Two induced pluripotent stem cell (iPSC) lines derived from patients affected by Waardenburg syndrome type 1 retain potential to activate neural crest markers

Abstract

Waardenburg syndrome type 1 (WS1), a rare genetic disease characterized by pigmentation defects and mild craniofacial anomalies often associated with congenital deafness is caused by heterozygous mutations in the PAX3 gene (2q36.1). We have generated two induced pluripotent stem cell lines (PCli029-A and PCli031-A) from two patients from the same family both carrying the same heterozygous deletion in PAX3 exon 1 (c.-70_85 + 366del). These cells are pluripotent as they can differentiate into ectoderm, mesoderm and endoderm. They also can activate the early neural crest marker SNAI2. These cells will be useful for studying the human neural crest-derived pigment cells.

Resource Table:

Unique stem cell lines identifier	PCli029-APCli031-A
Alternative names of stem cell lines	PC076 (for PCli029-A)PC079 (for PCli031-A)
Institution	Institut Curie
Contact information of distributor	Anne-Hélène Monsoro-Burq
Type of cell lines	iPSC
Origin	Human
Additional origin info	Age, gender:PCli029-A: 8, male, caucasian;PCli031-A: 37, female, caucasian.
Cell Source	Original cell type induced: Peripheral blood mononuclear cells
Clonality	Clonal
Method of reprogramming	Episomal
Multiline rationale	Both patients (mother and son) carry the same mutation and are affected by WS1. The two lines are non-isogenic cell lines.
Gene modification	Yes
Type of modification	Congenital mutation
Associated disease	Waardenburg syndrome type I (OMIM # 193500)
Gene/locus	PAX3 NM_181457.4c.-70_85 + 366del
Method of modification	N/A
Name of transgene or resistance	N/A
Inducible/constitutive system	N/A
Date archived/stock date	08/12/2021
Cell line repository/bank	hPSCreg (https://hpscreg.eu/cell-line/PCIi029-A; https://hpscreg.eu/cell-line/PCIi031-A)
Ethical approval	Written informed patient (or legal representative) consent for biomedical research was taken before blood sample. The generation, use and storage of human iPSCs were performed with approval from the French Ministry for Research and higher Education (AC-2019–3388).

1. Resource utility

Two iPSC cell lines were generated from two family-related patients with Waardenburg syndrome 1 (WS1) caused by a heterozygous PAX3 mutation. These lines will be a useful tool to understand the cellular and molecular mechanisms of WS1 using the protocols developed to differentiate iPSC into neural crest and their derivatives. (see Table 1.)

Table 1.

Summary of lines.

iPSC line names	Abbreviation in figures	Gender	Age	Ethnicity	Genotype of locus	Disease
PCli029-A	X	Male	8	Caucasian	PAX3 NM_181457.4c.-70_85 + 366del	Waardenburg syndrome type 1
PCli031-A	X	Female	37	Caucasian	PAX3 NM_181457.4c.-70_85 + 366del	Waardenburg syndrome type 1

2. Resource details

Waardenburg syndrome type 1 (WS1, OMIM #193500) is a hereditary disease characterized by mild pigmentation and midfacial (dystopia canthorum) defects, along with congenital deafness due to the lack of melanocytes in the inner ear. WS1 is caused by heterozygous mutations in PAX3, resulting in haploinsufficiency (Pingault et al., 2010). WS1 symptoms, currently interpreted as resulting from defective PAX3 function in the melanocytes, could alternatively result from broader PAX3 functions during neural crest development since other neural crest-derived lineages (e.g. craniofacial structures) are also affected.

Here, we report the generation of two iPSC lines derived from Peripheral Blood Mononuclear Cells (PBMCs) of a mother and her son, both affected by WS1, sharing the same heterozygous mutation (c.-70_85 + 366del), a deletion between the 5′UTR and the first exon–intron boundary, including the start codon. The mother, 37, presents mild symptoms with early graying of the hair and dystopia canthorum, while her son, 8, presents congenital bilateral hearing loss, heterochromia irides, dystopia canthorum and synophrys.

