IPSC reprogramming of two patients with spondyloepiphyseal dysplasia congenita (SEDC)

Abstract

Spondyloepiphyseal dysplasia congenita (SEDC) is a severe non-lethal type 2 collagenopathy caused by pathogenic variants in the COL2A1 gene, which encodes the alpha-1 chain of type II collagen. SEDC is clinically characterized by severe short stature, degenerative joint disease, hearing impairment, orofacial anomalies and ocular manifestations. To study and therapeutically target the underlying disease mechanisms, human iPSC-chondrocytes are considered highly suitable as they have been shown to exhibit several key features of skeletal dysplasias. Prior to creating iPSC-chondrocytes, peripheral blood mononuclear cells of two male SEDC patients, carrying the p.Gly1107Arg and p.Gly408Asp pathogenic variants, respectively, were successfully reprogrammed into iPSCs using the CytoTune™-iPS 2.0 Sendai Kit (Invitrogen).

Resource Table:

Unique stem cell line identifier	CMGANTi006-A CMGANTi007-A
Alternative name(s) of stem cell line	SEDC1 (CMGANTi006-A) SEDC2 (CMGANTi007-A)
Institution	University of Antwerp and Antwerp University Hospital
Contact information of the reported cell line distributor	Aline Verstraeten – Aline.Verstraeten@uantwerpen.be
Type of cell line	IPSC
Origin	Human
Additional origin info	CMGANTi006-A: 3 yrs, male, Polish CMGANTi007-A: 13 yrs, male, Belgian
Cell Source	PBMCs
Clonality	Clonal
Method of reprogramming	Sendai virus
Genetic Modification	Yes
Type of Genetic Modification	Hereditary
Evidence of the reprogramming transgene loss (including genomic copy if applicable)	Absence of the Sendai virus backbone was verified with PCR and agarose gel electrophoresis.
Associated disease	Spondyloepiphyseal dysplasia congenita (SEDC)
Gene/locus	CMGANTi006-A: COL2A1 c.3319G > A CMGANTi007-A: COL2A1 c.1223G > A
Date archived/stock creation date	July 2021
Cell line repository/bank	Hpscreg https://hpscreg.eu/cell-line/CMGANTi006-A https://hpscreg.eu/cell-line/CMGANTi007-A
Cell line repository/bank	Ethical committee Antwerp University Hospital, project ID: 2021-0288 – Edge 001903

1. Resource utility

Because a cartilage biopsy is a highly invasive procedure for the patient and the regenerative capacity of cartilage tissue is limited, induced pluripotent stem cell (iPSC)-derived chondrocytes provide a valuable alternative to model chondrodysplasias, including SEDC, and to investigate the underlying pathomechanisms.

