Mulberry leaf extract reduces abdominal fat deposition via adenosine-activated protein kinase/sterol regulatory element binding protein-1c/acetyl-CoA carboxylase signaling pathway in female Arbor Acre broilers

Abstract

This experiment was carried out to investigate the mechanism of action of mulberry leaf extract (MLE) in reducing abdominal fat accumulation in female broilers. A total of 192 one-day-old female Arbor Acres (AA) broilers were divided into 4 diet groups, with each group consisting of 8 replicates with 6 birds per replicate. The diets contained a basal diet and 3 test diets with supplementation of 400, 800, or 1,200 MLE mg/kg, respectively. The trial had 2 phases that lasted from 1 to 21 d and from 22 to 56 d, respectively. The growth performance, abdominal fat deposition, fatty acid composition, serum biochemistry and mRNA expression of genes related to fat metabolism in liver were determined. The results showed that, 1) dietary supplementation with MLE had no significant impact on broilers final body weight, average daily gain (ADG), or feed to gain ration (F/G) (P > 0.05), but linearly reduced abdominal fat accumulation in both experimental phases (P < 0.05); 2) the total contents of monounsaturated fatty acids (MUFA) and polyunsaturated fatty acids (PUFA), such as palmitoleic acid, oleic acid, and eicosadienoic acid, were increased quadratically as a result of dietary supplements of 400, 800, and 1,200 mg/kg MLE (P < 0.01), while the total contents of saturated fatty acids (SFA), such as teracosanoic acid were decreased (P < 0.01); 3) the addition of 800 or 1,200 MLE mg/kg to the diet linearly reduced total cholesterol (TC) in the serum and liver (P < 0.05). Adenosine-activated protein kinase (AMPK) mRNA expression in the liver was quadratically increased by the addition of 800 or 1,200 MLE mg/kg to the diet (P < 0.05), and the mRNA expression of sterol regulatory element binding protein-1c (SREBP-1c), acetyl-CoA carboxylase (ACC), and acetyl-CoA carboxylate), fatty acid synthase (FAS) were linearly decreased (P < 0.05). In conclusion, MLE can be employed as a viable fat loss feed supplement in fast-growing broiler diets since it reduces abdominal fat deposition in female AA broilers via the AMPK/SREBP-1c/ACC signaling pathway. MLE can also be utilized to modify the fatty acid profile in female broilers (AA) at varied inclusion levels.

INTRODUCTION

Excessive abdominal fat accumulation in broilers is a typical condition, and it reduces meat quality and economic value (Fouad, 2014). As a result, developing feed additives that reduce fat deposition will have a substantial impact on broilers productivity. The mulberry plant is a common crop in southern China (Jian, 2021; Semjon et al., 2020). Mulberry leaf extract (MLE) is made from the plant's leaves and contains a variety of bioactive substances, such as phenols, flavonoids, alkaloids, amino acids, polysaccharides, and steroid compounds. MLE can lower blood sugar and hepatic fat levels as well as have antioxidant and anti-inflammatory effects (He, 2018; Thaipitakwong, 2018). Ding et al. (2021) found that including 3% fermented mulberry leaf in broiler diet boosted breast muscle yield, decreased abdominal fat ratio, and improved slaughter performance. MLE has been found to lower oxidative stress, activate antioxidant enzyme activities, and improve growth performance in broilers when raised under stress conditions (So-In, 2022). However, Cai et al. (2019) found that using mulberry leaf (ML) up to 2 g/kg BW did not have any effect on SD rats. The flavonoids and 1-deoxynojirimycin (DNJ), one of its specific alkaloids’ components, play a significant role in regulating glucolipid metabolism. It can also effectively suppress glycosidase enzymes, fat metabolism, and amino acid metabolism, or treat liver diseases by reducing the excessive accumulation of cholesterol in both living and in vitro systems (Hu, 2020; Du et al., 2022). Fat deposition was linked to its production, breakdown, and transport, and the regulating mechanism is intimately connected in the AMPK or PPAR signaling pathways (Uchiyama et al., 2018; Li, 2019). However, few studies on broilers abdominal fat accumulation and the effects of MLE on fat metabolism and its mechanism in chickens have been conducted. Therefore, the purpose of this study was to evaluate the effects of MLE on abdominal fat deposition in broilers and to better understand the mechanism of MLE in reducing abdominal fat deposition.

MATERIALS AND METHODS

Animal Ethics

All procedures involving live birds handling, management, and health care followed the regulations of laboratory animals used for scientific purposes and were implemented within the Hunan Agricultural University Animal Care and Use Committee.

