promotes Wnt receptor turnover in an R‐spondin‐sensitive manner. Nature 485: 195–200 [DOI] [PubMed] [Google Scholar]
  10. Hirai H, Matoba K, Mihara E, Arimori T, Takagi J (2019) Crystal structure of a mammalian Wnt‐frizzled complex. Nat Struct Mol Biol 26: 372–379 [DOI] [PubMed] [Google Scholar]
  11. Janda CY, Waghray D, Levin AM, Thomas C, Garcia KC (2012) Structural basis of Wnt recognition by frizzled. Science 337: 59–64 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Jiang X, Cong F (2016) Novel regulation of Wnt signaling at the proximal membrane level. Trends Biochem Sci 41: 773–783 [DOI] [PubMed] [Google Scholar]
  13. Kaiser K, Gyllborg D, Prochazka J, Salasova A, Kompanikova P, Molina FL, Laguna‐Goya R, Radaszkiewicz T, Harnos J, Prochazkova M et al (2019) WNT5A is transported via lipoprotein particles in the cerebrospinal fluid to regulate hindbrain morphogenesis. Nat Commun 10: 1498 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Kakugawa S, Langton PF, Zebisch M, Howell S, Chang TH, Liu Y, Feizi T, Bineva G, O'Reilly N, Snijders AP et al (2015) Notum deacylates Wnt proteins to suppress signalling activity. Nature 519: 187–192 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Kim DI, Roux KJ (2016) Filling the void: proximity‐based labeling of proteins in living cells. Trends Cell Biol 26: 804–817 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Kim SE, Huang H, Zhao M, Zhang X, Zhang A, Semonov MV, MacDonald BT, Zhang X, Garcia Abreu J, Peng L et al (2013) Wnt stabilization of beta‐catenin reveals principles for morphogen receptor‐scaffold assemblies. Science 340: 867–870 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Korkut C, Ataman B, Ramachandran P, Ashley J, Barria R, Gherbesi N, Budnik V (2009) Trans‐synaptic transmission of vesicular Wnt signals through Evi/Wntless. Cell 139: 393–404 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Li M, Zheng J, He X, Zhang X (2022) Tiki proteins are glycosylphosphatidylinositol‐anchored proteases. FEBS Lett 596: 1037–1046 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. MacDonald BT, He X (2012) Frizzled and LRP5/6 receptors for Wnt/beta‐catenin signaling. Cold Spring Harb Perspect Biol 4: a007880 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. MacDonald BT, Tamai K, He X (2009) Wnt/beta‐catenin signaling: components, mechanisms, and diseases. Dev Cell 17: 9–26 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Mattes B, Dang Y, Greicius G, Kaufmann LT, Prunsche B, Rosenbauer J, Stegmaier J, Mikut R, Ozbek S, Nienhaus GU et al (2018) Wnt/PCP controls spreading of Wnt/beta‐catenin signals by cytonemes in vertebrates. Elife 7: e36953 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. McGough IJ, Vecchia L, Bishop B, Malinauskas T, Beckett K, Joshi D, O'Reilly N, Siebold C, Jones EY, Vincent JP (2020) Glypicans shield the Wnt lipid moiety to enable signalling at a distance. Nature 585: 85–90 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Mihara E, Hirai H, Yamamoto H, Tamura‐Kawakami K, Matano M, Kikuchi A, Sato T, Takagi J (2016) Active and water‐soluble form of lipidated Wnt protein is maintained by a serum glycoprotein afamin/alpha‐albumin. Elife 5: e11621 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Mulligan KA, Fuerer C, Ching W, Fish M, Willert K, Nusse R (2012) Secreted wingless‐interacting molecule (swim) promotes long‐range signaling by maintaining wingless solubility. Proc Natl Acad Sci USA 109: 370–377 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Nusse R, Clevers H (2017) Wnt/beta‐catenin signaling, disease, and emerging therapeutic modalities. Cell 169: 985–999 [DOI] [PubMed] [Google Scholar]