2. Resource details

Heterozygous missense, exon-skipping and truncating variants in the COL2A1 gene, encoding the alpha-1 chain of type II collagen, cause the type 2 collagenopathies. Spondyloepiphyseal dysplasia congenita (SEDC) is a severe non-lethal type 2 collagenopathy characterized by ocular manifestations, hearing impairment, orofacial anomalies, severe short stature and degenerative joint disease (Gregersen and Savarirayan, 1993). There is currently no curative treatment for SEDC. Management is mainly focused on prevention of degenerative joint disease and ocular complications such as spontaneous retinal detachment. Affected individuals have severe short stature for which there are no growth-enhancing drugs available and for whom limb lengthening surgery is not a good indication. There is thus clearly a need for novel treatments addressing the underlying pathophysiology. iPSC-derived chondrocytes as disease models have been shown to exhibit several key features of skeletal dysplasias. Therefore they are considered highly suitable to improve the current understanding of the underlying disease mechanisms and to allow the discovery of novel drug candidates to cure the disease. Whereas iPSC-derived cellular models for two perinatally lethal type 2 collagenopathies have already been created (Okada et al., 2015), no iPSC-chondrocytes from severe non-lethal type 2 collagenopathies such as SEDC are currently available. This article reports on the creation of iPSC-lines of two SEDC patients carrying a glycine substitution (p.Gly1107Arg and p.Gly408Asp) in type II collagen. Peripheral blood mononuclear cells (PBMCs) of these two patients were reprogrammed into iPSCs using the CytoTyne™-iPS 2.0 Sendai Kit (Invitrogen), which contains three Sendai viral reprogramming vectors delivering and expressing the essential key genetic factors for iPSC generation: OCT3/4, SOX2, KLF4 and c-MYC. Pluripotency of the resulting iPSCs was validated using immunocytochemistry (ICC) for the markers OCT4, SOX2, NANOG, TRA-1–60 and TRA-1–81 (Fig. 1, A) and real-time quantitative polymerase chain reaction (RT-qPCR) was used to determine expression levels of the pluripotency markers NANOG, POU5F1, DNTM3B and SOX2 (Fig. 1, B). Their ability to differentiate into the three germ layers, i.e. ectoderm, mesoderm and endoderm was confirmed using RT-qPCR (Fig. 1, F). Sanger sequencing of the corresponding exon was performed to prove the presence of the pathogenic variant in both iPSC lines (Fig. 1, C). To examine genomic identity and stability of the iPSC clones and corresponding PBMCs, a SNP array analysis was perfomed (Fig. 1, E and Table 3). There were no CNVs observed in genes described in the ‘Nosology and classification of genetic skeletal disorders: 2019 revision’ of Mortier et al. (Fig. 1, E) (Mortier et al., 2019). Therefore, it can be concluded that no clinically relevant CNVs were introduced during the reprogramming experiment. Important to note is that the SNP array is unable to detect balanced chromosomal rearrangements and low-level mosaicism. Furthermore, the iPSC culture medium was free of mycoplasma contamination (Supplementary Fig. 1, Supplementary Fig. 2) and the resulting iPSCs were free of Sendai virus (Supplementary Fig. 3). Altogether, it can be concluded that we have successfully generated two SEDC iPSC lines as a first step in the establishement of iPSC-chondrocyte disease models to study and therapeutically target the underlying disease mechanisms.

Fig. 1.

Characterization of iPSC-line CMGANTi006-A and CMGANTi007-A.

Table 3.

Cell line identity testing.

iPSC line	total count	correct count	errors	% identical
CMGANTi006-A P12	288,673	288,664	9	>99.9 %
CMGANTi007-A P12	288,407	288,401	6	>99.9 %

3. Materials and methods

3.1. PBMC culture and iPSC reprogramming

Mononuclear cells were isolated from peripheral blood samples of the two SEDC patients using Lymphocyte Separation Medium and cultured in StemSpan SFEM II medium supplemented with StemSpan Erythroid expansion supplement for 12 days. These PBMCs were transduced with the key genetic factors OCT3/4, SOX2, KLF4 and c-MYC using the CytoTune™-iPS 2.0 Sendai Kit (Life Technologies) according to the manufacturer’s protocol. The cells were transferred to Matrigel coating (Corning) three days after transduction and the medium was changed to iPSC medium seven days after transduction. Popping up iPSC colonies were picked and further expanded by passaging the cells as small clumps every 4–5 days (1:5 ratio) using 0.02 % EDTA in Essential 8™ Flex medium (Life Technologies) supplemented with RevitaCell (Life Technologies) on Matrigel-coated dishes at 37 °C, 5 % CO₂, 5 % O₂.

3.2. Immunocytochemistry

The resulting iPSCs (passage 12) were cultured on Matrigel coated coverslips and fixed with 100 % methanol (20′, −20 °C) after two days. Subsequently, they were permeabilized using 0.1 % Triton X-100 solution (Sigma-Aldrich) (15′, room temperature (RT)) and non-specific binding was blocked using 5 % goat serum (Jackson ImmunoResearch) (30′, RT). The primary antibodies were incubated overnight (4 °C), after which the secondary antibodies were incubated for one hour (RT). Nuclei were visualized using DAPI (Life Technologies) and pictures were taken using a 40x objective of a Leica DMi8 fluorescence microscope.