Experimental Materials

MLE was supplied by Hunan Jinghan Co., Ltd. (Changsha, China) (Production No. MD 0.5-200519). The following are the key functional components and content: Piperidine alkaloid DNJ 0.5%, total flavonoids are approximately 20%, polysaccharide is approximately 5%, total phenols are approximately 25%, total protein is approximately 30%, crude fat is approximately 2.5%, ash is approximately 15%, water is approximately 1.2%, crude fiber is approximately 0.5%, and other components are approximately 0.3%.

Animals and Experimental Design

A total of 192 one-day-old female Arbor Acres (AA) birds were randomly assigned to cages, each of which had 8 replicates with 6 birds per replicate. The diets consisted of a basal diet and 3 test diets supplemented with 0, 400, 800, or 1,200 MLE mg/kg. All of the birds were kept in battery cages with 12 h of lighting each day, and an ambient temperature of 26°C ± 1°C and relative humidity of 65 to 70% were maintained. The feed is in the form of mash. The experiment lasted for 56 d and was divided into 2 phases: 1 to 21 d and 22 to 56 d. The feed formulation and nutrients composition of the basal diets are shown in Table 1. Table 2 shows the bioactive component of the treatment diets.

Table 1.

Feed formula and nutrients composition of the basal diets (air-dry basis) %.

Items	1–21 d	22–42 d
Ingredients
Corn	60.62	64.98
Soybean meal	31.70	25.82
Fish meal	1.50	2.28
Soybean oil	2.17	3.22
DL-Methionine	0.18	0.10
CaHPO4	1.38	1.09
Limestone	1.15	1.21
NaCl	0.30	0.30
Premix1	1.00	1.00
Total	100.00	100.00
Calculated nutrient content2
ME/(kcal/kg)	2997	3097
CP	21.50	19.50
Lysine·HCl	1.17	1.02
DL-Methionine	0.53	0.43
Ca	1.00	0.95
AP	0.45	0.40
Digestible amino acids composition, g/kg
Arg	13.90	13.41
His	5.32	4.92
Ile	7.94	7.86
Leu	15.16	16.08
Lys	10.83	10.54
Met	3.17	3.11
Met + Cys	6.52	6.53
Phe	9.55	8.82
Phe + Tyr	16.58	15.09
Thr	7.12	6.46
Try	2.55	2.44
Val	9.31	8.90

¹The premix provided the following per kg of diet: Cu 9 mg, Fe 80 mg, Mn 80 mg, Zn 100 mg, I 0.4 mg, Se 0.20 mg, Co 0.40 mg, I 0.40 mg, VA 8,000 IU, VD 2,500 IU, VE 20 IU, VB₁ 2.50 mg, VB₆ 2.80 mg, VB₂ 8.0 mg, VB₁₂ 15 μg, nicotinic acid 35 mg, folic acid 0.10 mg, pantothenic acid 12 mg.

²CP was a measured value, while the others were calculated values.

Table 2.

The bioactive compounds of treatment diets.

	MLE supplementation to test diets/(mg/kg)
Items	400	800	1,200
DNJ	2.0	4.0	6.0
Total flavonoids	80.0	160.0	240.0
Polysaccharide	20.0	40.0	60.0
Total phenols	100.0	200.0	300.0
Total protein	120.0	240.0	360.0
Crude fat	10.0	20.0	30.0
Ash	60.0	120.0	180.0
Water	4.8	9.6	14.4
Crude fiber	2.0	4.0	6.0
Other components	1.2	2.4	3.6

Abbreviation: DNJ, 1-deoxynojirimycin.

Sample Collection and Measurements

All birds' body weights were measured on the 21st and 56th d of the experiment. Then, the average daily feed intake (ADFI), average daily weight gain (ADG), ratio of feed to weight gain (F: G) for entire experimental period were calculated. One bird per replicate was slaughtered, and blood, abdominal fat, liver, breast, and leg muscle samples were taken for analysis.

The abdominal fat deposition for broilers was represented by the ratio of abdominal fat weight (g) to bird's body weight (kg). The serum samples were analyzed for the biochemical indicators using an automatic biochemical analyzer (Mairui BS, Shanghai, China). Total cholesterol (TC), triglyceride (TG), glucose (GLU), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) were the measuring indices for the liver and blood. Nanjing Jingcheng Institute of Biological Engineering (Nanjing , China) provided the kits. The fatty acid content and ether extract (EE) of freeze-dried breast and leg muscle were determined using the methods of National Food Safety Standards GB5009.168-2016 and GB5009.6-2016.