PBMCs were collected and reprogrammed using episomal vectors. The resulting cell lines presented typical stem cell morphologies in phase-contrast bright-field microscopy (Fig. 1A). They expressed pluripotency markers (OCT4, SOX2 and NANOG, Fig. 1B), and a vast majority of cells co-expressed the pluripotency surface markers TRA-1–81 and SSEA-4 (Fig. 1C). Karyotyping showed normal chromosome numbers and structures in both cell lines (Supplementary Fig. 1A). A short tandem repeat (STR) analysis of the genomic DNA from the iPSCs matched with genomic DNA extracted from patients, except for two alleles of an STR locus in PCli031-A (STR Analysis File - submitted in archive with journal). Since the other 15 STRs matched perfectly with the patient genome, we concluded that the PCli031-A cell line was properly derived and identified. Both iPSC lines displayed the patient mutation: one PAX3 allelic deletion (Sanger sequencing, Fig. 1D), and were devoid of mycoplasma contamination (PCR test, Supplementary Fig. 1B). To better maintain the undifferentiated state of the cells, the iPSC lines were shifted to mTeSR1 medium and passaged using ReLeSR (STEMcell Technologies), which preferentially selects clumps of undifferentiated iPSC colonies.

Fig. 1.

Characterization and validation of PCli029-A and PCli031-A cell lines.

Pluripotency was assessed in embryoid bodies (EB) derived from the iPS cell lines. Both lines expressed markers of the three germ layers (Fig. 1E). Moreover, the patient-derived iPSCs and 3 commercially-available control WT iPSCs (Phenocell) were submitted to a 5-day protocol for neural crest induction using two concentrations of CHIR99021, an activator of the canonical Wnt pathway (Gomez et al., 2019). Both the patient-derived cell lines and the wild-type ones were able to differentiate into neural crest progenitors after 5 days, depicted by SNAI2 expression (Fig. 1F). However, PCli029-A required a higher level of Wnt signalling activation (3 µM CHIR99021). The neural crest marker SOX10 was also strongly activated in both PCli029-A (Fig. 1G) and PCli031-A (data not shown) upon treatment with 3 µM CHIR99021. These results show that despite PAX3 haploinsufficiency, the two mutated iPSC lines retained the potential to produce neural crest cells, albeit with variable efficiencies, and can thus be used for further investigations into the developmental origin of WS1.

3. Materials and methods

3.1. iPSC generation and maintenance

Peripheral Blood Mononuclear Cells from patients were purified using a Ficoll-Paque layer and reprogrammed with episomes (Epi5™ Reprogramming Kit, ThermoFisher #A15960) using Amaxa® Nucleofector® (Lonza). Transduced cells were seeded on Laminin-521 matrix-coated dishes (StemCell) and incubated with StemSpan™ SFEM II for 7 days. Medium was progressively switched to StemMACS™ (Miltenyi Biotec) over 10 days, then changed daily. Manually picked small colonies were transferred to Geltrex™ matrix-coated dishes (ThermoFisher) for development. iPSCs were initially maintained in StemMACS medium in hESC-qualified Matrigel (ThermoFisher) coated wells and passaged (1:5) every 4–5 days using Accutase (Sigma). At passage 16–17, cell lines were shifted to mTeSR1 medium (StemCell Technologies #85850) and passaged in clumps (1:5) using ReLeSR (StemCell Technologies #05872) every 4–5 days without ROCK inhibitor. All cells were grown at 37 °C, 5 % CO₂ in a humidified incubator with daily medium change.

3.2. FACS analysis of surface markers

iPSCs (passage 10) were harvested with Accutase™ (StemCell Technologies #07920) and centrifuged at 300g/3min. Antibodies (Table 3) were added to cells resuspended in Live Cell imaging solution (Life Technologies #A14291DJ). Appropriate control isotypes were used at same dilution. The mixtures were incubated for 30 min/RT in dark, then centrifuged at 300g/3min. Cell pellets were resuspended in 200 µL Live Cell imaging solution before analysis with Accuri™ C6 Plus flow cytometer (BD Biosciences).

Table 3.