3.3. Quantitative pluripotency marker analysis

RNA from patient PBMCs and the resulting iPSCs (passage 12) was extracted according to the manufacturer’s protocol of the Quick-RNA™ Miniprep Kit (ZYMO Research) and cDNA was synthesized using the SuperScript™ III First-Strand Synthesis System (Life Technologies). Gene expression of the selected pluripotency makers (Table 1) was confirmed using TaqMan® probes (Life Technologies) (Table 2) and a CFX384 Touch Real-Time PCR detection System (Bio-Rad) (50 °C 2′, 95 °C 10′, 40x (95 °C 15″, 60 °C 1′)). Relative gene expression to PBMCs of both patient iPSC lines was calculated based on the average cycle (Ct) value of triplicates, normalized to housekeeping genes GAPDH and ACTB and reported as fold change (2^{–Δ Δ Ct}). Relative expression of the pluripotency genes of the iPSC lines was compared with relative gene expression to fibroblasts (FBs) of an earlier published iPSC line BBANTWi006-A (Simons et al., 2022). Variance between the technical replicates is represented by error bars in Fig. 1, B.

Table 1.

Characterization and validation.

Classification	Test	Result	Data
Morphology	Photography Bright field	Normal	Fig. 1 panel D
Phenotype	Qualitative analysis (Immunocytochemistry)	Staining/expression of pluripotency markers: Oct3/4, Nanog, Sox2, Tra1-60, Tra1-80.	Fig. 1 panel A
	Quantitative analysis (RT-qPCR)	Expression of DNMT3B, NANOG, POU5F1 and SOX2	Fig. 1 panel B
Genotype	HumanCytoSNP-12 array	Resolution 72 kb, no major copy number variations	Fig. 1 panel E
Identity	HumanCytoSNP-12 array OR	> 99.9 % identical SNPs	Table 3
	STR analysis	N/A	N/A
Mutation analysis (IF APPLICABLE)	Sequencing	COL2A1 c.3319G > A, p.Gly1107Arg; COL2A1 c.1223G > A, p.Gly408Asp	Fig. 1 panel C
	Southern Blot OR WGS	N/A	N/A
Microbiology and virology	Mycoplasma	Negative	Supplementary Fig. 1, Supplementary Fig. 2
Differentiation potential	Trilineage differentiation	Expression of appropriate markers of the respective germ layers, i.e. ectoderm, mesoderm and endoderm.	Fig. 1 panel F
List of recommended germ layer markers	Expression of these markers has to be demonstrated at mRNA (RT PCR) or protein (IF) levels, at least 2 markers need to be shown per germ layer	Endoderm: CXCR4, FOXA2, SOX17 Mesoderm: NKX2.5, αSMA (ACTA2), HAND1 Ectoderm: HES5, MAP2, PAX6	Fig. 1 panel F
Donor screening (OPTIONAL)	HIV 1 + 2 Hepatitis B, Hepatitis C	N/A	N/A
Genotype additional info (OPTIONAL)	Blood group genotyping	N/A	N/A
	HLA tissue typing	N/A	N/A

Table 2.

Reagents details.