  26. Panakova D, Sprong H, Marois E, Thiele C, Eaton S (2005) Lipoprotein particles are required for hedgehog and wingless signalling. Nature 435: 58–65 [DOI] [PubMed] [Google Scholar]
  27. Reis AH, Macdonald B, Feistel K, Brito JM, Amado NG, Xu C, Abreu JG, He XI (2014) Expression and evolution of the Tiki1 and Tiki2 genes in vertebrates. Int J Dev Biol 58: 355–362 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Rim EY, Clevers H, Nusse R (2022) The Wnt pathway: from signaling mechanisms to synthetic modulators. Annu Rev Biochem 91: 571–598 [DOI] [PubMed] [Google Scholar]
  29. Steinhart Z, Angers S (2018) Wnt signaling in development and tissue homeostasis. Development 145: dev146589 [DOI] [PubMed] [Google Scholar]
  30. Stricker S, Rauschenberger V, Schambony A (2017) ROR‐family receptor tyrosine kinases. Curr Top Dev Biol 123: 105–142 [DOI] [PubMed] [Google Scholar]
  31. Sun Y, Wang W, Zhao C (2021) Frizzled receptors in tumors, focusing on signaling, roles, modulation mechanisms, and targeted therapies. Oncol Res 28: 661–674 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. van Amerongen R (2012) Alternative Wnt pathways and receptors. Cold Spring Harb Perspect Biol 4: a007914 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Wang Y, Chang H, Rattner A, Nathans J (2016) Frizzled receptors in development and disease. Curr Top Dev Biol 117: 113–139 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Willert K, Brown JD, Danenberg E, Duncan AW, Weissman IL, Reya T, Yates JR III, Nusse R (2003) Wnt proteins are lipid‐modified and can act as stem cell growth factors. Nature 423: 448–452 [DOI] [PubMed] [Google Scholar]
  35. Yamamoto H, Yoo SK, Nishita M, Kikuchi A, Minami Y (2007) Wnt5a modulates glycogen synthase kinase 3 to induce phosphorylation of receptor tyrosine kinase Ror2. Genes Cells 12: 1215–1223 [DOI] [PubMed] [Google Scholar]
  36. Zhang X, Abreu JG, Yokota C, MacDonald BT, Singh S, Coburn KL, Cheong SM, Zhang MM, Ye QZ, Hang HC et al (2012) Tiki1 is required for head formation via Wnt cleavage‐oxidation and inactivation. Cell 149: 1565–1577 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Zhang X, Cheong SM, Amado NG, Reis AH, MacDonald BT, Zebisch M, Jones EY, Abreu JG, He X (2015) Notum is required for neural and head induction via Wnt deacylation, oxidation, and inactivation. Dev Cell 32: 719–730 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Zhang X, MacDonald BT, Gao H, Shamashkin M, Coyle AJ, Martinez RV, He X (2016) Characterization of Tiki, a new family of Wnt‐specific metalloproteases. J Biol Chem 291: 2435–2443 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Expanded View Figures PDF

    Click here for additional data file. (4.5MB, pdf)

    Source Data for Expanded View

    Click here for additional data file. (469.4KB, zip)

    PDF+

    Click here for additional data file. (12.2MB, pdf)

    Source Data for Figure 1

    Click here for additional data file. (2.9MB, pdf)

    Source Data for Figure 2

    Click here for additional data file. (1.2MB, pdf)

    Source Data for Figure 3

    Click here for additional data file. (735.1KB, pdf)

    Source Data for Figure 4

    Click here for additional data file. (1.2MB, pdf)

    Source Data for Figure 5

    Click here for additional data file. (2MB, pdf)

    Source Data for Figure 6

    Click here for additional data file. (1.1MB, pdf)

    Source Data for Figure 7

    Click here for additional data file. (1.2MB, pdf)

    Source Data for Figure 8

    Click here for additional data file. (1MB, pdf)

    Data Availability Statement

    The mass spectrometry data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD040942 (https://www.ebi.ac.uk/pride/archive/projects/PXD040942).

    Articles from EMBO Reports are provided here courtesy of Nature Publishing Group

    RESOURCES