Reagents details.

Antibodies used for immunocytochemistry/flow-cytometry
	Antibody	Dilution	Company Cat # and RRID
Pluripotency Marker	Rabbit anti-OCT4	1:500	Millipore Cat#ab18976, RRID:AB_444714
Pluripotency Marker	Rabbit anti-SOX2	1:500	Biolegend Cat#651902, RRID:AB_11204259
Pluripotency Marker	Rabbit anti-Nanog	1:500	Abcam Cat#21624, RRID:AB_446437
Pluripotency Marker	Alexa Fluor 647 Mouse anti Tra-1–81	1:20	Biolegend Cat#330706, RRID:AB_1089242
Pluripotency Marker	PE Mouse anti-SSEA4	1:20	Biolegend Cat#330406, RRID:AB_1089206
Neural Border Marker	Mouse anti-PAX3	1:200	DSHB Cat#AB_528426 RRID:AB_528426
Neural Crest Marker	Rabbit anti-SOX10	1:200	CST Cat#89356 RRID: AB_2792980
Secondary Antibody	AlexaFluor 647 Goat anti-Rabbit IgG (H + L)	1:1000	Thermo Fisher Scientific Cat#A21244, RRID:AB_2535812
Secondary Antibody	AlexaFluor 488 Goat anti-Mouse IgG (H + L)	1:500	Thermo Fisher Scientific Cat#A11001, RRID:AB_2534069
Secondary Antibody	AlexaFluor 555 Goat anti-Rabbit IgG (H + L)	1:500	Thermo Fisher Scientific Cat#A21428, RRID:AB_2535849
Primers
	Target	Forward/Reverse primer (5′-3′)
House Keeping Gene	CREBBP	GAGAGCAAGCAAACGGAGAG/ AAGGGAGGCAAACAGGACA
House Keeping Gene	18S	GAGGATGAGGTGGAACGTGT/ TCTTCAGTCGCTCCAGGTCT
Differentiation Marker (Endoderm)	GATA6	AAAGACTTGCTCTGGTAATAGC/ GGCTGTAGGTTGTGTTGTGG
Differentiation Marker (Endoderm)	EOMES	AAGGCTTCAGAGACAACTATG/ CGACCTCCAGGGACAATC
Differentiation Marker (Mesoderm)	HAND1	TCAAGGCTGAACTCAAGAAGG/ CGGCTCACTGGTTTAACTCC
Differentiation Marker (Mesoderm)	T(Brachyury)	TAGCGAGAAATATGCCGAGGAG/ GAGCTGCGTGATCCGATGG
Differentiation Marker (Mesoderm)	SMA	GACCGAATGCAGAAGGAGAT/ CACCGATCCAGACAGAGTATT
Differentiation Marker (Ectoderm)	NESTIN	TCAAGATGTCCCTCAGCCTGGA/ AAGCTGAGGGAAGTCTTGGAGC
Differentiation Marker (Ectoderm)	P63	TACTGCCCTGACCCTTACA/ GGACATGGTGGATCGGTAATAA
Differentiation Marker (Ectoderm)	PAX6	AGTGAATCAGCTCGGTGGTGTCTT/ TGCAGAATTCGGGAAATGTCGCAC
Differentiation Marker (Neural Crest)	SNAI2	ATACCACAACCAGAGATCCTCA/ GACTCACTCGCCCCAAAGATG
Differentiation Marker (Neural Crest)	TFAP2B	CCTGCACTCCCGAAAGAATA/ GCGCCAGTAGATCCGTAAAT
PCR for genotyping	PAX3	GCTGGAACATTTGCCCAGAC/ ATTCCAATCACAATGGCGCGG

3.3. Embryoid-bodies (EBs) pluripotency assay; neural crest induction

iPSCs (passage 10) harvested with Accutase, centrifuged at 290g/3min, were plated at 10,000 cells per well in a 96-well Ultra-Low Attachment plate (Costar #7007) in 100 µL mTeSR1 containing 10 µM Blebbistatin (Selleckchem S7099). After one week, EBs were transferred into a 10 cm tissue-culture dish (Falcon #353003) in mTeSR1/Blebbistatin medium and cultured for another week. Neural crest was induced as in Gomez et al. 2019: iPSCs (passage 20) harvested with Accutase were plated at 20,000 cells/cm² on Matrigel in DMEM/F12 (ThermoFisher), 2 % B27 (Life Technologies), 0,5% BSA (A9647-106, Sigma). 2/3 µM CHIR 99021 (#4423, Tocris), 10 µM ROCK inhibitor Y-27632 (#1254, Tocris) were added for the first two days only.