	Antibodies used for immunocytochemistry/flow-cytometry
	Antibody	Dilution	Company Cat #	RRID
Pluripotency Markers	Mouse anti-TRA1-60 Rabbit anti-OCT4 Rabbit anti-SOX2 Mouse anti-TRA1-81 Rabbit anti-NANOG	1:200 1:200 1:200 1:200 1:500	Cell Signaling Technology Cat#4746S Cell Signaling Technology Cat# 2750S Abcam Cat# ab97959 Cell Signaling Technology Cat#4745S ThermoFisher Scientific Cat#PA1-097	AB_2119059 AB_823583 AB_2341193 AB_2119060 AB_2539867
Secondary antibodies	AF555 Goat anti-Mouse, IgM AF488 Goat anti-Rabbit, IgG	1:500 1:500	Thermo Fisher Scientific Cat#A21426 Thermo Fisher scientific Cat#A11034	AB_2535847 AB_2576217
	Primers
	Target	Size of band	Forward/Reverse primer (5′-3′)
Pluripotency Markers (RT-qPCR)	DNMT3B NANOG POU5F1 SOX2	55 bp 99 bp 77 bp 91 bp	Hs00171876_m1 Hs04260366_g1 Hs04260367_gH Hs01053049_s1
House-Keeping Genes (RT-qPCR)	GAPDH ACTB	93 bp 63 bp	Hs02758991_g1 Hs01060665_g1
Differentiation markers (RT-qPCR)	CXCR4 FOXA2 SOX17 NKX2.5 αSMA (ACTA2) HAND1 HES5 MAP2 PAX6	153 bp 66 bp 149 bp 64 bp 105 bp 54 bp 62 bp 98 bp 76 bp	Hs00607978_s1 Hs00232764_m1 Hs00751752_s1 Hs00231763_m1 Hs00426835_g1 Hs00231848_m1 Hs01387463_g1 Hs00258900_m1 Hs00240871_m1
Targeted mutation sequencing	SEDC1: COL2A1 c.3319G > A SEDC2: COL2A1 c.1223G > A	250 bp 390 bp	GTTTTCCCAGTCACGACGCCTCAGATGCAGAGGAG/CAGGAAACAGCTATGACTCCTGTCCCACCCAAGCT GAGAGCATGGGAAAGAGGGG/TCCCTGAAATGGACAGCACC
Sendai virus Plasmids (PCR)	SeV	181 bp	GGATCACTAGGTGATATCGAGC/ ACCAGACAAGAGTTTAAGAGATATGTATC

3.4. Trilineage differentiation and analysis

Both iPSC lines (CMGANTi006-A passage 17 and CMGANTi007-A passage 22) were differentiated into the three embryonic germ layers (mesoderm, endoderm and ectoderm) using the StemMACS Trilineage Differentiation Kit (Miltenyi Biotec) (37 °C, 5 % CO₂, 20 % O₂) as an extra proof of pluripotency. RNA was extracted and cDNA was synthesized of the resulting cells. Subsequently, expression of selected germ layer markers (Table 1) was verified using TaqMan® probes (Life Technologies) (Table 2) and RT-qPCR. The error between the technical replicates of both patient iPSC lines is represented by error bars in Fig. 1, F.

3.5. SNP array (CNV analysis)

Genomic DNA of patient PBMCs and the resulting iPSCs (passage 12) was isolated using the Maxwell® RSC Instrument and Maxwell® RSC Cultured Cells DNA Kit (Promega). Subsequently, a HumanCytoSNP-12 assay (Illumina) was performed using the Infinium HD Assay Ultra Automated Protocol and an iScan System (Illumina). The data was analysed in CNV-WebStore, an in-house developed online platform to analyse and interpret microarray data, to examine the presence of CNVs between the PBMCs and the created iPSC clones (Vandeweyer et al., 2011).

3.6. Sanger sequencing

Exon 47 and exon 20 of the COL2A1 gene of genomic DNA of patient CMGANTi006-A and CMGANTi007-A (passage 12) respectively was amplified by a Touchdown PCR (94 °C 3′, 10x (94 °C 5′, 65 °C (Δ-0.5) 15″, 72 °C 15″), 25x (94 °C 5′, 55 °C 15″, 72 °C 15″), 72 °C 1′)) using a Verity Thermal Cycler (Applied Biosystems). The resulting PCR products were enzymatically purified using calf intestinal alkaline phosphatase (Merck) and Exonuclease I (BioLabs) prior to the sequencing experiment. Subsequently, Sanger sequencing was performed using an ABI 3130XL Genetic Analyzer system (Applied Biosystems) according to the standard protocol.

3.7. Mycoplasma test

Absence of mycoplasma contamination in the iPSC culture medium was confirmed using the LookOut Mycoplasma PCR Detection Kit (Sigma-Aldrich).

3.8. Sendai virus detection

RNA isolation and cDNA synthesis of the iPSCs (passage 12) was performed as described above. Absence of the Sendai virus was demonstrated using RT-PCR (94 °C 5′, 34× (94 °C 15″, 60 °C 30″, 72 °C 45″), 72 °C 10′, 10 °C 1′) and agarose gel electrophoresis.

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix A. Supplementary data

The following are the Supplementary data to this article:

Supplementary Fig. 1.

Supplementary Fig. 2.

Supplementary Fig. 3.