Real-Time PCR

The liver mRNA was extracted and the detailed procedures outlined by Liu et al. (2016) for total RNA isolation, reverse transcription, cDNA synthesis, and quantitative real-time PCR analysis were followed. Briefly, TRIzol Reagent (Invitrogen-Life Technologies, Carlsbad, CA) was used to extract total RNA from samples (approximately 100 mg). RNA was measured using 1% agarose gel electrophoresis and a staining solution containing 10 ug/mL ethidium bromide. RNA was quantified to have an optical density (OD)₂₆₀-to-OD₂₈₀ ration between 1.8 and 2.0. The first-strand cDNA was then produced in accordance with the manufacturer's instructions. Primer 5.0 software (Premier Biosoft International, Palo Alto, CA) was used to create primers for the chosen gene (Table 3).

Table 3.

Primer sequences in fluorescence quantitative PCR reaction.

Primer name	Sequences of the primer pair1	Fragment length (bp)	GenBank no.
ACC	F:GCTGGGTTGAGCGACTAATG	170	NM_205505
	R:AAACTGGCAAAGGACTGACG
CPT-1α	F:GCCACTTATGAATGATGAGGAG	174	NM_001012898.1
	R:ATTATTGGTCCACGCCCTC
FAS	F:TGAAGGACCTTATCGCATTGC	96	NM_205155
	R:GCATGGGAAGCATTTTGTTGT
SREBP-1c	F:GTCGGCGATCCTGAGGAA	105	XM_046927256.1
	R:CTCTTCTGCACGGCCATCTT
PPARα	F:CAAACCAACCATCCTGACGAT	64	XM_046906390.1
	R:GGAGGTCAGCCATTTTTTGGA
AMPKα	F:GATATTTGGAGCAGTGGGGTTA	248	NM_001039603
	R:GGAAACAAGTATTTGGGAAGGT
ACO	F:TGCTGGTATTGAGGAATGTCG	96	NM_001006205.1
	R:CAGGATGGGGTGAACGTGA
LPL	F:TGGACAGATGGACAGCTTGG	148	NM_205282.1
	R:ATTTGAATCAGGTTCCCTCTTG
FABP	F:TCCAGAAGGGTAAGGACATCA	224	NM_204192.3
	R:TTGAGTTCGGTCACGGATTT
β-actin	F:TGCGTGACATCAAGGAGAAG	300	NM_205518.2
	R:TGCCAGGGTACATTGTGGTA

¹The primers were designed using Primer Expression software Primer Premier 5.

Abbreviations: ACC, acetyl-coA carboxylase; ACO, lipoyl-coa oxidase; AMPKα, adenosine monophosphate-activated protein kinase; CPT-1α, carnitine palmityl transferase; FABPs, fatty acid binding protein; FAS, fatty acid synthase; LPL, lipoprotein decomposition enzyme; PPAR_α, peroxisome proliferator activated receptor; SREBP-1c, sterol regulatory element binding protein-1c.

Acetyl-coA carboxylase (ACC), fatty acid synthase (FAS), sterol regulatory element binding protein-1c (SREBP-1c), carnitine palmityl transferase (CPT), lipoyl-coa oxidase (ACOX), lipoprotein decomposition enzyme (LPL), fatty acid binding protein (FABP), adenosine monophosphate-activated protein kinase (A) MPK, peroxisome proliferator activated receptor (PPARs) primers were designed using broilers CDS conserved sequences (Liu, 2019). Primers were synthesized by Shanghai Biochemical Technology Company, and the β-actin (Gene ID: NM 031144) was defined as the reference gene. We calculated the relative expression ration (R) of mRNA using R = 2 ^{−△△Ct (sample - control)}, where −△△Ct (sample − control) = (Ct βactin) for the sample − (Ct gene of interest − Ctβactin) for the control (Livak and Schmittgen, 2001).

Calculations and Statistical Analysis

ANOVA of Statistical Packages for Social Science 18.0 (SPSS18.0) software was used to test the date between the 4 treatment groups, and orthogonal polynomial contrasts were used to evaluate the linear and quadratic effects of increasing dietary mulberry inclusion on the detected traits in the experimental birds. Probability (P) values <0.05 were considered to be significant, and 0.05 < P < 0.10 were considered to indicate trends.

RESULTS

Effects of MLE on Growth Performance of Broilers

The effects of MLE on the growth performance of broilers are shown in Table 4, which demonstrates that for the entire experimental period, the 3 levels of MLE addition to the diet had no significant influence on ADFI, ADG, and F/G of broilers (P > 0.05).

Table 4.

Effects of MLE on growth performance of broilers.

Items	Supplementation of MLE on diet (mg/kg)					P value
	0	400	800	1,200	SEM	ANOVA	Linear	Quadratic
3–21 d
Initial weight/g (3 d)	71.04	71.03	71.04	71.03	1.97	1.000	0.335	0.598
BW at d 21/g	630.31	621.77	615.10	602.51	1.83	0.877	0.150	0.320
ADFI/g	52.76	51.56	50.68	49.54	1.17	0.052	0.07	0.705
ADG/g	32.26	31.25	30.60	29.53	1.48	0.332	0.165	0.331
F/G	1.64	1.65	1.65	1.68	0.07	0.524	0.781	0.264
22–42 d
Final weight	2392.07	2371.94	2303.51	2278.38	5.88	0.354	0.983	1.152
ADFI/g	138.74	138.59	134.7	132.56	1.23	0.298	0.06	0.689
ADG/g	88.52	88.47	83.16	83.66	1.46	0.202	0.162	0.325
F/G	1.66	1.60	1.57	1.53	0.08	0.536	0.866	0.291
42–56 d
Final weight	3104.33	3053.33	2958.33	2953.61	16.7	0.217	0.44	0.62
ADFI/g	130.69	111.94	116.46	112.86	3.63	0.185	0.046	0.995
ADG/g	58.87	48.67	46.77	48.23	2.34	0.103	0.017	0.602
F/G	2.22	2.30	2.49	2.34	0.07	0.381	0.307	0.522
3–56 d
ADFI/g	106.68	103.76	103.37	100.22	2.61	0.138	0.082	0.949
F/G	1.84	1.84	1.90	1.85	0.04	0.214	0.429	0.243

Abbreviations: ADFI, average daily feed intake; ADG, average daily weight gain; F/G, ratio of feed to weight gain.

Effects of MLE on Abdominal Fat Deposition of Broilers

The effect of MLE on broilers abdominal fat deposition is shown in Table 5. During the 2 experimental periods, 3 levels of MLE addition to the feed linearly reduced abdominal fat deposition in broilers (P > 0.001), with the addition of 1,200 mg/kg MLE reducing abdominal fat deposition by 44.15% compared to the control treatment at 56 d.

Table 5.

Effects of MLE addition to diet on abdominal fat deposition of broilers, g/kg BW.

Days of age	Supplementation of MLE on diet (%)					P value
	0	400	800	1,200	SEM	ANOVA	Linear	Quadratic
21 d	1.22a	0.79b	0.82b	0.80b	0.020	<0.001	<0.001	0.002
56 d	1.54a	1.08b	0.99b	0.86b	0.003	0.003	0.001	0.017

^a,bWith a row, values with different superscript letters differ (P < 0.05). n = 6.

Effects of MLE on Fatty Acid Composition of Breast

Table 6 demonstrates that supplementing the diet with 400, 800, and 1,200 mg/kg MLE linearly increased the total contents of MUFA and PUFA, including palmitoleic acid, oleic acid, eicosadienoic acid, eicosaenoic acid, eicosapenoic acid, and docosahexaenoic acid (P < 0.01), while linearly and quadratically decreasing the total contents of SFA, including teracosanoic acid (P < 0.01). MLE had no influence on the contents of other fatty acids in the breast of broilers (P > 0.05).

Table 6.

Effects of MLE on fatty acid composition of breast for AA broilers on 42 d (%, dry matter basis).

Items	MLE supplementation to diet/(mg/kg)					P value
	0	400	800	1,200	SEM	ANOVA Linear Quadratic
Myristic acid C14:0	0.34	0.31	0.32	0.33	0.00	0.545	0.648	0.241
Palmitic acid C16:0	22.33a	21.43b	21.20b	19.43c	1.33	0.159	<0.001	<0.01
Palmitoleic acid C16:1	0.37B	0.43B	0.68A	0.69A	0.15	<0.01	<0.001	<0.01
Daturic acid C17:0	0.25a	0.24a	0.22b	0.21b	0.02	<0.122	<0.001	<0.007
Stearic acid C18:0	20.00a	18.60b	18.40b	16.47c	1.47	0.061	<0.001	<0.006
Oleic acid C18:1n9c	13.60B	13.73B	15.70B	20.27A	2.8	<0.01	<0.001	<0.001
Linoleic acid C18:2n6c	18.97	20.93	22.00	23.63	2.1	0.134	<0.001	0.337
Linolenic acid C18:3n3	1.29	1.32	1.25	1.35	0.05	0.325	<0.040	<0.076
Eicosadienoic acid C20:2	1.29C	1.65B	1.94Aa	2.13Ab	0.33	<0.01	<0.001	<0.061
Eicostrienoic acid C20:3n6	1.00Ba	1.21Bb	1.48A	1.57A	0.23	<0.01	<0.001	<0.016
Eicosatetraenoic acid C20:4n6	10.30B	13.90A	14.50A	14.80A	1.95	<0.01	<0.001	<0.074
Teracosanoic acid C24:0	1.25A	1.16A	0.99Ba	0.62Bb	0.24	<0.01	<0.001	<0.074
Docosahexenoic acid C22:6n3	4.18Aa	5.21Ab	5.16Ab	6.45B	0.84	<0.01	<0.001	<0.096
Saturated fatty acids, SFA1	44.17Aa	41.74Ab	41.13Ab	37.06B	2.73	<0.01	<0.001	<0.010
Monounsaturated fatty acids MUFA2	13.97B	14.16B	16.38B	20.96A	2.91	<0.01	<0.010	<0.001
Polyunsaturated fatty acidsPUFA3	37.02B	44.21Ab	46.33Ab	49.94Aa	5.03	<0.01	<0.001	<0.001

¹SFA = saturated fatty acids; it includes the total contents of myristic acid, palmitic acid, daturic acid, stearic acid, teracosanoic acid.

²MUFA = monounsaturated fatty acids, it includes the total contents of palmitoleic acid, oleic acid.

³PUFA = polyunsaturated fatty acids; it includes the total contents of linoleic acid, linolenic acid, eicosadienoic acid, eicostrienoic acid, eicosatetraenoic acid, docosahexaenoic acid.

^a,bWith a row, values with different superscript letters differ (P < 0.05). n = 6.

^A,BWith a row, values with different superscript letters differ (P < 0.01). n = 6.

Effects of MLE on Crude EE of Breast and Leg Muscle Content for AA Broilers

As demonstrated in Table 7, nutritional supplementation with 400, 800, and 1,200 mg/kg MLE reduced crude fat content linearly (P < 0.001); additionally, 800 and 1,200 mg/kg reduced crude fat content quadratically in AA broilers breast and leg muscle at 21 d of age (P < 0.01). Among various treatments, the addition of 1,200 mg/kg MLE to the diet has the largest fat reduction benefits both in the breast and leg muscle.

Table 7.

Effects of MLE on weight and crude ether extract (EE) content of breast and leg muscle for AA broilers %.

Days of age	MLE supplementation to diet/(mg/kg)					P value
	0	400	800	1,200	SEM	ANOVA	Linear	Quadratic
21 d
Breast weight, g	222.22b	214.41b	215.91b	239.80a	8.253	0.049	0.051	0.013
Leg muscle weight, g	163.40	156.61	149.80	151.44	8.39	0.386	0.123	0.485
EE of breast muscle, %	3.84A	3.79A	3.09B	2.99B	<0.188	<0.001	<0.001	0.853
EE of leg muscle, %	9.67Aa	8.98Ab	8.47Bb	6.21A	<0.503	<0.001	<0.001	0.039
42 d
Breast weight, g	565.75	527.85	526.84	514.27	29.341	0.353	0.109	0.548
Leg muscle weight, g	395.15a	385.58a	350.25b	341.06b	19.947	0.045	0.005	0.989
EE of breast muscle, %	4.98A	3.95B	3.93B	3.32B	<0.01	<0.001	<0.001	0.080
EE of leg muscle, %	9.67a	8.93a	8.47a	6.21b	0.502	<0.001	<0.001	0.039

Abbreviation: EE, ether extract.

^a,bWith a row, values with different superscript letters differ (P < 0.05). n = 6.

^A,BWith a row, values with different superscript letters differ (P < 0.01). n = 6.

Effects of MLE on the Biochemical Indexes of Serum and Liver of Broilers

The Biochemical Indexes in Serum

Three levels of MLE addition to diet exhibited no significant effects on serum TG, GLU, HDL-C, and LDL-C of broilers at 21 (P > 0.05), but significantly decreased serum TC content of broilers at 21 and 56 d (P < 0.05), and linearly increased serum HDL-C of broilers at 56 d, as shown in Table 8.

Table 8.

Effects of MLE on serum biochemical indexes of broilers.

	MLE supplementation to diet/(mg/kg)					P value
Items	0	400	800	1,200	SEM	ANOVA	Linear	Quadratic
21 d of age/(mmol/L)
TG	0.42	0.38	0.45	0.45	0.03	0.251	0.139	0.327
TC	3.77a	3.82a	3.31b	3.51b	0.17	0.044	0.016	0.631
GLU	12.33	13.47	12.40	13.37	0.65	0.177	0.323	0.859
HDL-C	2.4	2.51	2.18	2.23	0.18	0.311	0.153	0.796
LDL-C	0.39	0.46	0.46	0.5	0.04	0.102	0.016	0.675
56 d of age/(mmol/L)
TG	0.60	0.51	0.45	0.49	0.10	0.576	0.273	0.409
TC	3.25a	3.34a	2.98b	2.72b	0.20	0.030	0.005	0.228
GLU	11.62	12.26	11.64	11.53	0.65	0.673	0.678	0.433
HDL-C	0.95b	1.08b	0.97b	1.33a	0.12	0.013	0.010	0.164
LDL-C	0.56	0.74	0.63	0.54	0.12	0.366	0.692	0.118

Abbreviations: GLU, glucose; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein cholesterol; TC, total cholesterol; TG, triglyceride.

^a,bWith a row, values with different superscript letters differ (P < 0.05). n = 6.

The Biochemical Indexes in Liver

As presented in Table 9, 3 levels of MLE addition to diet had no significant effects on serum TG of broilers at age of 21 and 56 d (P > 0.05), while addition of 800 and 1,200 mg/kg MLE to diet significantly decreased the liver TC content of broilers at age of 21 and 56 d (P < 0.05). The addition of 1,200 mg/kg MLE to the feed lowered the blood HDL-C concentration of broilers at 56 d of age.

Table 9.

Effects of MLE addition to diet on liver biochemical indexes of broilers.

	MLE supplementation to diet/(mg/kg)					P value
Items	0	400	800	1,200	SEM	ANOVA	Linear	Quadratic
21 d of age/(mmol/L)
TG	1.77	1.83	1.72	1.77	0.21	0.966	0.861	0.995
TC	1.10a	1.01ab	0.97b	0.98b	0.04	0.039	0.013	0.115
56 d of age/(mmol/L)
TG	1.79	1.93	2.11	1.81	0.18	0.309	0.676	0.111
TC	1.32a	1.26a	1.01b	1.08b	0.06	<0.001	<0.001	0.172

Abbreviations: TC, total cholesterol; TG, triglyceride.

^a,bWith a row, values with different superscript letters differ (P < 0.05). n = 6.

Effects of MLE on mRNA Expression of Liver Lipid Metabolism in Broilers

As presented in Table 10, the 3 levels of MLE addition to the diet quadratically upregulated the mRNA expression of AMPK (P < 0.05), whereas 800 or 1,200 mg/kg MLE addition to the diet linearly downregulated mRNA expression of SREBP-1c, ACC, and FAS fatty acid (P < 0.05) in the liver. The addition of 3 levels of MLE to the diet had no significant effects on mRNA expression of PPARα, CPT1α, ACO, LPL, FABP (P > 0.05).

Table 10.

Effects of MLE on liver lipid metabolism gene expression of broilers.

	MLE supplementation to diet/(mg/kg)					P value
Items	0	400	800	1,200	SEM	ANOVA	Linear	Quadratic
ACC	1.00a	0.58b	0.32c	0.31c	0.04	<0.001	<0.001	<0.001
CPT1α	1.00	1.11	0.95	1.04	0.06	0.187	0.917	0.815
FAS	1.00a	0.68b	0.55c	0.52c	0.06	<0.001	<0.001	0.004
SREBP-1c	1.00a	1.10a	0.67b	0.45b	0.13	0.001	<0.001	0.202
PPARα	1.00	0.95	0.84	0.94	0.12	0.635	0.470	0.406
AMPK	1.00c	3.54b	3.72b	4.43a	0.19	<0.001	<0.001	<0.001
ACO	1.00	0.87	1.13	0.89	0.11	0.260	0.865	0.533
LPL	1.00	1.03	1.09	0.94	0.12	0.747	0.731	0.286
FABP	1.00	1.00	0.88	0.98	0.13	0.782	0.673	0.595

Abbreviations: ACC, acetyl-coA carboxylase; ACO, lipoyl-coa oxidase; AMPKα, adenosine monophosphate-activated protein kinase; CPT-1α, carnitine palmityl transferase; FABP, fatty acid binding protein; FAS, fatty acid synthase; LPL, lipoprotein decomposition enzyme; PPAR_α, peroxisome proliferator activated receptor; SREBP-1c, sterol regulatory element binding protein-1c.

^a,b,cWith a row, values with different superscript letters differ (P < 0.05). n = 6.

DISCUSSION

The effects of ML on animal growth performance depend on how the ML is physically processed. The 3 primary ML forms are MLE, ML raw powder, and ML fermented powder. Ding et al. (2021) showed that ML raw powder and fermented powder could reduce ADG and ADFI of chickens. Zhang et al. (2021) study showed that feeding 2% ML fermented powder could significantly increase ADFI and ADG of broilers, but had no significant effect on F/G. Missotten et al. (2013) found that adding 0.2, 0.5, and 0.8% MLE to the diet of yellow hens boosted ADG considerably, but decreased F/G. This current study found that MLE had no influence on broilers ADFI, ADG, or F/G over the course of the experiment. The difference could be attributed to the functional ingredients included in MLE; as compared to ML powder, MLE contains more functional components such as flavonoids, phenols, and alkaloids. For instance, DNJ, an ingredient found only in mulberry leaf extract, is a crucial alkaloid that may successfully limit the decomposition of disaccharides, significantly lowering blood glucose (Hu et al., 2017; Hu, 2020), which may affect broilers' growth performance. Given that MLE in this study had a DNJ content of 0.5%, it appears that this dosage was effective in reducing the accumulation of abdominal fat for DNJ content. Additionally, flavonoids are potent components that influence lipid metabolism. It has the potential to reduce blood TG and TC levels as well as inhibit LDL-C oxidation. In this investigation, blood TG was reduced with the MLE inclusion level, demonstrating that mulberry flavonoids are also a component of decreased fat deposition. The flavonoids content MLE used in the present study is 25%.

This study showed that MLE significantly reduced abdominal fat deposition in AA broilers, which is consistent with some previous findings on ML powder. According to Liu et al. (2019), adding ML powder significantly decreased the proportion of abdominal fat in Wanxi geese. Lan et al. (2012) demonstrated that dietary supplements containing 5-, 8-, and 10%-ML powder decreased the amount of abdominal fat in broilers, with 5% ML powder reducing the abdominal fat percentage by 39.81%. This study showed that 3 levels of MLE (400, 800, and 1,200 mg/kg) addition to diet reduced the abdominal fat deposition rate of AA broilers by 30.38, 36.32, and 44.9%, respectively. This demonstrates that MLE can reduce the rate of abdominal fat deposition in AA broilers. Furthermore, the fatty acid analyses of the broilers breast revealed that MLE addition lowered crude EE or SFA while increasing MUFA and PUFA.

The determination of physiological and biochemical indicators related to fat metabolism in serum and liver revealed that 800, 1,200 mg/kg MLE supplementation to diet significantly reduced the content of cholesterol (TC) in serum and liver over the entire experimental period. Other markers, such as TG, LDL-C, and GLU content, were not substantially impacted, indicating that MLE reduced abdominal fat deposition in AA broilers by decreasing the content of TC in liver and blood, rather than TG, LDL-C, and GLU contents.

Fat was primarily classified as TG and TC. The main form of energy storage in the body is TG, and serum TG concentration shows the capacity of fat deposition in animals (Wang et al., 2018). TC is primarily synthesized and stored in the liver, and it is the total of cholesterol contained in lipoproteins in the blood that is typically considered as the primary biomarker of fatty acid metabolism (Liu, 2021). Serum LDL-C is generated in the liver and is a key lipoprotein for delivering endogenous cholesterol from the blood to extrahepatic tissues (Martins, 2015). It is also an important carrier for assuring the body's demand for cholesterol. On the other hand, liver TC and TG are key biomarkers of fat metabolism in the liver. Fat metabolism homeostasis in the liver is critical to overall health. A fatty liver or an excessive amount of abdominal fat deposition resulted from high levels of fat and TC that were unable to be fully digested (Sun, 2015; Zhu, 2020). The findings of this study partially agreed with that of earlier studies on MLE or ML powder. Chen et al. (2019) demonstrated that adding raw or fermented ML to finishing pig serum considerably reduced the level of TC, TG, and LDL-C while significantly increasing serum HDL-C content, indicating that ML could improve fat metabolism ability of finishing pigs. Lee (2012) discovered comparable results in mice. According to Huang et al. (2016), dietary supplementation with 20% ML raw powder can dramatically lower TC and TG content in bearded chicken serum. Yan et al. (2019) found that dietary supplementation with ML powder or ML DNJ reduces TG levels in geese blood while having no effect on TC concentration. Although the LDL-C and HDL-C contents were not significantly impacted, this suggests that DNJ is a key functional component for the effects of ML on animal fat metabolism (Jin, 2014; Wang et al., 2015; Chang et al., 2016), and the DNJ content in this study is 0.5%. More research is needed to determine which functional component is most significant in effectively reducing abdominal fat accumulation in AA broilers. Further research on genes involved in fat synthesis and decomposition in the liver was conducted to investigate the mechanism of MLE effects on abdominal fat deposition reduction, and it was discovered that the cause of MLE reduction of TC in AA broilers was closely related to the AMPK signaling pathway.

AMPK, a crucial signaling system for controlling energy and lipid metabolism, has the ability to directly phosphorylate the equivalent target of SREBP-1c, which reduces the production of SREBP-1c's mRNA and prevents the synthesis of fatty acids (Barber, 2005; Liu, 2015). As the primary transcriptional regulator of cellular fat metabolism, SREBP-1c can control the mRNA expression of the enzymes acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS), which in turn controls the synthesis of fatty acids and triglycerides, the building blocks of lipid production (Shimano, 1997; Yang, 2022). Meanwhile, SREBP-1c overexpression may enhance triglyceride and cholesterol accumulation in the liver (Haluzik, 2006). FAS is a crucial enzyme in the polymerization of long-chain fatty acids and is strongly linked to the synthesis of fatty acids in the liver (Kim, 2017). ACC regulates the production and metabolism of fatty acids in the body, and reducing its activity may limit fat synthesis while increasing fatty oxidation (Tang, 2013).

The results of this study revealed that MLE significantly increased AMPK mRNA expression while decreasing SREBP-1c, ACC, and FAS mRNA expression in broilers liver, and effectively reduced TC deposition in liver.

Meanwhile, the findings of the fatty acid profile revealed that the total of SFA declined while the total of MUFA and PUFA increased, with an increase in MLE inclusion, which was consistent with the interaction between cholesterol and SFA, MUFA, and PUFA synthesis. Prior research has shown that elevated cholesterol reduces SFA synthesis while increasing MUFA and PUFA synthesis (Matthan et al., 2009; Silva, 2017). Furthermore, it was corroborated by an increase in HDL at 56 d of age, which earlier research predicted would occur when MUFA synthesis increased (Canbay, 2007).

This demonstrated that MLE's effects on reducing abdominal fat deposition and composition in AA broilers were accomplished by the AMPK signaling pathway. The process was depicted in Figure 1, the procedure involved increasing AMPK mRNA expression, decreasing SREBP-1c mRNA expression, which in turn decreases the expression of ACC and FAS as well as fatty synthesis in the liver, and lastly lowering lipid synthesis in the liver and abdominal fat deposition for broilers.

Figure 1.

MLE affects abdominal fat deposition by regulating AMPK pathway. Abbreviations: ACC, acetyl-CoA carboxylase; AMPK, AMPK-activated protein kinase; FAS, fatty acid synthetase; SREBP-1c, sterol regulatory element binding protein-1c.

Some indicators of oxidative decomposition of fatty acids, such as PPAR, which was strongly associated to regulation of ACO, CPT-I, LPL, and L-FABP, were also discovered in the signaling pathway of MLE lowering effects of abdominal fat formation (Kemmerer, 2015; Wu, 2020). However, the results of this study showed that MLE had no significant effect on mRNA expression of PPAR, ACO, CPT-1, LPL, and L-FABP genes in broilers liver, indicating that the effect of MLE on broilers was achieved mainly by suppressing fat sh0987.

CONCLUSIONS

MLE can reduce abdominal fat deposition in female AA broilers by decreasing the mRNA expression of FAS, ACC, and associated fatty acid synthesis enzymes through the pathway of AMPK/SREBP-1c/ACC in the liver, as well as by lowering the TC concentration in the liver and blood. Therefore, MLE can be employed as a viable fat loss feed supplement in fast-growing broiler diets. MLE can also be utilized to modify the fatty acid profile in female broilers (AA) at varied inclusion levels. For instance, MLE affected the dynamics of the fatty acid contents and lipoproteins at a level of inclusion. Certain MLE concentrations dramatically reduced saturated fatty acid compositions, while others boosted polyunsaturated and monounsaturated fatty acid concentrations. In this study, the optimal dose of MLE was 800 to 1,200 mg/kg; nevertheless, more research is needed to find the ideal dosage to decrease abdominal fat accumulation in AA broilers.

In conclusion, MLE can be employed as a viable fat loss feed supplement in fast-growing broiler diets since it reduces abdominal fat deposition in female AA broilers via the AMPK/SREBP-1c/ACC signaling pathway. MLE can also be utilized to modify the fatty acid profile in female broilers (AA) at varied inclusion levels.