3.4. qRT-PCR

RNA was extracted from iPSCs submitted to the EB protocol (passage 10) or the neural crest protocol (passage 20) using Trizol (Invitrogen). M−MLV reverse transcriptase (Promega) and SYBR Green (Bio-Rad) were used for qRT-PCR in a C1000-Touch cycler (Bio-Rad). Results were normalized against reference genes 18S/CREBBP (Table 2).

Table 2.

Characterization and validation.

Classification	Test	Result	Data
Morphology	Phase contrast bright-field microscopy	Normal morphology	Fig. 1 panel A
Phenotype	Qualitative analysis: immunocytochemistry	Positive for NANOG, OCT4, SOX2	Fig. 1 panel B
	Quantitative analysis: flow cytometry	Percentage of cells double-labelled with TRA-1–81 and SSEA-4 was superior to 88	Fig. 1 panel C
Genotype	Karyotype (G-banding) and resolution	No gross chromosomal alteration by reprogramming was detected Resolution 400	Supplementary Fig. 1A
Identity	STR analysis	16 sites tested: all matched except for one allele	Submitted in archive with journal
Mutation analysis	Sequencing	Heterozygous mutation in PAX3 NM_181457.4c.-70_85 + 366del	Fig. 1 panel D
Microbiology and virology	Mycoplasma	Mycoplasma testing by PCR. All negative.	Supplementary Fig. 1B
Differentiation potential	Embryoid body	Expression of ectodermal (PAX6, P63 or NESTIN), mesodermal (HAND1, T(Brach) or SMA) and endodermal (GATA6, EOMES) markers.	Fig. 1 panel E
Donor screening	HIV 1 + 2 Hepatitis B, Hepatitis C	Negative	Not shown

3.5. Genotyping

iPSC (passage 20) gDNA was extracted with Phenol/Chloroform/Isoamyl Alcohol, RNAseA digestion, and (CH₃COO)Na/isopropanol precipitation. PCR was performed using PAX3 primers (Table 2). The 832 bp and the 312 bp band (WT and mutated allele, respectively) were purified by gel extraction (Qiagen) and sequenced.

3.6. Immunofluorescence

IPSCs were fixed for 12 min with 4 % paraformaldehyde, permeabilized with 0,4% Tween20 and blocked with 10 % FBS at RT. Primary and secondary antibody (passage 10; OCT4/SOX2/NANOG or passage 20; PAX3/SOX10, Table 3) were incubated in 4 % FBS/0.1 % Tween, overnight/4°C and 1 h/RT, respectively. Nuclei were stained with 1 µg/ml DAPI (Promega). Cells were imaged using Olympus IX73 microscope.

3.7. Karyotyping

Karyotyping was performed by Chromostem (CHRU Montpellier, France) on 10 metaphasic cells (passage 10) using the RHG banding method (400 bands resolution).

3.8. STR analysis

STR analysis was performed on DNA extracted from iPSCs (passage 20) and DNA extracted from corresponding patients using Powerplex 16HS® kit (Promega). A multiplex amplification was performed on 15 STRs and a sex determination marker on GeneAmp PCR 9700 cycler (Applied Biosystems).

3.9. Mycoplasma test

Lack of mycoplasma in iPSCs (passage 20) was confirmed with LookOut® Mycoplasma PCR Detection Kit (Sigma).

Declaration of Competing Interest

The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: Brigitte Ontoniente reports a relationship with Phenocell SAS that includes: board membership and employment.

Appendix A. Supplementary data

The following are the Supplementary data to this article: