An acetyl-click screening platform identifies small molecule inhibitors of Histone Acetyltransferase 1 (HAT1)

Abstract

HAT1 is a central regulator of chromatin synthesis that acetylates nascent histone H4. To ascertain whether targeting HAT1 is a viable anti-cancer treatment strategy we sought to identify small molecule inhibitors of HAT1 by developing a high-throughput HAT1 acetyl-click assay. Screening of small molecule libraries led to the discovery of multiple riboflavin analogs that inhibited HAT1 enzymatic activity. Compounds were refined by synthesis and testing of over 70 analogs, which yielded structure-activity relationships. The isoalloxazine core was required for enzymatic inhibition, whereas modifications of the ribityl sidechain improved enzymatic potency and cellular growth suppression. One compound (JG-2016 [24a]) showed relative specificity towards HAT1 compared to other acetyltransferases, suppressed the growth of human cancer cell lines, impaired enzymatic activity in cellulo, and interfered with tumor growth. This is the first report of a small molecule inhibitor of the HAT1 enzyme complex and represents a step towards targeting this pathway for cancer therapy.

INTRODUCTION

Nutrient metabolism and epigenetic reactions are integrated and sensed by cells to ensure that adequate substrates are available to meet the demands of transcriptional programs that spur cell division.¹ By studying genes induced by epidermal growth factor (EGF) we identified HAT1 as the human acetyltransferase most highly induced by EGF stimulation in mammary cells.² HAT1 was also required for rapid cell proliferation and tumor formation in vivo.^2-6 These data indicate that HAT1 plays a critical role in coordinating anabolic and epigenetic processes for cell division that drives tumor growth.

HAT1 was the first histone acetyltransferase gene isolated,^7-9 and subsequent work has established that it plays a critical role in chromatin replication, the process of making new nucleosomes during S-phase.¹⁰ In the cytosol, HAT1 di-acetylates histone H4 on lysines 5 and 12 of the amino-terminal histone tail. It then transits to the nucleus together with histone tetramers or disomes¹¹ and other histone chaperones¹² to deposit nascent histones at the replication fork, or other sites of nucleosome insertion. Then HAT1 is released from chromatin¹³ and the HAT1 di-acetylation mark on histone H4 is quickly removed within a span of 15-30 minutes by the action of histone deacetylases.^14-16 Thus, HAT1 does not directly acetylate chromatin, and the di-acetylation mark placed by HAT1 is not propagated to mature chromatin.

Our prior work suggested a model whereby free acetate derived from de-acetylation of nascent histones was recycled to acetyl-CoA via acetyl-CoA-synthetases to provide substrate for nascent chromatin acetylation.² As each nascent nucleosome of newly replicated chromatin contributes four HAT1-dependent acetyl groups, this should provide adequate acetyl-CoA to allow for histone acetylation of the much sparser promoter and enhancer sites. Indeed, histone H3 acetylation marks are reduced in cells depleted from HAT1, as expected from this model.² In addition, CBP auto-acetylation is strongly dependent on HAT1¹⁷ which also suggests a role for HAT1 in governing nuclear acetyl flux. Other links between mitochondrial processes and HAT1 function have also been reported.^5,18

Although these genetic studies have shed light on HAT1 function, further development of chemical probes should prove useful to distinguish the importance of the enzyme’s catalytic activity from its structural role in protein:protein or protein:DNA complexes. Recently, a HAT1 bisubstrate inhibitor was designed by chemically ligating co-enzyme A to the ζ-amine of lysine 12 in the histone H4 N-terminal 20-mer peptide, yielding a K_i of ~ 1 nM towards bacterially-expressed recombinant HAT1.¹⁹ Although, useful for enzymatic assays, this probe is unlikely to be cell permeable and therefore of limited utility to study cellular processes dependent on HAT1. Therefore, we sought to identify and design small molecule modulators of HAT1 to probe the effects of HAT1 activity in cells and validate its role as a pro-tumorigenic factor.

The design of small molecule acetyltransferase inhibitors has been hampered by nonspecific and low-throughput assays, which have tended to yield bio-reactive molecules.^20,21 However, specific, potent, small molecule acetyltransferase inhibitors targeting CBP/p300²² and KAT6A/B^23,24 have recently been described. We previously pioneered peptide-based sensors of non-receptor tyrosine kinases for cellular detection and monitoring of post-translational modification events including small molecule kinase inhibitor treatments.²⁵ We then built a generalizable in silico pipeline to design, optimize and screen kinase-specific peptide substrates for drug discovery screens.²⁶ The use of lanthanide coordination by peptide substrates allowed for the development of screening assays without the need for post-translational modification-specific antibodies.^27,28 Therefore, these approaches were adapted with recent advances in acetylation monitoring²⁹ to build a high-throughput, peptide-based sensor assay for HAT1 acetylation activity to facilitate drug discovery.

RESULTS

Design and validation of a HAT1 high-throughput enzymatic assay

HAT1 chemical probe screens or high-throughput enzymatic assays have yet to be described. Therefore, we designed a HAT1 enzymatic assay to specifically and rapidly measure the HAT1 di-acetylation product using a click-chemistry approach (Fig. 1A). The click-chemistry acetyl-CoA analog 4-pentynoyl-CoA allows for enzymatic transfer of an alkyne handle via an acylation reaction. First, the HAT1 enzyme complex (HAT1 + Rbap46) purified from human cells is co-incubated with 4-pentynoyl-CoA cofactor and a biotinylated H4 N-terminal peptide to allow for HAT1-dependent pentynoylation of the peptide substate at lysines 5 and 12. Then, reaction products are bound to a neutravidin capture plate, followed by Cu(I)-catalyzed alkyne-azide cycloaddition with biotin-azide. After streptavidin-HRP binding, fluorescence signal can be detected by peroxidation of Amplex Red.

Figure 1: Design and validation of a HAT1 high-throughput enzymatic assay.

A. Schematic of HAT1 acetylation assay. HAT1/Rbap46 purified enzyme complex is incubated with 4-pentynoyl-CoA and histone H4 N-terminal biotinylated peptide in the presence or absence of test compounds. Then reaction products are bound to neutravidin 96-well plate, washed, functionalized by copper(I)-catalyzed cycloaddition click chemistry with biotin-azide. Then, streptavidin-HRP is bound and detected by Amplex Red fluorescence reaction.

B. Standard curve generated by mixing biotinylated positive control peptide (H4 N-terminal peptide with propargylglycine residues substituted for lysines 5 and 12) with the unmodified histone H4 N-terminal peptide of equal length, followed by binding products to neutravidin plate, click chemistry addition of biotin-azide, streptavidin-HRP binding and Amplex Red detection. Black line indicates nonlinear curve fit through all data. Blue dashed line is a linear fit for data from 0-50% positive control (R²=0.98). Limit of detection (LoD) and limit of quantitation (LoQ) are mean ± SD for three independent replicates.

C. High-throughput characterization of technical replicates of 100%, 50% or 0% propargylglycine containing H4 peptides mixed with unmodified peptides spotted in checkboard pattern in 96-well neutravidin-plates. Z' score and signal window are calculated for the difference between 0-100% (top) and 0-50% (below) peptide mixtures.

D. High-throughput characterization of biological replicates of HAT1 acetylation reactions treated with either DMSO control or positive control bisubstrate inhibitor H4K12-CoA (10 μM).

E. Dose-response study of HAT1 acetylation assay treated with H4K12-CoA. IC₅₀ was calculated by 3 parameter least-squares regression assuming Hill slope −1.0.

This assay was dependent on exogenous expression and co-purification of both HAT1 and Rbap46 from a human cell line (Fig. S1A). In contrast, utilization of HAT1 alone was less active, as previously described.³⁰ Next, assay performance was optimized (Fig. S1B) and quantified. A standard curve was generated using a histone H4 peptide manufactured to have terminal alkynes at the 5^th and 12^th positions of the H4 N-terminal peptide (Fig. 1B) allowing for quantification of reaction products. The assay demonstrated linear performance (R² = 0.98) when up to 50% true positive control peptides were used. Therefore, assay conditions were calibrated to produce signal within this upper threshold. Reaction conditions included 19 nM enzyme, 1.75 μM H4 peptide, 100 μM DTT, and 100 μM 4-pentynoyl-CoA to yield 50% product conversion rate in a 1-hour reaction at 37°C. All reactions were performed in the presence of 0.01% non-ionic detergent (Triton X-100 or NP40) to prevent aggregation artifacts.³¹ The limit of detection (LoD) was 1.6 ± 0.89% defined as the percentage of positive control peptide that gave a fluorescence reading corresponding to 3x the standard deviation of the unacetylated negative control peptide above baseline. The limit of quantitation (LoQ) was 5.7 ± 3.1% defined as the percentage of positive control peptide that gave fluorescence output corresponding to 10x the standard deviation greater than the baseline negative control.³² Thus the assay was designed to operate at fluorescent detection values greater than the LoQ.

We next assessed the relative preference of HAT1 for 4-pentynoyl-CoA versus the natural cofactor acetyl-CoA. Titration of increasing concentrations of acetyl-CoA into reactions with the previously optimized concentration of 4-pentynoyl-CoA (100 μM) showed that 0.18 μM of acetyl-CoA could inhibit 50% of the enzyme activity towards the non-native cofactor, whereas 1 μM of acetyl-CoA completely suppressed the pentynoylated product (Fig. S1C). Thus, the enzyme prefers the native cofactor with >100-fold preference compared to the click-enabled cofactor.

Next, high-throughput assay performance with 4-pentynoyl-CoA was characterized using technical controls. A 96-well plate was arrayed in checkboard configuration consisting of H4 N-terminal peptides with 0%, 50% or 100% alkyne-containing positive control peptides (Fig. 1C). This allowed us to calculate the Z' factor and the signal window (SW) for the maximal range of the assay (0-100%) and also for the linear range of the assay (0-50%). A Z' factor between 0.5 and 1 indicates the assay performs adequately for high-throughput screening (HTS) as it indicates a robust dynamic range. Similarly, a SW > 2 also indicates a wide separation between positive and negative controls suitable for HTS. Both the maximal range (0-100%) and linear range (0-50%) of the assay demonstrated excellent performance characteristics (Z'> 0.5, SW >2; Fig. 1C). Therefore, the assay is technically suitable for HTS.

To determine if the assay maintained appropriate HTS parameters under biological conditions, the HAT1/Rbap46 complex was incubated with and without the H4K12-CoA bi-substrate inhibitor (positive control inhibitor), which caused robust inhibition with suitable high-throughput performance metrics Z' and SW (Fig. 1D). To further demonstrate the biological characteristics of the assay we measured the IC₅₀ for HAT1 inhibition by the bi-substrate inhibitor. H4K12-CoA inhibited HAT1/Rbap46 activity with an IC₅₀ of ~1 μM (Fig. 1E). As this bi-substrate inhibitor has been shown to be a specific inhibitor of HAT1, but not other acetyltransferases,¹⁹ this validates the specificity of this HAT1 high-throughput assay. Finally, although lysyl-CoA is a validated bi-substrate inhibitor for CBP/p300,³³ it had no inhibitory activity towards HAT1/Rbap46 in our assay (Fig. S1D), in accordance with prior results from low-throughput assays,¹⁹ thereby demonstrating assay specificity. Together these results demonstrate the ability of the HAT1/Rbap46 assay to detect biologically relevant acetylation.

Structural modeling coupled with enzymatic screening to identify HAT1 inhibitors

Human HAT1 has been crystalized at high-resolution (1.9-Å) revealing residues that comprise binding surfaces for the histone H4 N-terminal substrate and the acetyl-CoA cofactor.³⁴ The pantotheine moiety of acetyl-CoA resides in a canyon that orients the thioester bond in close proximity to the lysine 12 side-chain of H4, which is the preferred substrate site for acetyl transfer.^8,34 We used this structural data to build a virtual docking workflow to identify small molecules with appropriate physiochemical properties to occupy the cofactor binding site (Fig. 2A). The NCI open collection of 265,242 molecules was screened against the HAT1 cofactor binding sites using Schrodinger Glide-based virtual screening with increasing precision cutoffs (see Methods). We focused on the top ~0.1% of compounds yielding 274 hits from the starting collection. Of these, 35 were obtained and screened with our HAT1 acetylation assay at a single dosage (100 μM, equivalent to the cofactor concentration, Fig. S2). The best compound (NSC-42186) was a natural-product derivative of riboflavin that displayed 31% inhibition at 100 μM (Fig. 2B). NSC-42186 showed appropriate dose-response activity with an enzymatic IC₅₀ of 62.6 μM (95% CI: 29 – 130 μM; Fig. 2C). Thus, this combined virtual and enzymatic screening approach identified candidate small molecule candidate HAT1 inhibitors.

Figure 2: Structural modeling coupled with enzymatic screening to identify HAT1 inhibitors.

A. Schematic of virtual docking workflow used to pre-select small molecules capable of binding the the acetyl-CoA cofactor binding site (red) of the HAT1 crystal structure 2P0W. The entire NCI open chemical library was screened with Schrodinger Glide with SP and XP modes to select the top 0.001% of compounds predicted to bind. Compounds were obtained from the NCI/DTP repository.

B. Thirty-five compounds from the NCI/DTP repository screened in the HAT1 acetylation assay. Inset is structure of the best hit NSC-42186. Positions around the isoalloxazine core are numbered for further reference throughout the text.

C. Dose-response of NSC-42186 treatment in the HAT1 acetylation assay. IC₅₀ was calculated by 3 parameter least-squares regression assuming Hill slope −1.0. N = 5 independent replicates.

D. Chemical structures of riboflavin analogs and derivatives obtained and tested.

E. Dose-response of riboflavin analogs in (D) tested in the HAT1 acetylation assay.

NSC-42186 contains 7,8-di-chloro substitutions of the tri-cyclic isoalloxazine ring that are the sole features that distinguish it from the 7,8-di-methyl isoalloxazine of riboflavin (ring numbering scheme is shown in Fig. 2B). Riboflavin, commonly known as vitamin B2, is an essential nutrient in metazoans where it is further metabolized to flavin-mononucleotide (FMN) and flavin-adenine-dinucleotide (FAD), which are cofactors for flavin-containing proteins.³⁵ To determine if a flavin class effect contributed to HAT1 inhibition the enzymatic assay was repeated with other flavins including riboflavin, di-methyl-isoalloxazine, FMN, FAD, and riboflavin tetrabutyrate (Fig. 2D). Riboflavin and riboflavin tetrabutyrate inhibited HAT1 enzymatic activity with low-micromolar IC₅₀s of 20, and 17 μM, respectively (Fig. 2E). However, there was no detectable inhibitory activity for di-methyl-alloxazine, FMN, nor FAD. Because riboflavin, FAD and FMN have similar redox potentials³⁶ it is unlikely that redox cycling is a common mechanism for HAT1 inhibition with this class of compounds. Furthermore, we were unable to detect free radical generation by NSC-42186 under the above assay conditions. Therefore, certain riboflavin analogs, but not all, can modulate HAT1 acetylation activity and this effect appears to be independent of redox cycling.

Screening of focused libraries to develop structure-activity relationships

As various riboflavin-derived analogs affected HAT1 enzymatic activity, we assessed an expanded collection of similar compounds. Computational structure searches were performed to identify other compounds in the NCI open library with similarity to the isoalloxazine core of NSC-42186. Of these, 30 additional compounds were experimentally characterized with our assay (Fig. 3A, Fig. S3A). The top hit (NSC-3064) also contained a 7,8-di-methyl-isoalloxazine core but with a different N₁₀ appended sidechain comprised of an acetoxyethyl (Fig. 3B). Also, the fifth best hit (NSC-275266) also contained a 7,8-dimethyl-isoalloxazine core but lacked the amino group at position 4.

Figure 3: Screening of focused libraries to develop structure-activity relationships.

A. Structural similarity screen of the isoalloxazine core was used to select similar multi-cycle cores from the NCI open compounds directory, which were obtained from NCI/DTP and tested for inhibitory properties in the HAT1 acetylation assay. Compounds were screened in duplicate on separate days a mean % inhibition values are plotted (Fig. S3A). Red indicates the top 6 compounds.

B. Chemical structures of the top 6 compounds identified in A.

C. A focused library of 54 compounds containing the isoalloxazine core, as well as related structures, was screened by the HAT1 acetylation assay. Compounds were screened in duplicate on separate days and mean % inhibition values are plotted (Fig. S3B). Red indicates the top 8 compounds.

D. Chemical structures of the top 8 compounds from C with greatest inhibition.

E. R₂-groups of compounds from C that were inactive in the assay.

Therefore, the 7,8-di-substituted-isoalloxazine structure is repeatedly found in compounds with HAT1-inhibitory activity, although the N₁₀-appended sidechain can vary.

Based on the detection of multiple riboflavin analogs with HAT1 inhibitory properties we next screened a focused library of 54 compounds that all contained a core tri-cyclic ring structure similar to isoalloxazine (Fig. 3C, Fig. S3B). This library contained molecules with R-group substitutions at four different sites around the isoalloxazine core (Fig. 3D). R-groups from the top 8 most potent compounds are summarized in table format (Fig. 3D). The top two compounds are highly similar with chloro- and ethyl- substitutions at either R₁ or R₂ positions and ribityl-groups at position R₃. This screen also allowed us to identify several substitutions that dramatically impaired inhibitory activity, for example, bulky or aliphatic substitutions at R₂ (Fig. 3E). In contrast, aromatic substitutions at R₄ were partially tolerated (Fig. 3D). Therefore, this focused library of isoalloxazine derivatives allowed for elucidation of structural determinants associated with HAT1 inhibitory activity.

Medicinal chemistry optimization of riboflavin analog 7-chloro-, 8-ethyl-isoalloxazine

Thus far our studies have identified a series of compounds based on the isoalloxazine tricyclic ring system that contains HAT1 inhibitory activity when modified at specific positions. The most potent inhibitors discovered included chloro- or ethyl- substitutions at the 7,8 positions and a sidechain at amino 10. Therefore, we undertook a medicinal chemistry approach to synthesize a library of compounds that incorporated these features. Using a 7-chloro-, 8-ethyl-isoalloxazine core, analogs were synthesized with R-groups at the amino-10 side-chain position.

The derivatives synthesized are depicted in 10 schemes. Schemes 1, 2, and 3 represent the synthesis of ester and carbamate derivatives of compound 6, respectively. Scheme 4 shows the synthesis of a diverse range of N-alkylated derivatives 16a-p. Schemes 5 to 9 depict the synthesis of alkyl oxy ethyl, arylalkyl oxy ethyl, and aryl oxy ethyl functionalized derivatives 20a-j; 24a-g; 28, 33, and 37a-p, respectively. Scheme 10 illustrates the synthesis of amide and sulfonamide containing derivatives 42a-c and 43a-g, respectively. In general, intermediates were not isolated in all the above schemes and all reactions proceeded to the following steps without further purification. All the biologically tested products were purified and analyzed by ¹H-NMR and LCMS.

Scheme 1. Synthesis of compound 6, 7(a-b)^a.

^aReagents and conditions (a) NaBH₄, MeOH, −10 °C-0 °C, 1 h; (b) Et₃SiH, BF₃Et₂O, DCE, 50 °C, 16 h; (c) KNO₃, H₂SO₄, 0 °C, 30 min; (d) 2-aminoethan-1-ol, DMSO, 150 °C MW, 10 min; (e) Zn, NH₄Cl, EtOH:Water, 90 °C, 2.5 h; (f) Alloxan monohydrate, Boric acid, AcOH, 60 °C, 16 h; (g) corresponding acid, EDC.HCl, HOBt, DMAP, DMF, r.t., 12h;

Scheme 2. Synthesis of compound 10 ^a.

^a Re agents and conditions (a) CH₃COCl, K₂CO₃, DMF; (b) Zn, NH₄Cl, EtOH: Water, 90 °C, 2.5 h; (c) Alloxan monohydrate, Boric acid, AcOH, 60 °C, 16 h.

Scheme 3. Synthesis of carbamate derivatives 13(a-b)^a.

^aReagents and conditions: (a) (b) p-methoxy benzyl-chloride, KOH, DMSO, r.t, 2h; (b) corresponding isocyanates, TEA, DCM, r.t, 1h;(c) Triflic acid, DCM, 0 °C, 30 min.

Scheme 4. Synthesis of derivatives 16(a-p)^a.

^aReagents and conditions (a) corresponding amine, DMSO, 190 °C MW, 10 min; (b)Zn, NH₄Cl, EtOH:Water, 90 °C, 2.5 h; (c) Alloxan monohydrate, Boric acid, AcOH, 60 °C, 16 h

Scheme 5. Synthesis of compound 20a-j^a.

^aReagents and conditions (a) corresponding alkylhalides, ethanoiamine, NaH, DMR rt, 2 h; (b) 3, DMSO, 150 °C MW, 15 min; (c) Zn, NH₄Cl, EtOH:Water, 90 °C, 2.5 h; (d) Alloxan monohydrate, Bole acid, AcOH, 60 °C, 16 h.

Scheme 9. Synthesis of derivatives 37a-p ^a.

^aReagents and conditions (a) corresponding phenols, 2-chloroethan-1-amine hydrochloride, NaH, DMF, rt, 18 h; (b) DMSO, 190 °C MW, 20 min; (c) Zn, NH₄Cl, EtOH:Water, 90 °C, 2 h; (d) Alloxan monohydrate, Boric acid, AcOH, 80 °C, 2 h.

Scheme 10. Synthesis of amide derivatives 42a-c^a and Synthesis of sulfonamide derivatives 43a-g^a.

^aReagents and conditions (a) tert-butyl (2-aminoethyl)carbamate, DMSO, 150 °C, 18 h; <b)Zn NH₄Cl, EtOH:Water, 90 °C, 2.5 h; (c) Alloxan monohydrate, Boric acid, AcOH, 60 °C, 16 h: (d) TFA, DCM, rt, 1 h (e) CH₃COCl, K₂CO₃, DMF, (f) corresponding acid, HATU, DIPEA, DMF, rt, 16 h; (g) corresponding sulfonyl chlorides, TEA, DMF or K₂CO₃, DMF.

Preparation of 7-Chloro-8-ethyl-isoalloxazine core library compounds

Synthesis of compounds 6, 7, and 8:

Scheme 1:

The target molecules 6 and 7a-b were prepared according to Scheme 1. First, 1-(2,5-dichlorophenyl)ethan-1-one was converted into corresponding alcohol 1 by treating with NaBH₄ in methanol. Intermediate 1 was reduced in the presence of Et₃SiH and BF₃Et₂O to give compound 2, which was reacted with KNO₃ in conc. H₂SO₄ to afford 1,4-dichloro-2-ethyl-5-nitrobenzene 3. Intermediate 3 was subjected to an aromatic nucleophilic substitution reaction with 2-aminoethan-1-ol in DMSO under microwave irradiation conditions to yield compound 4. Subsequently, the nitro group was reduced into amino functionality with Zn and NH₄Cl to procure compound 5, which was cyclized with alloxan monohydrate to accomplish the final compound 6. Compound 6 was treated with different acids in the presence of EDC.HCl and HOBt in DMF to afford the corresponding esters 7a-b.

Synthesis of compound 10:

Scheme 2:

Intermediate 4 was acetylated with acetyl chloride in the presence of K₂CO₃ to afford compound 8. Compound 8 was reduced to give aniline 9, which was reacted with alloxan monohydrate in acetic acid to accomplish compound 10.

Synthesis of compounds 11 and 13a-b:

Scheme 3:

The NH group in compound 6 was protected with a PMB group to synthesize the carbamate derivatives to give intermediate 11. Subsequently, compound 11 was subjected to reactions with various isocyanates to procure corresponding carbamate derivatives. Finally, the PMB group was deprotected with triflic acid in DCM to accomplish final compounds 13a-b.

Synthesis of compounds 16a-p:

Scheme 4:

Compound 3 was subjected to aromatic nucleophilic substitution with 2-(pyridin-3-yl)ethan-1-amine to procure the corresponding intermediate 14a. The nitro group on intermediate 14a was reduced to an amine with Zn and NH₄Cl to afford intermediate 15a, which was cyclized with alloxan monohydrate in acetic acid solvent to accomplish the final compound 16a.

Compounds 16b-j were prepared from intermediate compound 3 by treating with corresponding aromatic alkyl amines following the same reaction sequence as compound 16a.

Synthesis of compounds 16k-p:

Compound 3 was subjected to aromatic nucleophilic substitution with a series of aliphatic alkylamines to procure corresponding intermediates 14k. The nitro group on intermediate 14k was reduced to an amine with Zn and NH₄Cl to afford intermediate 15k, which was cyclized with alloxan monohydrate in acetic acid solvent to accomplish final compounds 16k.

Compounds 16l-p were prepared from compound 3 and treating with corresponding aliphatic alkyl amines following the same sequence as compound 16k.

Synthesis of compounds 20a-j:

Scheme 5:

2-Aminoethan-1-ol was alkylated with p-fluorobenzylbromide in the presence of NaH in DMF to procure corresponding O-alkylated amines 17a. Compound 3 was subjected to aromatic nucleophilic substitution with intermediate 17a to afford intermediate 18a. The nitro group on intermediate 18a was reduced to an amine with Zn and NH₄Cl to afford intermediate 19a, which was cyclized with alloxan monohydrate in acetic acid solvent to accomplish the corresponding final compound 20a.

Compounds 20a-j were prepared from ethanolamine by treating with the corresponding aromatic alkyl halides to yield their corresponding ether amines, which were treated with 3 following the same sequence as compound 20a.

Synthesis of compounds 24a-g:

Scheme 6:

Scheme 6. Synthesis of derivatives 24a-h ^a.

^aReagents and conditions (a) corresponding alcohols, 2-chloroethan-1-amineh/drogen chloride, NaH, DMF,0 °C it, 4 h; (b) 3, DMSO, 170 °C for 5h; (c) 2n, NH₄Cl, EtOH:Water, r.t., 15 min; (d) Alloxan monohydrate, Boric acid, AcOH, 50 °C, 15 min

Hydrochloride salts of 2-chloroethan-1-amine were alkylated with 2-methylpropan-1-ol in the presence of NaH in DMF to procure corresponding O-alkylated amines 21a. Key intermediate 3 was subjected to aromatic nucleophilic substitution with intermediates 21a to afford intermediate 22a. The nitro group on intermediate 22a was reduced to an amine with Zn and NH₄Cl to afford intermediate 23a, which was cyclized with alloxan monohydrate in acetic acid solvent to accomplish the corresponding final compound 24a.

Compounds 24a-g were prepared from 2-chloroethan-1-amine by treating with corresponding alcohols to yield corresponding ether amines, which were treated with compound 3 by following the same sequence as for compound 24a.

Synthesis of compound 28:

Scheme 7:

Scheme 7. Synthetic approach for compound 28 ^a.

^aReagents and conditions (a) tert-butyl (2-bramoethyl)carbamate, NaH, THF, 0 °C-rt, 3 h; (b) 3, DMSO, 195 °G MW, 15 min; (c) Zn, NH₄Cl, EtOH:Water, 80 °C, 0.5 h; (d) Alloxan monohydrate, Boric acid, AcOH, 80 °C, 15 h.

Pyrazin-2-ylmethanol was treated with tert-butyl (2-bromoethyl)carbamate compound in the presence of NaH in THF solvent to afford ether compound 25 with the observed loss of N-Boc protection. Intermediate 3 was subjected to aromatic nucleophilic substitution with intermediate 25 to afford intermediate 26. The nitro group on intermediate 26 was reduced to an amine with Zn and NH₄Cl to afford intermediate 27, which was cyclized with alloxan monohydrate in acetic acid solvent to accomplish the corresponding final compound 28.

Synthesis of compound 33:

Scheme 8:

Scheme 8. Synthesis of derivatives 33^a.

^aReagents and conditions (a) 2-chioroethan-1-amine hydrochloride, NaH, DMF, rt, 2 h; (b) 3, DMSO, MW for 45 min at 190 °C; (c) Zn, NH₄Cl, EtOH:Water, r.t., 15 min; (d) Alloxan monohydrate, Boric acid, AcOH, 50 °C, 15 min; (e)TFA in DCM 0 °C to r.t. for 2h.

Hydrochloride salts of 2-chloroethan-1-amine were alkylated with tert-butyl 4-(hydroxymethyl)piperidine-1-carboxylate in the presence of NaH in DMF to procure O-alkylated amine 29. Key intermediate 3 was subjected to aromatic nucleophilic substitution with intermediates 29 to afford intermediate 30. The nitro group on intermediate 30 was reduced to an amine with Zn and NH₄Cl to afford intermediate 31, which was cyclized with alloxan monohydrate in acetic acid solvent to accomplish corresponding tert-butyl 4-((2-(7-chloro-8-ethyl-2,4-dioxo-3,4-dihydrobenzo[g]pteridin-10(2H)-yl)ethoxy)methyl)piperidine-1-carboxylate compound 32. Compound 32 tertiary butoxy carbonyl (Boc) group was deprotected with TFA in DCM solvent to afford final compound 33 as a TFA salt.

Synthesis of compounds 37a-p:

Scheme 9:

Hydrochloride salts of 2-chloroethan-1-amine were alkylated with p-cresol in the presence of NaH in DMF to procure corresponding O-arylated amine 34a. Intermediate 3 was subjected to aromatic nucleophilic substitution with intermediate 34a to afford intermediate 35a. The nitro group on intermediate 35a was reduced to an amine with Zn and NH₄Cl to afford intermediate 36a, which was cyclized with alloxan monohydrate in acetic acid solvent to accomplish corresponding final compounds 37a.

Compounds 37b-p were prepared from 2-chloroethan-1-amine by treating with corresponding phenols to yield corresponding ether amines intermediates, which were further treated with compound 3 following the same sequence as compound 37a.

Synthesis of compounds 42a-c:

Scheme 10:

Intermediate 3 was subjected to aromatic nucleophilic substitution with tert-butyl (2-aminoethyl)carbamate to afford intermediate 38. The nitro group on intermediate 38 was reduced to an amine with Zn and NH₄Cl to afford intermediate 39, which was cyclized with alloxan monohydrate in acetic acid solvent to yield 40. The Boc group was deprotected from 40 using TFA in DCM to afford intermediate 41 as a TFA salt. Compound 41 was treated with various acids to accomplish corresponding amide compounds 42a-c.

Synthesis of compounds 43a-g:

Scheme 10:

Compound 41 was treated with a series of sulfonyl chlorides to accomplish corresponding sulfonamides as final compounds 43a-g.

Altogether, 73 synthesized analogs were tested for HAT1 inhibitory activity together with 11 additional compounds with structural similarity (84 compounds total). Of these 84 compounds, 11 (13%) caused at least 50% inhibition of HAT1 activity at 100 μM (Fig. 4A, Fig. S4A, B). Single-dose inhibition studies identified analog JG-2016 (24a) as the most potent HAT1 inhibitor, which caused 69% inhibition at 100 μM (Fig. 4A). This analog has a 1-ethoxy-2-methyl-propane sidechain at the amino-10 position of the isoalloxazine core (Fig. 4B). Dose-response studies showed it to inhibit HAT1 enzymatic activity with IC₅₀ 14.8 μM (95% CI: 9.6 – 22.9 μM; Fig. 4C), which is approximately a 2-4 fold improvement over the original hit compound NSC-42186.

Figure 4: Medicinal chemistry optimization of riboflavin analogs to yield JG-2016 (24a).

A. Inset shows chemical structure of the core compound used for chemical library generation with R-group at the 10-amino position. Graph shows the mean % inhibition values for each compound performed in duplicate on separate days. See also Fig. S4.

B. Chemical structures of compounds tested in A. Compound name is bolded and below are % inhibition values. Dashed lines indicate bonds joining to the 10-amino position. For compounds that vary from the R-group library the full structure is provided.

C. Dose-response of compound JG-2016 in the HAT1 acetylation assay. IC₅₀ was calculated by 3 parameter least-squares regression assuming Hill slope −1.0. Mean ± SD of triplicate reactions is plotted. Inset: JG-2016 (24a) structure.

D. Dose-response enzyme assays for 7 acetyltransferases were performed in the presence of JG-2016 (10-point dose curve starting at 100 μM, followed by 3-fold serial dilutions) to calculate the IC₅₀ values for enzyme inhibition. Assay conditions: 50 mM Tris-HCl, 0.1 mM EDTA, 250 mM NaCl, 1% DMSO, pH 8.0, 3 μM ³H-Acetyl-CoA, 10 μM enzyme and 5 μM substrate, reaction time 1 hour at 30°C, substrate conversion rate 5-20%.

In addition, this medicinal chemistry approach identified structure-activity relationships. For example, bulky sidechains interfered with enzyme inhibition, most prominently the 1-ethoxymethyl-benzene sidechains substituted at the meta and para positions in compounds 24g, 37i, 20b and others (Fig. 4B), suggesting a steric effect. In summary, these studies identify active and inactive amino-10 position sidechains with HAT1 enzyme inhibitor properties on an isoalloxazine scaffold.

Mechanism of HAT1 inhibition by JG-2016 (24a)

These structure-activity studies nominated the analog JG-2016 (24a) for further study as it was the most potent HAT1 inhibitor identified in enzymatic studies. Synthesis of this molecule was scaled-up to the 5-gram scale, and its structure was confirmed by crystallization (Supp. Methods, Fig. S5). To validate that this compound represented a true enzymatic inhibitor and not an assay-interfering compound due to the intrinsic fluorescence of the isoalloxazine core, further characterization of assay conditions in the presence or absence of the compound were performed. Standard curves were prepared in the presence of JG-2016 or equivalent amounts of vehicle (DMSO) as a control (Fig. S6A). The fluorescence activity in the standard curve is generated by titrating a defined amount of biotinylated H4 n-terminal peptide with lysine 5 and 12 substituted for propargylglycines to mimic the HAT1-dependent acylation that occurs in the presence of 4-pentynoyl-CoA. This allowed us to assess the robustness of assay steps in the presence of JG-2016 including binding to neutravidin plates, copper-catalyzed azide-alkyne cycloaddition of biotin-azide, streptavidin-HRP binding and finally Amplex Red oxidation and fluorescence detection. The standard curves generated in the presence of JG-2016 were indistinguishable from control conditions (Fig. S6A, R²=0.99). In addition, neither the original hit NSC-42186, nor JG-2016, have been previously identified as pan assay interfering compounds (PAINS).³⁷ Taken together, JG-2016 does not interfere with any assay steps, and instead, likely disrupts HAT1-dependent peptide acylation.

The ability of JG-2016 (24a) to impair peptide acetylation more broadly was tested by assaying its inhibitory activity against seven other human histone acetyltransferases. JG-2016 had modest inhibitory activity towards CBP, MYST2/KAT7, p300 (IC₅₀ values 90.41, 84.82, 74.25 μM, respectively; Fig. 4D) that were at least 5-fold higher than that observed towards the HAT1 complex. Additionally, JG-2016 had minimal or undetectable inhibitory activity towards GCN5, PCAF, KAT5 or MYST4/KAT6b. These results suggest that JG-2016 has specific activity towards the HAT1 complex, which is greater than that towards other tested human acetyltransferases. In addition, JG-2016 enzyme inhibition assays carried out in the presence of acetyl-CoA, instead of 4-pentynoyl-CoA, yielded similar dose-response relationships for HAT1 inhibition (Fig. S6B; IC₅₀ = 19.1 μM). Finally, we tested whether JG-2016 could impair an FAD-dependent oxidase, however detected no significant inhibitory activity (Fig. S6C), suggesting that JG-2016 is not a broadly inhibitory compound and that it should not compete with other flavin-dependent cofactors.

Next, assays for target engagement were performed to demonstrate that JG-2016 could directly modulate the HAT1:Rbap46 complex. SPR was employed to provide confirmation of direct binding of JG-2016 to HAT1 complex. HAT1/Rbap46 purified complex was immobilized to a CM5 sensor chip via amine coupling. JG-2016 analyte was applied (dose range: 9.14 nM – 20 μM) and response sensorgrams demonstrated evidence of binding (Fig. S6D). Steady state response values were used to calculate a K_D for JG-2016 binding to HAT1 complex using a one site specific saturation model (Fig. 5A). We obtained a K_D of 5.2 μM (95% CI 4.0 – 8.8 μM). This is in reasonable agreement with our other enzymatic and biophysical results.

Figure 5: Mechanism of action of JG-2016 (24a).

A. SPR analysis of HAT1/Rbap46 complex immobilized on CM5 chip by amine-coupling. Analyte JG-2016 was applied at indicated concentrations (9.14 nM, 27.4 nM, 82.3 nM, 247 nM, 741 nM, 2.22 μM, 6.67 μM, 20 μM) and K_D was determined by steady state analysis.

B. CETSA assay performed in A549 cells treated with JG-2016 (20 μM) for 1 hour or DMSO control. HAT1 protein expression was detected by microcapillary immunoassay.

C. Quantitative CETSA band from microcapillary immunoassay from three biological replicate experiments. P-value by sum of squares F test.

D. HAT1 enzyme kinetics for increasing concentrations of 4-pentynoyl-CoA were performed in the presence or absence of 50 μM JG-2016 at timepoints 0, 5, 10, 15 minutes of reaction time, analyzed jointly by acetyl-click assay. Datapoints are plotted and curves represent competitive inhibition least squares regression modeling of the data. Michealis-Menton K_m were calculated for each dataset.

E. HAT1 enzyme kinetics for varying concentrations of H4 peptide were performed in the presence (n=1) or absence (n=3) of 50 μM JG-2016 at timepoints 0, 5, 10, 15 minutes of reaction time, analyzed jointly by acetyl-click assay. Datapoints are plotted and curves represent noncompetitive inhibition least squares regression modeling of the data. Michealis-Menton K_m were calculated for each dataset.

Experiments were then performed to determine whether JG-2016 could also bind HAT1 in cells. Cellular thermal shift assays (CETSA) were performed in the A549 cell line. This showed that JG-2016 treatment led to increased thermal stability of HAT1, compared to DMSO treatment (Fig. 5B, C). This indicates that JG-2016 bound to HAT1 in cells.

The mechanism by which JG-2016 bound to HAT1 was further investigated by competition assays with 4-pentynoyl-CoA and H4 peptide in recombinant HAT1 kinetics assays. Reactions were performed with independent titrations of either the cofactor (4-pentynoyl-CoA) or the substrate (H4 peptide). Curve fitting demonstrated that JG-2016 best fit a model of competitive inhibition with the cofactor (>99% probability compared to noncompetitive model by Akaike’s Information Criteria; Fig. 5D). Correspondingly, treatment with JG-2016 best fit a non-competitive inhibition model with the peptide substrate (>92% probability compared to competitive model; Fig. 5E). Therefore, the JG-2016 compound likely binds HAT1 at the cofactor-binding site and does not compete with the histone substrate.

Biological activity of JG-2016 (24a)

Given that JG-2016 (24a) directly engaged the purified HAT1 enzyme as well as HAT1 in cellulo we next assessed the effects of JG-2016 in cell lines. The triple-negative breast cancer cell line HCC1806 was treated with JG-2016, H4K12-CoA and the riboflavin analog T308463 at varying doses and cell growth was assessed by addition of resazurin, which is reduced to resorufin in proliferating cells and emits fluorescence at 590 nm (Fig. 6A). Although H4K12-CoA is a potent enzymatic inhibitor of HAT1 in cell-free assays, it likely does not cross cell membranes and may be susceptible to metabolic degradation; thus, we could detect no inhibitory activity against this cell line. In contrast, JG-2016 (24a) robustly inhibited cell growth (EC₅₀ 10.4 μM; Fig. 6A). Additionally, JG-2016 was a more potent cell growth inhibitor compared to a related compound T308463 (Fig. 6A) and the parent compound T308471 in HCC1937 (triple-negative breast cancer; EC₅₀=29.8 μM; Fig. 6B) and A549 (lung cancer; EC₅₀=1.9 μM; Fig. 6C) cell lines. The weak inhibitory activity of the T308 compounds with 10-ribityl sidechains mirrors the minimal toxicity of riboflavin which can be tolerated at mega-doses in animals due to urinary excretion.³⁸ Thus, the substituted isoalloxazine scaffold derivative JG-2016 has distinct biological properties compared to classical flavins.

Figure 6: In cellulo characterization of JG-2016 (24a).

A. Dose-response of riboflavin analogs or H4K12-CoA bisubstrate inhibitor in the HCC1806 cell lines with EC₅₀ for JG-2016 indicated.

B. Dose-response of riboflavin analogs in the HCC1937 cell lines with EC₅₀ for JG-2016 indicated.

C. Dose-response of riboflavin analogs in the A549 cell line with EC₅₀ for JG-2016 indicated.

D. hTert-HME1 cells were treated with indicated concentrations of JG-2016 in MEGM media supplemented with 1% dialyzed BSA for 12 hours. Then nascent histone acetylation was assessed by microcapillary immunoassays.

E. hTert-HME1 cells were starved of EGF for 16 hours, then pre-treated with JG-2016 for 30 minutes followed by stimulation with EGF for 8, 10, or 12 hours. Then nascent histone acetylation was assessed by microcapillary immunoassays.

The EC₅₀ for growth inhibition was next assessed in the HCC1806 cell line for 42 flavins (selected for a range of HAT1 enzymatic IC₅₀s), as well as other isoalloxazine derivatives and control treatments (Fig. S7A-E). In these experiments, JG-2016 (24a) was among the most potent inhibitors of cell growth. In contrast, some analogs (eg., roseoflavin) had strong cell growth inhibitory properties but were inactive in the HAT1 enzymatic assay. Among all tested compounds, the correlation of cellular EC₅₀ for cell growth versus enzymatic IC₅₀ for inhibition demonstrated that JG-2016 had the most optimized combination of these parameters (Fig. S7F).

Given the properties of JG-2016 as an enzymatic inhibitor of HAT1 and a suppressor of cell growth we next tested if this compound could inhibit HAT1 acetylation in cellulo. We previously demonstrated that acute suppression of HAT1 protein levels led to decreased H4 lysine 5 and 12 acetylation of nascent histones, as well as decreased total H4 protein levels in the hTert-HME1 cell line.² When these cells were treated with JG-2016 we observed dose-dependent inhibition of H4 lysine 5 and 12 acetylation by site-specific antibody-based capillary immunoassay (Fig. 6D).³⁹ Similarly, time-course analysis of EGF starvation followed by stimulation to induce nascent histone acetylation also showed on-target inhibition as early as 8 hours post-stimulation that persisted through 12 hours (Fig. 6E). At some timepoints, decreased H4 protein levels were also observed, consistent with prior studies of the effects of HAT1 depletion.² These experiments indicated that treatment with JG-2016 can impair HAT1 dependent acetylation in cells.

As JG-2016 treatment could decrease nascent H4 acetylation in cells, this led us to next test whether JG-2016 treatment could impair tumor growth in pre-clinical mouse models. The A549 model was chosen because of the low IC₅₀ required to impair cell proliferation by JG-2016 treatment (1.9 μM; Fig. 6C). First, the A549 cell line was treated with HAT1-targeted shRNAs to demonstrate that HAT1 was required for tumor growth. A549 cells treated with shRNAs targeting the HAT1 mRNA evinced suppression of tumor growth in mice compared to cells treated with control shRNAs (p < 0.0001; Fig. 7A).

Figure 7: In vivo characterization of JG-2016 (24a).

A. A549 cells were treated with either control lentivirus shRNA or 3 separate lentiviral shRNAs targeting the HAT1 mRNA, then injected into bilateral flanks of NSG mice. N=3 control shRNA mice and 7 HAT1 shRNA mice. * indicates p< 0.0001 by least squares regression and extra sum-of-squares F-test.

B. Pharmacokinetic plasma values after i.p. injection of JG-2016 (24a, 100 mg/kg).

C. Plasma concentration of JG-2016 (24a) after a single i.p. injection (100 mg/kg).

D. A549 cells were implanted into NSG mice and tumors were allowed to establish for 2 weeks, then were treated with a single i.p. injection of vehicle or JG-2016 (24a) at the indicated doses. Tumors were harvested 24 h later and assessed for H4K12Ac levels by immunofluorescence. Scale bar = 40 μm.

E. Quantitation of H4K12Ac levels from immunofluorescence images in D. Median fluorescence per nuclei is calculated for all nuclei present in 2 independent images per treatment group. P-value by one-way ANOVA.

F. A549 cells were implanted into bilateral flanks of NSG mice, then vehicle control or JG-2016 at doses indicated were injected intraperitoneally every third day starting on day 13 (indicated by arrows). P-value calculated by least squares regression and extra sum-of-squares F-test. N = 5 mice per group.

Next, dose-finding studies showed that mice could tolerate JG-2016 (24a) up to 250 mg/kg or lower as a single intraperitoneal (i.p.) injection with minimal toxicity, but signs of distress were observed at doses of 500 mg/kg. Pharmacokinetic measurements were performed after JG-2016 was administered to mice by a single 100 mg/kg i.p. injection (Fig. 7B). There was rapid detection of JG-2016 in plasma with peak at 1 hour (C_max= 70.1 ± 1.55 μM), which persisted at 72 hours (2.05 ± 0.233 μM; Fig. 7C). Thus, JG-2016 (24a) is readily detectable in plasma after i.p. dosing and significant levels persist up to 72 hours after administration.

The good pharmacokinetic properties of JG-2016 (24a) allowed us to determine whether HAT1-dependent acetylation reactions could be impaired in vivo. A549 tumors were allowed to establish in NSG mice then a single i.p. dose of JG-2016 (24a) was administered and tumors were harvested 24 hours later. Histone H4 lysine 12 acetylation (H4K12Ac) were determined in tumor sections by immunofluorescence. We observed a dose-dependent decrease in H4K12Ac signal with increasing doses of JG-2016 (Fig. 7D, E). To determine if JG-2016 had anti-tumor activity A549 cells were implanted into flanks of mice and allowed to establish for 13 days, then treated with intraperitoneal injections of JG-2016 (Fig. 7F). Two dose levels of JG-2016 were used: 50 mg/kg and 100 mg/kg, both delivered once every three days. The three-day dosing interval was chosen to reflect persistence of the drug in plasma at 72 hours at concentrations greater than the EC₅₀ for A549 cells. Treatment with JG-2016 at both doses significantly impaired tumor growth compared to vehicle-treated control mice (p < 0.0001; Fig. 7F). A dose-response relationship was observed with the higher dose causing more profound suppression of tumor growth compared to the lower dose. This indicates that JG-2016 has anti-tumor activity in a pre-clinical model.

DISCUSSION

Multiple reports have suggested that HAT1 may be a cancer therapeutic target based on protein knockdowns or knockouts in various pre-clinical models.^2-5 These works, which include our own prior studies, motivated the search for small molecules capable of interfering with HAT1 enzymatic activity. We report here the development of a platform to identify and characterize HAT1 acetyltransferase activity based on a high-throughput, peptide-based, click-chemistry-enabled enzymatic assay. The advantages of this enzymatic assay include the utilization of the human HAT1/Rbap46 enzyme complex purified from human cells as opposed to a bacterial source. Also, this assay provides a direct readout of enzymatic activity on the peptide substrate without relying on coupled reactions that are prone to nonspecific inhibition. Although antibody-based methods could be used to interrogate enzyme activity, the acetyl-click assay avoids the biological variability and cost of antibodies. In addition, we have validated its high-throughput characteristics in 96-well plates, which should enable larger chemical screens to be performed. The click chemistry approach based on 4-pentynoyl-CoA as an acetyl-CoA analog should be adaptable to other acetyltransferases as well.⁴⁰ Mutations shown to improve 4-pentynoyl-CoA utilization have recently been reported,⁴¹ which could be incorporated into future studies. Finally, as reaction products are bound prior to functionalization and quantification, it allows for washing to remove potential assay-interfering compounds that commonly cause nonspecific signatures in other assays.⁴²

JG-2016 (24a) was prioritized based on a workflow that spanned virtual structure-based docking algorithms followed by enzymatic assays, focused library screening, medicinal chemistry and biologic assays. This compound retains the isoalloxazine core common to flavins with modifications to the 7,8, and 10 positions that led to significant improvements in enzyme inhibition and cellular growth inhibition. Prior work has demonstrated that flavins are selectively transported into cancer cell lines,^43,44 indicating that active transport of JG-2016 may be a useful feature for cancer-specific targeting. A family of riboflavin transporters have recently been identified and shown to specifically recognize and transport the isoalloxazine core rather than the ribityl sidechain.^45-49 Thus, JG-2016 retains chemical features that may allow for specific transport into cancer cells. Cancer-specific expression of riboflavin transporters may be a biomarker of sensitivity to this agent. This also raises the possibility of using isoalloxazine as a mechanism to achieve cancer-selective targeting of therapeutic agents, as has been previously demonstrated for another B class vitamin: folate (B9).⁵⁰

HAT1 sits at the intersection of cytoplasmic mitochondrial processes that generate acetyl-CoA and nuclear reactions that consume it to drive transcription of growth programs. HAT1 likely functions as a cytoplasm-to-nucleus acetyl-shuttle by acetylating nascent histones in the cytoplasm that then become rapidly de-acetylated upon insertion into chromatin leading to a nuclear acetyl pool. This work describes the isolation of the first small molecule compounds capable of modulating HAT1 enzymatic activity. These compounds may serve as chemical tools to further our understanding of HAT1 biology, its role in chromatin synthesis and the connection between cellular metabolism, epigenetics, and nuclear acetyl flux. JG-2016 or other related analogs may also serve as a chemical scaffold for more potent HAT1 inhibitors through structure-based design or chemical similarity screens. Finally, this work lays the foundation to eventually demonstrate that HAT1 may be a therapeutic vulnerability in cancers with an acceptable toxicity profile. Given the importance of HAT1 in the response to EGF stimulation and its role in histone maturation and cell cycle progression, this indicates that further efforts to target HAT1 may be fruitful for cancer therapy.

EXPERIMENTAL SECTION

Expression and Purification of human HAT1 complex

Full-length human HAT1 and Rbap46 were independently cloned into the pHEK293 vector (Takara Bio) with Gibson assembly. HAT1 was appended with a C-terminal FLAG tag, Rbap46 was unmodified. The pHEK293 vector was digested with XbaI then amplified with Phusion polymerase (Thermofisher) with primers (CGAGCCCGGGGAGGCTTAAG, CCTGCAGGCATGCAAGCTTG), then gel purified. HAT and Rbap46 were ordered as gBlocks (IDT) with ~20bp ends overlapping sequence with the pHEK293 vector. Gibson assembly was performed with NEBuilder HiFi DNA Assembly (NEB) and propagated in DH5α cells. 293F cells (Thermo-Fisher) were grown in suspension culture in a humified incubator with 8% CO₂ at 37°C with constant shaking at 120 RPM. 293F were seeded to a density of 5E5 cells/ml in 300 ml culture volume in a 1L baffle-free plastic Erlenmeyer flask with vented caps. The next day the transfection mix was prepared with 300 μg of pHEK293-HAT1-FLAG and 300 μg of pHEK293-Rbap46 in 30 mL of PBS with 1.2 mL of PEI (0.5 mg/ml), incubated for 15 minutes, then added to 300 mL culture of 293F. After 48 hours, cells were treated with 12.5 μM forskolin for 30 minutes at 37°C then collected by centrifugation and snap frozen. Cell pellets were lysed in 40 mL of RSB-500 buffer (20 mM Tris/pH7.5, 500 mM NaCl, 25 mM MgCl₂) with 0.1% triton-X-100 with Complete protease inhibitors (Roche). Lysate was sonicated at 10% amplitude for 10 seconds x 3, then centrifuged at 10K RPM for 10 minutes. Supernatant was collected and immunoprecipitated with FLAG M2 agarose (400 μL per 10 mL of extract) for 2 hours, then washed extensively in lysis buffer, then once in RSB-100 buffer (20 mM Tris/pH7.5, 100 mM, NaCl 25 mM, 25 mM MgCl₂) + 0.1% triton-X-100. HAT enzyme was eluted with FLAG peptide diluted to 0.5 mg/mL in EB (1.5 mL) for at least one hour at 4degC. Supernatant was collected and combined, washed twice with 15 mL Elution Buffer (EB: 25 mM HEPES pH 8.0, 100mM NaCl, 0.01% Triton-X) and concentrated by centrifugation in Amicon 10K cutoff filters and resuspended in 6 mL EB per original 300 mL culture volume. Agilent protein 230 chip was run to quantitate protein concentration, then snap frozen in 200 μL aliquots and stored at −80°C. HAT1 acetylation assays were performed to validate enzyme activity and then enzyme diluted in EB to yield approximately 1500 fluorescence units (25% full activity on standard curve) and re-frozen. Typically, this was a 1:40 dilution, resulting in a 37 nM enzyme stock.

Virtual drug screening workflow, docking, similarity searches

Schrodinger software (2018-3) was utilized to prepare the HAT1 crystal structure 2P0W for serving as a target model for virtual screening. The cognate ligand (acetyl-CoA) was used to generate the grid for the virtual screen. SDF file (NCI_Open_2012-05-01.sdf.gz) of the NCI/DTP open compounds was downloaded from https://cactus.nci.nih.gov/download/nci/. Using the Schrodinger Virtual Screening Workflow pipeline, the ligands were prepared by desalting, removing duplicates and generating conformers (max 32) at pH 7.0-7.2 using EPIK algorithm. The ligands were docked into the receptor grid in 3 successive steps of increasing precision levels (HTVS, SP, XP) with Schrodinger Glide program. The resulting docked poses were used to estimate the binding affinity of the ligand using MMGBSA method as implemented in Schrodinger. The ligands that had favorable Glide XPScore (< 10.5) and MMGBSA DGBIND (< −60) were prioritized for testing in the experimental assay. The initial hit compound (NSC-42186) was used as a template to find similar compounds from the NCI database using Schrodinger shape screen. The physiochemical properties of the resulting compounds were calculated using qikprop (Schrodinger) then filtered for predicted water solubility (QplogS < −1.0 & > −5.7) and reactive functional groups (#rtvFG = 0). The python input file for Schrodinger virtual screening workflow has been deposited online: https://github.com/quantumdolphin/enzyme-inhibition-assay. A docking model of NSC-42186 bound to HAT1 (2P0W) is provided in the SI.

HAT1 Acetyl-click Assay

Acetylation reactions were assembled from the following components: histone H4 peptide (1-23-GGK-biotin; Anaspec #AS65097) resuspended in DMSO to 0.1 mg/mL [34.8 μM], HAT1 enzyme pre-diluted in EB, 20x buffer (1M Tris pH 8.5, 0.1% NP40), 2 mM DTT, 4-pentynoyl-CoA dissolved in water to 1 mg/mL [1 mM]. A 20 μL reaction comprised 10 μL of enzyme, 1 μL of H4 peptide, 1 μL of 20x buffer, 1 μL of DTT pre-mixed and aliquoted to wells of a 96-well PCR plate on ice. Then 1 μL of DMSO or test compound dissolved in DMSO was added per well and mixed by gentle pipetting and allowed to incubate for 10 minutes on ice. Then 2 μL of 4-pentynoyl-CoA and 4 μL of water were pre-mixed and added together to wells, which were then gently mixed by pipetting, centrifuged briefly at 2500 RPM to collect contents, and incubated at 37degC for 1 hour. Contents were then either directly processed for reaction products or quenched with 20 μL of 8M urea and stored at −20degC until processing. Reaction contents were added to BSA pre-blocked black Neutravidin coated 96-well plates (Fisher # 15217) containing 80 μL of PBST per well and bound with gentle orbital shaking for 1 hour at room temperature. Wells were washed 200 μL PBST 3x 15 strokes (180 μL stroke volume) with a Hydra96 (Art Robbins Instruments). Reagents for click reactions were prepared as follows: 100 mM THPTA ligand in water, 20 mM CuSO4 in water, 300 mM sodium ascorbate in water, 2.5 mM Biotin Azide in DMSO. One click reaction contained 140 uL PBS, 10 uL of THPTA, 10 uL of CuSO4, 10 uL of Na Ascorbate, 20 uL of Biotin Azide. Click reagents were dispensed to each well and incubated at 37degC for 1 hour, then plate was washed 3x with PBST. Streptavidin-HRP (CST#3999S @ 0.224 mg/m) was diluted 1:10 in Streptavidin (0.224 mg/ml; EMD Millipore #189730), then further diluted 1:1000 in PBST. Steptavidin-HRP:streptavidin mix was added (100 uL per well) then incubated at room temp for 1 hour with gentle orbital shaking, then washed 3x with PBST. Amplex red detection reagents were combined as follows: 4.45 mL NaHPO4 buffer (1x = 50 mM final Concentration), 50 uL Amplex Red (20 mM diluted in DMSO), 500 uL of diluted H₂O₂. H₂O₂ was diluted from 30% stock to 3% in 1x NaHPO₄ buffer, then 22.7 μL of 3% H₂O₂, was diluted into 933 μL of 1x NaHPO₄ buffer (this is the H₂O₂ used for amplex reaction). 100 uL of amplex red reaction mix is added per well, incubated at room temp for 30 minutes protected from light then fluorescence excitation/emission 571/585 nm detected. Percent inhibition was calculated according to the following formula:$\frac{D-x}{D-\mathit{BG}}\ast 100$, where D is the fluorescence value of control reactions treated with DMSO only, X is value of reactions treated with test compounds, and BG is value of background wells (no enzyme added). Least squares regression was used to fit dose-response and competitive versus non-competitive inhibition curves.

For HAT1 acetylation assays with acetyl-CoA, identical reactions were carried out with acetyl-CoA in place of 4-pentynoyl-CoA. Then reaction products were spotted onto nitrocellulose membranes and dot blotted with anti-H4-lysine-12 antibodies. Immunoblot signal was quantified by densitometry.

HAT1 Acetyl-click Standard Curve

A positive control H4 N-terminal peptide was synthesized (Genscript) with sequence: SCRG[Pra]GGKGLG[Pra]GGAKRHRKVLRGG[Lys(Biotin)], where [Pra] denotes Propargylglycine. Peptide was resuspended at 0.1 mg/mL in DMSO, then mixed with H4 N-terminal peptide (Anaspec #AS65097) to create a standard curve. These mixtures were bound to neutravidin plates, functionalized by click chemistry, bound with streptavidin-HRP and reacted with amplex red as described above for the HAT1 acetylation assay. LoD was calculated as the assay baseline (negative controls) plus 3x the standard deviation of the baseline measurements. LoQ was calculated as the assay baseline plus 10x the standard deviation of the baseline measurements.

Other Acetyltransferase Assay

Acetylation assays on 7 targets (CBP, GCN5, KAT5, MYST2/KAT7, MYST4/KAT6b, p300, pCAF) was performed by Creative Biomart. JG-2016 was tested in a 10-dose IC₅₀ mode in singlet with 3-fold serial dilution, starting at 100 μM. Reaction buffer was 50 mM Tris-HCL, 0.1 mM EDTA, 250 mM NaCl, 1 mM DTT, 1% DMSO, pH 8.0, using 3 μM ³H-Acetyl-CoA, 10 μM enzyme and 5 μM substrate with reaction time of 1 hour at 30 degrees Celsius, with substrate conversion rate between 5-20%. Enzymes were diluted in reaction buffer, followed by addition of compound with Acoustic Technology in nanoliter range, incubated at room temperature for 20 minutes, then ³H-Acetyl-CoA was added. Reaction was incubated at 30 minutes at 30 degrees Celsius, then transferred to filter paper for detection.

Cell Culture, Drug Treatments, Immunoassays

hTert-HME1, HCC1806, HCC1937, A549 were maintained in a humified incubator at 37degC with 5% CO2. HCC1806 and HCC1937 were grown in RPMI with 10% FBS and 1% penicillin-streptomycin. A549 was grown in F-12 media with 10% FBS and 1% penicillin-streptomycin. hTert-HME1 was grown in Mammary Epithelial Growth Media (PromoCell). Drug treatments were performed in 96-well plates. Cells were seeded at 5000 cells per well, then allowed to attach overnight. Drug dilutions were made in 96-well plates then transferred to plate containing cells and incubated for 48-72 hours. Cell density was then determined by CellTiter-Blue (Promega). For capillary immunoassays hTert-HME1 5E5 cells were seeded in 10 cm plates and cultured for 48 hours, then cells were washed 2x in PBS and EGF-free MEGM was added overnight. The next day, cells were treated in EGF-free media with 1% dialyzed BSA + drug for 30 minutes, then EGF was added to the plate and cells were cultured for 8, 10 and 12 hours before harvesting. Microcapillary immunoassays were performed on a SimpleWestern Wes instrument using H4K12-Ac antibody (Abcam ab46983) at 1:25 dilution, H4K5-Ac antibody (Millipore 07-327) at 1:50 dilution, HAT1 (Abcam ab194296) at 1:50 dilution, nascent H4 (Abcam ab7311) at 1:10 dilution, nascent H3 (Abcam ab18521) at 1:50 dilution, actin (Thermo-Fisher MA5-15452) at 1:100 dilution. There are several antibodies that recognize H4 lysine 5 and 12 acetylation listed and validated on histoneantibodies.com³⁹, including the H4K5-Ac antibody we used. FAD oxidase reactions were performed using FAD Assay Kit (Abcam ab204710) using manufacturer’s recommended protocol with 0.01 μM FAD in 96 well format.

CETSA

The protocol of Jafari et al.⁵¹ was followed with some adjustments. Ten plates of A549 cells were grown to 50% confluence. Cells were pre-treated with 12.5 μM forskolin for 30 minutes to activate HAT1. Then, 5 plates were treated with 20 μM JG-2016 (24a) or DMSO control. After one hour incubation at 37°C, we removed 1 ml drug or DMSO containing media then the cells were collected by scraping and pelleted. The cell pellet was resuspended with 1 ml of previously aliquoted DMSO or drug treated media. 100 μl of the cells were then aliquoted into 8 PCR tubes and placed on a temperature gradient from 40-60°C for 3 minutes. They were then removed and left at room temperature 3 mins, then flash frozen in liquid nitrogen. The samples were either kept frozen in −80°C freezer overnight or directly proceeded to the next step. The samples were thawed at 25°C, vortexed, and snap frozen in liquid nitrogen. This cycle was repeated once. Finally, the cells were thawed at 25°C, vortexed, and placed on ice and centrifuged at 13,000 rpm at 4°C for 20 minutes. Then 90 μl of the supernatant in each sample was transferred to an microcentrifuge tube. Samples were placed on ice and prepared for ProteinSimple analysis. 20 μl of each sample was mixed with 5 μl of ProteinSimple 5x Master Mix. Antibodies used were α-HAT1 (Abcam # ab194296) and α-Rbap46 (Cell Signaling # 6882S). Results indicate 3 biological replicates. Results were normalized by dividing each peak area for a treatment by the maximum peak area.

Mouse Experiments

All mouse experiments were conducted with prior approval of the Administrative Panel on Laboratory Animal Care. For PK studies, 6–7-week-old female CD1 mice were injected i.p. with 100 mg/kg JG-2016 (24a) in 200 μL volume prepared in a 50:50 mixture of 1) 5% BSA in PBS; and 2) PEG400. Blood was collected into EDTA tubes by submandibular bleed at 15 minutes, then by cardiac puncture at 60, 360, 1440 and 4320 minutes. Three mice were used per timepoint. Plasma was prepared by centrifugation for 10 min at 9600 x g, then diluted into blank plasma by 10-fold dilution for 15, 60, 360-minute samples, and by 2-fold dilution for 1440 and 4320 minutes samples. 100 μL of diluted samples was mixed with 200 μL of methanol internal standard solution containing 0.15% formic acid and 75 ng/ml n-benzylbenzamide, vortexed for 15 seconds, incubated at room temperature for 10 minutes, and spun twice at 16,100 x g in a microcentrifuge. The supernatant was analyzed by LC-MS/MS using a Sciex Triple Quad^™ 4500 mass spectrometer, with positive ESI in multiple-reaction monitoring mode. Separation was performed on a Shimadzu LC-20 liquid chromatography (LC) system with an Agilent C18 XDB column with 5-micron packing (50 x 4.6 mm). LC was performed with mobile phase A (water + 0.1% formic acid) and mobile phase B (methanol + 0.1% formic acid) at flow rate 1.5 mL/min in the following steps: 0-1.0 min 3% B, 1.0-2.0 min gradient to 100% B, 2.0-3.5 min 100% B, 3.5-3.6 min gradient to 3% B, 4.6-4.5 min 3% B. JG-2016 (24a) had a retention time of 2.5 min, m/z 378.005/321.9. N-benzylbenzamide (m/z 212.1/91.1) served as an internal standard. Standard curves were prepared with known quantities of JG-2016 (24a) spiked into commercial mouse plasma (BioIVT, Westbury, NY). The limit of detection was defined as a value 3-fold above the blank value; the limit of quantitation, defined as the lowest point on the standard curve within 15% of theoretical and above the LOD, was equivalent to 1 ng/ml. Pharmacokinetic parameters were calculated using the noncompartmental analysis tool of Phoenix WinNonLin (Certara/Pharsight, Sunnyvale, CA).

For tumor studies, A549 cells were infected with 3 lentiviral shRNAs targeting the human HAT1 mRNA (Origene # TL312517). Six-to-eight-week-old NSG female mice (Jackson Labs #005557) were shaved, then 500,000 A549 tumor cells were injected into bilateral flanks and tumor growth was assessed by tri-dimensional tumor measurements to yield tumor volumes. For drug treatments, JG-2016 (24a) was resuspended in a 1:1 mixture of PEG-400 and PBS + 1% dialyzed BSA-0.2 μm-filtered (MilliporeSigma #12-660-910GM). Intraperitoneal injections (200 μL) were performed with a 21-G needle. Tumor measurements were performed with digital calipers. Tumor immunofluorescence was performed on FFPE tumors sectioned onto slides followed by 0.1% triton-X 100 permeabilization, 1.5% BSA blocking, H4K12Ac primary antibody incubation (abcam cat# ab46983), then secondary antibody incubation with an anti-rabbit alexa fluor-594 and treated with Hoechst.

Compounds, NMR, Mass Spectrometry, Purity

Riboflavin analogs from Figure 3C were purchased from Chemdiv. ¹H-NMR and ¹³C-NMR spectra were measured on a Bruker 400 MHz spectrometer (i- probe 5mm with Topspin 3.2. Software). All 13C -NMR were recorded at 100 MHz. LCMS or mass analysis was performed using either of the following LCMS machines: (a) Waters Acquity Ultra performance LC equipped with PDA and attached with QDA detector with a Waters X-bridge C18, 50*2.1 mm, 2.5-micron column using a binary solvent system [A: 0.1% FA in Water, B= 0.1% FA in H2O: ACN (10:90)]. (b) Water Acquity UPLC- H Class equipped with PDA and Acquity SQ detector with a Waters X-bridge C18, 50*2.1 mm, 2.5-micron column using a Quaternary solvent system [A: 0.1% FA in Water, B= 0.1% FA in H2O: ACN (10:90)]. (c) Waters Acquity Ultraperfomance LC connected with PDA and equipped with SQ detector with a Waters X-bridge C18, 50*4.6 mm, 3.5-micron column using a Binary solvent system [A= 5mM Ammonium Bicarbonate in H2O and B=ACN]. Mass analysis was performed on a Waters Acquity Ultraperfomance LC equipped with SQ detector using a Binary solvent system [A= 5mM Ammonium Acetate and 0.1 % Formic acid in H2O and B= Methanol]. All purified products were determined to be ≥95% pure unless otherwise noted.

SPR

The surface plasmon resonance experiments were performed using a Biacore T100 (with T200 sensitivity enhanced) equipped with a CM5 sensor chip. The ligand (105 kDa, >95% pure based on SDS–PAGE) was scouted for optimal pH and then immobilized using amine-coupling chemistry. The surfaces of flow cells were activated for 7 min with a 1:1 mixture of 0.1 M NHS (N-hydroxysuccinimide) and 0.4 M EDC (3-(N,N-dimethylamino) propyl-N-ethylcarbodiimide) at a flow rate of 5 μl/min. The ligand at a concentration of 50 μg/ml in 10 mM sodium acetate, pH 5.0, was immobilized at a density of 2092 RU on flow cell 3, 5388 RU on flow cell 4, and flow cell 1 was left blank to serve as a reference surface. All surfaces were blocked with a 7 min injection of 1 M ethanolamine, pH 8.0. To collect kinetic binding data, the analytes (1992 Da for H4 [Anaspec # AS-624980], 250 Da for JG-2016, 809 Da for Acetyl-CoA [Millipore-Sigma # A2056]) in 10 mM HEPES, 150 mM NaCl, 3 mM EDTA, 0.05% P20, 5% DMSO, pH 7.4, was injected over all flow cells at various concentrations as shown in Fig. 5A and Fig. S6D at a flow rate of 30 μl/min and at a temperature of 25°C. The complex was allowed to associate and dissociate for 60 and 600 s, respectively. Duplicate injections (in increasing concentration order) of each sample and a buffer blank were flowed over the two surfaces. Data were collected at a rate of 10 Hz. The data were fit to a heterogeneous ligand interaction model using the global data analysis option available within Biacore T200 evaluation software (Version 3.2.1). The steady state responses were calculated with data 4 seconds before injection stop with a 5-second window and fit to a one site specific saturation model in Prism to derive K_D.

Crystallization and Structure Determination

Crystals suitable for x-ray diffraction were obtained evaporating a solution of JG-2016 in isopropanol at room temperature. Data were collected at beamline SSRL BL12-2 at the Stanford Synchrotron Radiation Lightsource synchrotron at SLAC National Accelerator Laboratory (2572 Sand Hill Road, Menlo Park, California, CA 94025, USA). Except two hydrogen atoms attached to nitrogen, all the H atoms were refined using a riding model while keeping their isotropic displacement parameters constrained to 1.2 (H attached to aromatic C atoms) and 1.5 (H atoms attached to non-aromatic C atoms) times larger than those of their carrier atoms. Software used for structure analysis: XDS (Kabsch, 2010), WinGX (Farrugia, 1999), and SHELX (Sheldrick, 2008). Software for data collection Blu-Ice (McPhillips et al., 2002). CCDC deposit code 2169717 contains the supplementary crystallographic data. These data can be obtained free of charge from The Cambridge Crystallographic Data Centre via www.ccdc.cam.ac.uk/structures.

Chemistry

Commercially available reagents and solvents were used as purchased without further purification. When needed, solvents were distilled and stored on molecular sieves. Reactions were monitored by thin layer chromatography (TLC) carried out on 5 cm × 20 cm silica gel plates with a layer thickness of 0.25 mm, using UV light as a visualizing agent. When necessary, TLC plates were visualized with aqueous KMnO₄ or ninhydrin reagent. Column chromatography was performed on flash silica gel using Kieselgel 60 silica gel (particle size 0.040–0.063 mm, 230–400 mesh). Melting points were determined in an open glass capillary with a Stuart Scientific SMP3 apparatus. All the target compounds were characterized by ¹H NMR and ¹³C NMR (Bruker Avance Neo 400 MHz), and HRMS (Thermo Fisher Q-Exactive Plus) equipped with an Orbitrap (ion trap) mass analyzer. Chemical shifts are reported in parts per million (ppm) with residual solvent signals as internal standard (CDCl₃, δ = 7.26 ppm for ¹H NMR, δ = 77.16 ppm for ¹³C NMR; CD₃OD, δ = 3.31 ppm for ¹H NMR, δ = 49.00 ppm for ¹³C NMR; (CD₃)₂CO, δ = 2.05 ppm for ¹H NMR, δ = 29.84, 206.26 ppm for ¹³C NMR; (CD₃)₂SO, δ = 2.50 ppm for ¹H NMR, δ = 39.52 ppm for ¹³C NMR). Coupling constants (J) are quoted in hertz (Hz). Abbreviations used for multiplicity are as follows: s, singlet; d, doublet; t, triplet; q, quartet; quint, quintet; dd, doublet of doublets; dt, doublet of triplets; br, broad; m, multiplet.

The purity of selected compounds was determined by HPLC using a Shimadzu HPLC system (Shimadzu, Kyoto, Japan) equipped with a Kinetex C18 (150 × 4.6 mm, 5 μm d.p., Phenomenex Torrance, CA) and using 0.2% formic acid in water and 0.2% formic acid in acetonitrile as eluents (for further details, see supporting information SI). The purity of all tested compounds is 95% or higher.

1-(2,5-Dichlorophenyl)ethan-1-ol (1, JG-2001-X1)

To a solution of 1-(2,5-dichlorophenyl)ethan-1-one (50.0 g, 264.4 mmol) in MeOH (500 mL), sodium borohydride (15.0 g, 396.7 mmol) was added at −10 °C, and the reaction mixture was allowed to stir at 0 °C for 1 h. After completion of the reaction as indicated by TLC, the reaction mixture was concentrated carefully, and crude was diluted with water and EtOAc. The reaction mixture was partitioned between water (1000 mL) and EtOAc (1000 mL×2). The organic layer was separated and washed with brine (2 x 1000 mL). The combined organic layer was evaporated under vacuum to obtain compound 1 as an off-white solid (54.0 g, 77%). ¹H NMR: (400MHz, DMSO-d₆) δ 7.59-7.58 (t, J = 4Hz, 1H), δ 7.44-7.42 (dd, J = 8Hz, 1H), δ 7.35-7.32 (t, J = 12Hz, 1H), δ 5.55-5.54 (d, 1H), δ 4.99-4.95 (q, 1H), δ 1.31-1.30 (d, J = 4Hz, 3H).

1,4-Dichloro-2-ethylbenzene (2, JG-2001-X2)

To a solution of 1-(2,5-dichlorophenyl)ethan-1-ol (1, JG-2001-X1) (54.0 g, 284.2 mmol) in ethylene dichloride at 0 °C, BF3-etherate (67.1 mL, 539.9 mmol) and triethylsilane (92.0 mL, 568.4 mmol) were added at 0 °C and stirred for 16 hr at 50°C. After completion of the reaction as indicated by TLC, the reaction mixture was cooled at 0°C and quenched with sat. NaHCO₃ (1500 ml). The reaction mixture was partitioned between EtOAc (1500mL × 2), and the organic layer was washed with brine solution (2 x 1500 mL). The combined organic layer was dried over Na₂SO₄ and evaporated to obtain title compound 2 as a pale-yellow oily liquid (45.0 g, quantitative). ¹H NMR: (400MHz, DMSO-d₆). δ 7.50-7.43 (m, 2H), δ 7.31-7.28 (dd, J = 12Hz, 1H), δ 2.72-2.66 (q, J = 8Hz, 2H), δ 1.24-1.14 (t, 3H).

1,4-Dichloro-2-ethyl-5-nitrobenzene (3, JG-2001-X)

To a solution of 1,4-dichloro-2-ethylbenzene (2, JG-2001-X2) (45.0 g, 258.6 mmol) in H2SO4 (450 mL) at 0 °C, KNO₃ (26.1g, 258.6mmol) was added at 0°C and stirred for 30 min. After completion of the reaction as indicated by TLC, the reaction mixture was quenched with ice water (1000 mL) slowly and stirred for 20 min. The product was extracted with EtOAc (500 ml × 2) and washed with brine solution (2 x 500 mL). The combined organic layer was dried over Na₂SO₄ and evaporated under vacuum. The crude product was purified by column chromatography (0-15 % EtOAc/hexane) to obtain title compound 3 as pale-yellow oil (35.0 g, 57 %). ¹HNMR: (400MHz, CDCl₃) δ 1.20-1.16 (t, 3H), 2.792-2.735 (q, 2H), 7.799 (s, 1H), 8.23 (s, 1H).

2-((4-Chloro-5-ethyl-2-nitrophenyl)amino)ethan-1-ol (4, JG-2001-A1)

To a solution of 1,4-dichloro-2-ethyl-5-nitrobenzene (3, JG-2001-X) (0.10 g, 0.456 mmol, 1.0 eq) in DMSO (1.5 mL)) 2-aminoethan-1-ol (CAS: 141-43-5) (0.064 g, 1.05 mmol, 5.0 eq) was added, and the reaction mixture was heated at 150 °C under microwave irradiation for 10 min. After completion of the reaction, as indicated by TLC, the reaction mixture was poured into ice-cold water (50 mL) and extracted with ethyl acetate (3 x 50 mL). The combined organic layer was dried over anhydrous sodium sulphate and concentrated under vacuum. The obtained crude product was further purified by column chromatography (35 % ethyl acetate/hexane) to obtain title compound 4 as orange solid (0.085 g, 93.27 %, 76.44%) LCMS (ESI)m/z 245.0 & 247.0 (M & M+2)

2-((2-Amino-4-chloro-5-ethylphenyl)amino)ethan-1-ol (5, JG-2001-A2)

To a solution of 2-((4-chloro-5-ethyl-2-nitrophenyl)amino)ethan-1-ol (4, JG-2001-A1) (0.40 g, 1.63 mmol, 1.0 eq) in EtOH: water (9:1 mL), Zn Dust (0.86 g, 13.1mmol, 8.0 eq) and NH₄Cl (0.70 g, 13.1 mmol, 8.0 eq) were added and stirred at 90 °C for 2.5h. After completion of the reaction as indicated by TLC, the reaction mixture was filtered through Celite and filtrate concentrated under reduced pressure. The reaction mixture was poured into water (100 mL) and extracted with ethyl acetate (4 x 25 mL). The combined organic layer was dried over anhydrous sodium sulphate and concentrated under vacuum to afford orange solid 5 as crude (0.37 g, Quantitative) LCMS (ESI) m/z 215.1 & 217.1 (M & M+2)

7-Chloro-8-ethyl-10-(2-hydroxyethyl)benzo[g]pteridine-2,4(3H,10H)-dione (6, JG-2001)

To a solution of 2-((2-amino-4-chloro-5-ethylphenyl)amino)ethan-1-ol (5, JG-2001-A2) (0.300 g, 1.40 mmol, 1.0 eq) in AcOH (6 mL), alloxan monohydrate (CAS No: 2244-11-3) (0.224 g, 1.40mmol, 1.0 eq) and boric anhydride (0195 g, 2.80 mmol, 2.0 eq) were added, and the reaction mixture was stirred at 60 °C for 16 h. After completion of the reaction as indicated by TLC, the reaction mixture was poured into water (50 mL) and extracted with 10 % DCM:MeOH (3x50 mL). The combined organic layer was dried over anhydrous sodium sulphate and concentrated under vacuum. The obtained crude product was further purified by column chromatography (10 % DCM:MeOH) to afford orange solid (0.221 g, 49.31%); TLC: 10% MeOH in DCM, Rf = 0.2; visualized with UV. HPLC: 98.7% (HPLC RT 5.13 min); ¹H NMR (400 MHz, DMSO-d₆) δ 11.46 (s, 1H), 8.22 (s, 1H), 8.05 (s, 1H), 4.97 (t, J = 5.6Hz, 1H), 4.71 (t, J = 6, 2H), 3.83 (m,2H), 2.95 (q, J = 7.6, 2H), 1.30 (t, J = 7.6 Hz, 3H); LCMS (ESI) m/z 321.2 & 323.2(M & M+2).

2-(7-Chloro-8-ethyl-2,4-dioxo-3,4-dihydrobenzo[g]pteridin-10(2H)yl)ethylbenzoate (7a, JG-2029)

To a solution of benzoic acid (0.15 g, 0.12 mmol) in DMF (3 mL), EDC.HCl (0.35 g, 0.18 mmol), DMAP (0.45 g, 0.17 mmol), and HOBT (0.24 g, 0.17 mmol) were added. 7-chloro-8-ethyl-10-(2-hydroxyethyl)benzo[g]pteridine-2,4(3H,10H)-dione (6, JG-2001) (0.39 g, 0.12 mmol) in DMF (2 mL) was added to the reaction mixture and stirred at rt for 12 min. The reaction mixture was slowly poured into water (10 mL) and extracted with ethyl acetate (3 x 10 mL). The combined organic layer was dried over anhydrous sodium sulphate and concentrated under vacuum. The crude product was purified with prep-HPLC to obtain the title compound as a pale-yellow solid (0.036 g, 18 %); TLC: 10% MeOH in DCM, Rf = 0.6; visualized with UV. HPLC: 90.27% (HPLC RT 6.93 min); 1H NMR (400 MHz, DMSO-d6) δ 11.49 (s, 1H), 8.25 (s, 1H), 8.22 (s, 1H), 7.73-7.59(m, 3H), 7.43-7.39(m, 2H), 5.06(t, 2H), 4.71 (bs, 2H), 2.87(q, J =7.2 Hz, 2H), 1.21(t, J =7.2 Hz, 3H); LCMS: (ESI) m/z 425.19 (M+1).

2-(7-Chloro-8-ethyl-2,4-dioxo-3,4-dihydrobenzo[g]pteridin-10(2H)-yl)ethylisobutyrate (7b, JG-2030)

To a solution of Isobutyric acid (0.15 g, 0.17 mmol) in DMF (3 mL), EDC.HCl (0.48 g, 0.25 mmol), DMAP (0.34 g, 0.25 mmol), and HOBT (0.34 g, 0.25 mmol) were added and stirred at room temperature. 7-chloro-8-ethyl-10-(2-hydroxyethyl)benzo[g]pteridine-2,4(3H,10H)-dione (6, JG-2001) (0.54 g, 0.16 mmol) in DMF (3 mL) was added and stirred for 10 min at room temperature. The reaction mixture was slowly poured into water (10 mL) and extracted with ethyl acetate (3 x 10 mL). The combined organic layer was dried over anhydrous sodium sulphate and concentrated under vacuum. The crude product was purified by prep-HPLC to obtain the title compound as a pale-yellow solid (0.066g, 36.76 %). TLC: 10% MeOH in DCM, Rf = 0.5; visualized with UV. HPLC: 96.08% (HPLC RT 6.73 min); ¹H NMR (400 MHz, DMSO-d₆) δ 11.49 (s,1H), 8.23 (s, 1H), 8.08 (s, 1H), 4.93(t, 2H), 4.44(s, 2H), 2.95(q, J = 7.6Hz, 2H), 2.36(hept, 1H), 1.31(t, J = 7.6Hz, 3H), 0.90(d, J =6.8Hz, 6H); LCMS: (ESI) m/z 391.8, 393.8 (M& M+2).

2-(7-Chloro-8-ethyl-2,4-dioxo-3,4-dihydrobenzo[g]pteridin-10(2H)-yl)ethyl acetate (10, JG-2004)

4 (JG-2001-A1) (150 mg, 1 eq) was combined with acetyl chloride (3 eq) and K₂CO₃ (2 eq) in DMF, cooled to 0 °C, then allowed to warm to room temperature for 30 minutes. Product formation was confirmed by LCMS and ¹H-NMR and purified by column chromatography (8, JG-2004-B1, yield 130 mg). Next, JG-2004-B1 (120 mg, 1 eq) was combined with Zn (3 eq) and NH₄Cl (5 eq) in a 1:1 mixture of ethanol and water, then incubated at room temperature for 3 h. Product formation was confirmed by TLC, LCMS, and ¹H-NMR, then purified by column chromatography (JG-2004-B2, yield 50 mg). 9, JG-2004-B2 (30 mg, 1 eq) was mixed with pyrimidine-2,4,5,6(1H,3H)-tetraone (1 eq) and boric acid (1 eq) in acetic acid, heated to 70 ⁰C for 1 h. Product formation (10, JG-2004) was confirmed by TLC, LCMS, and purified by column chromatography to yield a yellow solid (10 mg, 24%). TLC: 10% MeOH in DCM, Rf = 1; visualized with UV. HPLC: 100% (HPLC RT 5.03 min); ¹H NMR (400 MHz, DMSO-d₆, ppm) δ 11.49 (s, 1H), 8.23 (s, 1H), 8.04 (s, 1H), 4.89 (t, J = 5.6 Hz, 2H), 4.42 (t, J = 5.2 Hz, 2H), 2.95 (q, J = 7.2 Hz, 2H), 1.89 (s, 3H), 1.30 (t, J = 7.6 Hz, 3H); LCMS, calc’d 362.77 (ESI) m/z; found 363.12 (ESI) m/z.

2-(7-Chloro-8-ethyl-2,4-dioxo-3,4-dihydrobenzo[g]pteridin-10(2H)-yl)ethylethylcarbamate (13a, JG-2066)

6, JG-2001 (100 mg, 1 eq) was mixed with CAS 824-94-2 (3 eq) and KOH (4 eq) in DMSO and reacted at room temperature for 2 hours. Product 11(JG-2001-B1) was purified by column chromatography (yield 25 mg). ¹H-NMR (400 MHz, DMSO, ppm) δ 8.25 (s, 1H), 8.08 (s, 1H), 7.32 (d, J = 8.4 Hz, 2H), 6.86 (d, J = 8.4 Hz, 2H), 5.02 (s, 2H), 4.96 (t, J = 6.0 Hz, 1H), 4.73 (s, 2H), 3.82 (d, J = 5.6 Hz, 2H), 3.71 (s, 3H), 2.94 (d, J = 7.6 Hz, 2H), 1.29 (t, J = 7.6 Hz, 3H); LCMS, calc’d 440.13 (ESI) m/z; found 441.79 (ESI) m/z

7-chloro-8-ethyl-10-(2-hydroxyethyl)-3-(4-methoxybenzyl)benzo[g]pteridine-2,4(3H,10H)-dione 11 (JG-2001-B1) (30 mg, 1 eq) was mixed with ethyl isocyanate (CAS 109-90-4) (4 eq), DCM, TEA and DMR (0.2 ml) for 2 hours at room temperature. Product (12a, JG-2066-A1) was observed by TLC (yield 20 mg). The product was mixed with ice-cold DCM and triflic acid for 1 hour at 0⁰C. Product (13a, JG-2066) was observed by TLC and purified by column chromatography (yield 13 mg, 56%). TLC: 10% MeOH in DCM, Rf = 0.6; visualized with UV. HPLC: 93.01% (HPLC RT 5.78 min); ¹H NMR (400 MHz, DMSO-d₆) δ 11.49 (s, 1H), 8.33 (s, 1H), 7.95 (s, 1H), 7.11 (t, J = 5.6 Hz, 1H), 4.85 (t, 2H), 4.36 (t, J = 5.2 Hz, 3H), 2.90 (m, 4H), 1.31 (t, J = 7.6 Hz, 3H), 0.85 (t, J = 7.2 Hz, 3H); LCMS, calc’d 391.81 (ESI) m/z; found 392.07 (ESI) m/z

2-(7-Chloro-8-ethyl-2,4-dioxo-3,4-dihydrobenzo[g]pteridin-10(2H)-yl)ethyl phenylcarbamate (13b, JG-2031)

7-chloro-8-ethyl-10-(2-hydroxyethyl)-3-(4-methoxybenzyl)benzo[g]pteridine-2,4(3H,10H)-dione 11 (JG-2001-B1) (80, 1 eq) was mixed with DCM + TEA (3 eq) and phenyl isocyanate (CAS 103-71-0) (1.5 eq) for 1 hour at room temperature. Product formation (12b, JG-2001-F1) was observed by TLC and LCMS and purified by column chromatography (yield 50 mg). 12b (JG-2001-F1) was mixed with DCM and triflic acid (0.1 ml) and cooled on ice for 30 minutes. Product formation (13b, JG-2031) was observed by TLC and LCMS (yield 20 mg, 39%). TLC: 10% MeOH in DCM, Rf = 0.6; visualized with UV. HPLC: 96.11% (HPLC RT 6.79 min)¹H NMR (400MHz, DMSO-d₆, ppm) δ 11.51 (s, 1H), 9.5 (s, 1H), 8.22 (s, 1H), 7.9 (s, 1H), 7.27 (d, 4H), 6.97 (m, 1H), 4.9 (s, 2H), 4.5 (s, 2H), 2.85 (d, J = 7.2 Hz, 2H), 1.21 (t, J = 6.8 Hz, 3H) LCMS, calc’d 439.86 (ESI) m/z; found 440.74 (ESI) m/z

4-Chloro-5-ethyl-2-nitro-N-(2-(pyridin-3-yl)ethyl)aniline (14a, JG-2042-A1)

To a solution of 1,4-dichloro-2-ethyl-5-nitrobenzene (3, JG-2001-X) (0.200 g, 0.91 mmol, 1 eq) in DMSO (3 mL), 2-(pyridine-3-yl)ethan-1-amine (CAS: 20173-24-4) (0.445 g, 3.65 mmol, 3.0 eq) was added and the reaction mixture was heated at 190°C under microwave irradiation for 15 min. After completion of reaction as indicated by TLC, the reaction mixture was poured into water (10 mL) and extracted with ethyl acetate (3 x 10 mL). The combined organic layer was dried over anhydrous sodium sulphate and concentrated under vacuum to afford yellow liquid (0.30g, 100 %) LCMS: (ESI) m/z 306.5 & 308.5(M & M+2)

Note: Crude material was directly used in the next step without further purification.

4-Chloro-5-ethyl-N1-(2-(pyridine-3-yl)ethyl)benzene-1,2-diamine (15a, JG-2042-A2)

To a solution of 4-chloro-5-ethyl-2-nitro-N-(2-(pyridine-3-yl)ethyl)aniline (14a, JG-2042-A1) (0.3g, 0.98 mmol, 1.0 eq) in EtOH: water (8:2 mL), Zn Dust (0.513g, 7.80 mmol, 8.0 eq) and NH₄Cl (0.419g, 7.80 mmol, 8.0 eq) were added and stirred at 60°C for 15 min. After completion of reaction as indicated by TLC, the reaction mixture was fitered through Celite and filtrate was extracted with ethyl acetate (2 x 10 mL). The combined organic layer was dried over anhydrous sodium sulphate and concentrated under reduced pressure. The obtained crude product was further purified by column chromatography (20 % ethyl acetate/hexane) to obtain title compound as yellow solid (0.086g, 31.78 %) LCMS (ESI) m/z 276.5 & 278.5 (M & M+2)

7-Chloro-8-ethyl-10-(2-(pyridin-3-yl)ethyl)benzo[g]pteridine-2,4(3H,10H)-dione (16a, JG-2042)

To a solution of 4-chloro-5-ethyl-N1-(2-(pyridin-3-yl)ethyl)benzene-1,2-diamine(15a, JG-2042-A2) (0.086 g, 0.31 mmol, 1.0 eq) in AcOH (1.5 mL), alloxan monohydrate (CAS No: 2244-11-3) (0.049 g, 0.31 mmol, 1.0 eq), and boric anhydride (0.043 g, 0.62 mmol, 2.0 eq) were added, and the reaction mixture was stirred at 50°C for 20 min. After completion of the reaction, as indicated by TLC, the reaction mixture was slowly poured into ice-cooled water (10 mL) and extracted with ethyl acetate (4 x 10 mL). The combined organic layer was dried over anhydrous sodium sulphate and concentrated under reduced pressure. The crude product was further purified by column chromatography (8.2 % MeOH/DCM) to obtain the title compound as a yellow solid (0.003 g, 4.20 %). TLC: 10% MeOH in DCM, Rf = 0.35; visualized with UV. HPLC: 100% (HPLC RT 4.28 min); ¹H NMR (400 MHz, DMSO-d₆) δ 11.48 (s, 1H), 8.53 (s, 1H), 8.41 (d, J = 4.0 Hz, 1H), 8.18 (s, 1H), 7.77 – 7.64 (m, 2H), 7.29 (dd, J = 7.5, 4.9 Hz, 1H), 4.85 (t, J = 6.8 Hz, 2H), 3.10 (t, J = 6.9 Hz, 2H), 2.88-2.80 (m, 2H), 1.20 (t, J = 7.4 Hz, 3H); LCMS (ESI) m/z 382.7 & 384.7(M & M+2);

Note: The following compounds 16b-j were made according to the procedure described for (16a, JG-2042) using key intermediate 3, JG-2001-X.

7-Chloro-8-ethyl-10-(4-(trifluoromethyl)phenethyl)benzo[g]pteridine-2,4(3H,10H)-dione (16b, JG-2039)

Yellow solid (yield 15 mg, 16%); TLC: 10% MeOH in DCM, Rf = 0. 5; visualized with UV. HPLC: 95.12% (HPLC RT 7.74 min); ¹H NMR (400 MHz, DMSO-d₆) δ 11.49 (s, 1H), 8.18 (s, 1H), 7.66 (s, 1H), 7.63-7.54 (m, 4H), 4.86 (bs, 2H), 3.17 (bs, 2H), 2.82 (q, 2H), 1.17 (t, J = 6.8 Hz, 3H); LCMS (ESI) m/z 449.8 & 451.8 (M & M+2).

7-Chloro-10-(3,5-difluorophenethyl)-8-ethylbenzo[g]pteridine-2,4(3H,10H)-dione (16c, JG-2040)

Yellow solid (yield 60 mg, 26%); TLC: 30% EtOAc in Hexane, Rf = 0. 2; visualized with UV. HPLC: 98.83% (HPLC RT 7.34 min); ¹H NMR (400MHz, DMSO-d₆, ppm) δ 11.49 (s, 1H), 8.19 (s, 1H), 7.70 (s, 1H), 7.09 (m, J = 6.4 Hz, 3H), 4.84 (t, 2H), 3.10 (t, J = 6.4 Hz, 2H), 2.84 (q, J = 7.2 Hz, 2H), 1.21 (t, J = 7.2 Hz, 3H); LCMS (ESI) m/z 417.1 & 419.0 (M & M+2).

7-Chloro-8-ethyl-10-(4-fluorophenethyl)benzo[g]pteridine-2,4(3H,10H)-dione(16d, JG-2041)

Yellow solid (yield 60 mg, 17%); TLC: 5% MeOH in DCM, Rf = 0. 2; visualized with UV. HPLC: 98.83% (HPLC RT 7.34 min); ¹H NMR (400MHz, DMSO-d₆, ppm) δ 11.47 (s, 1H), 8.18 (s, 1H), 7.69 (s, 1H), 7.36 (q, J = 6 Hz, 2H), 7.10 (t, J = 8.8 Hz, 2H), 4.81 (t, J = 7.2 Hz, 2H), 3.05 (t, J = 6.85 Hz, 2H), 2.85 (q, J = 7.2 Hz, 2H), 1.21 (t, J = 7.6 Hz, 3H); LCMS (ESI) m/z 399.2 & 401.0 (M & M+2).

7-Chloro-8-ethyl-10-(2-(pyridin-2-yl)ethyl)benzo[g]pteridine-2,4(3H,10H)-dione (16e, JG-2043)

Yellow solid (yield 40 mg, 26%); TLC: 10% MeOH in DCM, Rf = 0. 2; visualized with UV. HPLC: 100% (HPLC RT 4.36 min); ¹H NMR (400 MHz, DMSO-d_{6, ppm}) δ 11.47 (s, 1H), 8.53 (d, J=3.6 Hz, 1H), 8.20 (s, 1H), 7.78 (s, 1H), 7.69 (m, 1H), 7.33 (d, J = 7.6Hz, 1H), 7.25(m, 1H), 4.98 (t, 2H), 3.24 (t, 2H), 2.87 (q, 2H), 1.24 (t, J = 6.8 Hz, 3H); LCMS (ESI) m/z 382.6 & 384.7(M & M+2).

7-Chloro-8-ethyl-10-(4-(trifluoromethyl)benzyl)benzo[g]pteridine-2,4(3H,10H)-dione (16f, JG-2048)

Yellow solid (yield 70 mg, 57%); TLC: 20% EtOAc in Hexane, Rf = 0. 5; visualized with UV. HPLC: 98.09% (HPLC RT 7.62 min); ¹H NMR (400MHz, DMSO-d₆, ppm) δ 11.52 (s, 1H), 8.25 (s, 1H), 7.65 (m, J = 8 Hz, 5H), 5.99 (s, 2H), 2.81 (q, J = 7.2 Hz, 2H), 1.13 (t, J = 7.6 Hz, 3H); LCMS (ESI) m/z 435.1 & 437.1(M & M+2).

7-Chloro-8-ethyl-10-(4-fluorobenzyl)benzo[g]pteridine-2,4(3H,10H)-dione (16g, JG-2049)

Brown solid (yield 70 mg, 8%); TLC: neat EtOAc, Rf = 0. 3; visualized with UV. HPLC: 98.78% (HPLC RT 7.05 min); ¹H NMR (400MHz, DMSO-d₆, ppm) δ 11.50 (s, 1H), 8.23 (s, 1H), 7.6 (s, 1H), 7.46 (d-d, J = 5.6 Hz, 2H), 7.17 (t, J = 8.8 Hz, 2H), 5.89 (s, 2H), 2.81 (q, J = 7.6 Hz, 2H), 1.15 (t, J = 7.6 Hz, 3H); LCMS (ESI) m/z 385.6 &387.56(M & M+2).

7-Chloro-10-(3-chlorobenzyl)-8-ethylbenzo[g]pteridine-2,4(3H,10H)-dione (16h, JG-2050)

Yellow solid,(yield 82 mg, 30%); TLC: 10% MeOH in DCM, Rf = 0. 5; visualized with UV. HPLC: 96.02% (HPLC RT 6.85 min); ¹H NMR (400 MHz, DMSO-d₆, ppm) δ 11.51 (s, 1H), 8.24 (s, 1H), 7.64 (s, 1H), 7.50 (s, 1H), 7.37 (d, J = 5.2 Hz, 3H), 5.90 (s, 2H), 2.81 (q, J = 7.2 Hz, 2H), 1.47 (t, J = 7.6 Hz, 3H); LCMS (ESI) m/z 401.2 & 403.1(M & M+2).

7-Chloro-8-ethyl-10-phenethylbenzo[g]pteridine-2,4(3H,10H)-dione (16i, JG-2026)

Yellow solid,(yield 25 mg, 10%); TLC: 10% MeOH in DCM, Rf = 1.1; visualized with UV. HPLC: 95.73% (HPLC RT 7.26 min); ¹H NMR (400MHz, DMSO-d₆, ppm) δ 11.47 (s, 1H), 8.19 (s, 1H), 7.7 (1H, s), 7.34 (d-d, J = 7.2 Hz, 2H), 7.27 (d-d, J = 7.6 Hz, 2H), 7.22 (m, J = 6.82 Hz, 1H), 4.8 (t, 2H), 3.06 (t, J = 6.8 Hz, 2H), 2.85 (q, J = 7.2 Hz, 2H), 1.23 (t, J = 7.2 Hz, 3H); LCMS (ESI) m/z 381.1 & 383.1(M & M+2).

7-Chloro-8-ethyl-10-(3-phenylpropyl)benzo[g]pteridine-2,4(3H,10H)-dione (16j, JG-2027)

Yellow solid, yield 100 mg, 49%); TLC: 10% MeOH in DCM, Rf = 0. 9; visualized with UV. HPLC: 92.68% (HPLC RT 7.68 min); ¹H NMR (400MHz, DMSO-d₆) δ 11.44 (s, 1H), 8.21 (s, 1H), 7.67 (s, 1H), 7.29 (d-d, J = 6.8 Hz, 2H), 7.29 (d-d, J = 6.8 Hz, 2H), 7.21 (m, J = 6.4 Hz, 1H), 4.6 (t, 2H), 3.13 (q, J = 7.7 Hz, 2H), 2.90 (m, J = 7.6 Hz, 2H), 2.81 (t, J = 7.6 Hz, 2H), 1.25 (t, J = 7.6Hz, 3H); LCMS (ESI) m/z 385.1 & 397.3(M & M+2).

4-Chloro-N-(cyclohexylmethyl)-5-ethyl-2-nitroaniline (14k, JG-2046-A1)

To a solution of 1,4-dichloro-2-ethyl-5-nitrobenzene (3, JG-2001-X) (0.200 g, 0.91 mmol, 1 eq) in DMSO (3 ml), cyclohexylmethanamine (CAS: 3218-02-8) (0.413 g, 3.62 mmol, 3.0 eq) was added, and the reaction mixture was stirred at 190°C temperature under microwave irradiation for 15 min. After completion of the reaction as indicated by TLC, the reaction mixture was poured into water (10 mL) and extracted with ethyl acetate (3 x 10 mL). The combined organic layer was dried over anhydrous sodium sulphate and concentrated under vacuum to obtain the title compound as a yellow solid (0.310 g, 100 %). LCMS (ESI) m/z 297.6 &299.7 (M & M+2)

The crude material was directly used in the next step without further purification.

4-chloro-N1-(cyclohexylmethyl)-5-ethylbenzene-1,2-diamine (15k, JG-2046-A2)

To a solution of 4-chloro-N-(cyclohexylmethyl)-5-ethyl-2-nitroaniline (14k, JG-2046-A1) (0.310g, 1.04 mmol, 1.0 eq) in EtOH: water (8:2 mL), Zn Dust (0.546g, 8.35 mmol, 8.0 eq) and NH4Cl (0.446g, 8.35 mmol, 8.0 eq) were added, and the reaction mixture was stirred at 60°C for 15 min. After completion of the reaction as indicated by TLC, the reaction mixture was filtered through celite and extracted with ethyl acetate (2 x 10 mL). The combined organic layer was dried over anhydrous sodium sulphate and concentrated under vacuum. The crude product was purified by column chromatography (30 % ethyl acetate/hexane) to obtain a yellow solid (0.120g, 43.06 %). LCMS (ESI) m/z 267.6 & 269.6 (M & M+2).

7-chloro-10-(cyclohexylmethyl)-8-ethylbenzo[g]pteridine-2,4(3H,10H)-dione (16k, JG-2046)

To a solution of 4-chloro-N1-(cyclohexylmethyl)-5-ethylbenzene-1,2-diamine (15k, JG-2046-A2) (0.120g, 0.44mmol, 1.0 eq) in AcOH (1.5 mL), alloxan monohydrate (CAS: 2244-11-3) (0.072 g, 0.44 mmol, 1.0 eq) and Boric anhydride (0.062 g, 0.89 mmol, 2.0 eq) were added, and the reaction mixture was stirred at 50°C for 15 min. After completion of the reaction, as indicated by TLC, the reaction mixture was poured into water and extracted with ethyl acetate (4 x 10 mL). The reaction mixture was dried over anhydrous sodium sulphate and concentrated under vacuum. The crude product was further purified by column chromatography (5 % MeOH and DCM) to obtain the title compound as a yellow solid (0.060g, 35.78 %) TLC: 10% MeOH in DCM, Rf = 0. 29; visualize with UV. HPLC: 100% (HPLC RT 7.76 min); ¹H NMR (400 MHz, DMSO-d₆) δ 11.42 (s, 1H), δ 8.21 (s, 1H), 7.96 (s, 1H), 4.50 (bs, 2H), 2.95 (q, J = 7.2Hz 2H), 2.10-1.90 (m, 1H), 1.70 – 1.52 (m, 4H), 1.30 (t, 3H), 1.30-1.00 (m, 6H); LCMS (ESI) m/z 373.8 (M+1).

The following compounds 16l-p were made according to the procedure described for 16k, JG-2046 using 3, JG-2001-X

7-Chloro-10-(cyclobutylmethyl)-8-ethylbenzo[g]pteridine-2,4(3H,10H)-dione (16l, JG-2047)

Yellow solid (yield 50 mg, 27%); TLC: 10% MeOH in DCM, Rf = 0. 8; visualized with UV. HPLC: 96.38% (HPLC RT 6.9 min); ¹H NMR (400MHz, DMSO-d₆) δ 11.43 (s, 1H), 8.21 (s, 1H), 8.0 (s, 1H), 4.72 (d, J = 6.4 Hz, 2H), 2.95 (q, J = 7.2 Hz, 2H), 2.89 (m, J = 7.6 Hz, 1H), 1.98 (m, J = 8.8 Hz, 4H), 1.80 (m, J = 7.6 Hz, 2H), 1.29 (t, J = 7.2 Hz, 3H); LCMS (ESI) m/z 345.5 & 347.6 (M&M+2).

7-Chloro-8-ethyl-10-neopentylbenzo[g]pteridine-2,4(3H,10H)-dione (16m, JG-2036)

Yellow solid (yield 128 mg, 69%); TLC: 10% MeOH in DCM, Rf = 0. 8; visualized with UV. HPLC: 96.5% (HPLC RT 7.03 min); ¹H NMR (400MHz, DMSO-d₆) δ 11.44 (s, 1H), 8.19 (s, 1H), 8.08 (s, 1H), 4.97 (s, 1H), 4.34 (s, 1H), 2.94 (q, J = 7.2 Hz, 2H), 1.27 (t, J = 7.2 Hz, 3H), 1.00 (s, 9H); LCMS (ESI) m/z 347.5 & 349.9 (M&M+2).

7-Chloro-8-ethyl-10-(2-methoxyethyl)benzo[g]pteridine-2,4(3H,10H)-dione (16n, JG-2038)

Yellow solid (yield 45 mg, 23%); TLC: 10% MeOH in DCM, Rf = 0. 5; visualized with UV. HPLC: 100% (HPLC RT 4.36 min); ¹H NMR (400 MHz, DMSO-d₆) δ 11.45 (s, 1H), δ 8.20 (s, 1H), 8.02 (s, 1H), 4.80 (t, 2H), 3.75(t, 2H), 3.26 (s, 3H), 2.94 (q, J = 7.2Hz, 2H), 1.29 (t, J = 7.2Hz, 3H); LCMS (ESI) m/z 335.6 & 337.6 (M&M+2).

7-Chloro-8-ethyl-10-(3,3,3-trifluoropropyl)benzo[g]pteridine-2,4(3H,10H)-dione (16o, JG-2045)

Yellow solid (yield 5 mg, 25%); TLC: 10% MeOH in DCM, Rf = 0. 9; visualized with UV. HPLC: 95.05% (HPLC RT 6.67 min); ¹H NMR (400MHz, DMSO-d₆, ppm) δ 11.52 (s, 1H), 8.25 (s, 1H), 7.90 (s, 1H), 4.85 (t, J = 6.8 Hz, 2H), 2.96 (q, J = 7.2 Hz, 2H), 2.83 (q, J = 7.6 Hz, 2H), 1.35 (t, J = 7.2 Hz, 3H); LCMS (ESI) m/z 373.2 & 375.2 (M&M+2).

Methyl 3-(7-chloro-8-ethyl-2,4-dioxo-3,4-dihydrobenzo[g]pteridin-10(2H)-yl)propanoate (16p, JG-2028)

Yellow solid (yield 40 mg, 28%); TLC: 50% EtOAc in Hexane, Rf = 0. 5; visualized with UV. HPLC: 91.42% (HPLC RT 5.96 min); ¹H NMR (400MHz, DMSO-d₆, ppm) δ 11.48 (s, 1H), 8.22 (s, 1H), 8.05 (s, 1H), 4.80 (t, J = 7.6 Hz, 2H), 3.66 (s, 3H), 2.97 (q, J = 7.6 Hz, 2H), 2.82 (t, J = 7.6 Hz, 2H), 1.3 (t, J = 7.6 Hz, 3H); LCMS (ESI) m/z 363.5 & 365.7 (M&M+2).

7-Chloro-8-ethyl-10-(2-((4-fluorobenzyl)oxy)ethyl)benzo[g]pteridine-2,4(3H,10H)-dione (20a, JG-2068)

2-((4-Fluorobenzyl)oxy)ethan-1-amine (17a, JG-2068-Z1)

To a solution of 1-(bromomethyl)-4-fluorobenzene (1.0 g, 5.29 mmol, 1 eq) in DMF (5 mL), 2-aminoethan-1-ol (CAS: 141-43-5) (0.645 g, 10.5 mmol, 2.0 eq) and NaH (0.126 g, 5.29 mmol, 1 eq) were added, and the reaction mixture was stirred at RT for 2 h. After completion of the reaction as indicated by TLC, the reaction mixture was quenched with methanol, poured into water (50 mL), and extracted with ethyl acetate (3 x 50 mL). The combined organic layer was dried over anhydrous sodium sulphate and concentrated under vacuum to afford yellow liquid. The crude was forwarded to the next step. LCMS (ESI) m/z 170 (M+1).

4-Chloro-5-ethyl-N-(2-((4-fluorobenzyl)oxy)ethyl)-2-nitroaniline (18a, JG-2068-Z2)

To a solution of 1,4-dichloro-2-ethyl-5-nitrobenzene (3, JG-2001-X) (0.22 g, 0.99 mmol, 1.0 eq) in DMSO (8 mL), 2-((4-fluorobenzyl)oxy)ethan-1-amine(17a, JG-2001-Z1) (0.84 g, 4.70 mmol, 5.0 eq) was added, and the reaction mixture was heated at 160 °C under microwave irradiation for 15 min. After completion of the reaction, as indicated by TLC, the reaction mixture was poured into ice-cold water (50 mL) and extracted with ethyl acetate (3 x 50 mL). The combined organic layer was dried over anhydrous sodium sulphate and concentrated under vacuum. The obtained crude product was further purified by column chromatography (45 % ethyl acetate/hexane) to obtain the title compound as yellow solid (0.045g, 12.93 %) LCMS (ESI) m/z 353.0 & 355.1 (M & M+2).

4-Chloro-5-ethyl-N1-(2-((4-fluorobenzyl)oxy)ethyl)benzene-1,2-diamine (19a, JG-2068-Z3)

To a solution of 4-chloro-5-ethyl-N-(2-((4-fluorobenzyl)oxy)ethyl)-2-nitroaniline (18a, JG-2001-Z2) (0.29g, 0.82 mmol, 1.0 eq) in EtOH: water (4:0.5 mL), Zn Dust (0.43g, 6.57 mmol, 8.0 eq) and NH₄Cl (0.35 g, 6.57 mmol, 8.0 eq) were added and stirred at 90 °C for 10 min. After completion of the reaction as indicated by TLC, the reaction mixture was filtered through Celite, and the filtrate was concentrated under reduced pressure. The obtained crude product was further purified by column chromatography (50 % ethyl acetate/hexane) to obtain the title compound as a yellow solid (0.19g, 71.60 %). Mass (ESI) m/z 323.54 & 325.54 (M+1).

7-Chloro-8-ethyl-10-(2-((4-fluorobenzyl)oxy)ethyl)benzo[g]pteridine-2,4(3H,10H)-dione (20a, JG-2068)

To a solution of 4-chloro-5-ethyl-N1-(2-((4-fluorobenzyl)oxy)ethyl)benzene-1,2-diamine (19a, JG-2001-Z3) (0.19g, 0.59 mmol, 1.0 eq) in AcOH (3 mL), alloxan monohydrate (CAS No: 2244-11-3) (0.094g, 0.11 mmol, 1.0 eq) and boric anhydride (0.082 g, 0.11 mmol, 2.0 eq) were added, and the reaction mixture was stirred at 80°C for 15 min. After completion of the reaction, as indicated by TLC, the reaction mixture was poured into ice-cooled water (10 mL) and filtered. The crude product was triturated with diethyl ether to obtain the title compound as a yellow solid (0.020 g, 7.92 %). TLC: neat EtOAc, Rf = 0. 5; visualized with UV. HPLC: 95.7% (HPLC RT 7.16 min); ¹H NMR (400 MHz, DMSO-d₆) δ 11.44 (s, 1H), 8.18 (s,1H), 8.00 (s,1H), 7.20-7.12 (m,2H), 7.06-7.02 (m,2H), 4.84 (bs,2H), 4.43 (s,2H), 3.89 (bs,2H), 2.84 (q, J = 7.2, 2H), 1.14 (t, J = 7.2 Hz, 3H); LCMS (ESI) m/z 429.0 & 431.1 (M & M+2).

The following compounds 20b-i were made according to the procedure described for 20a, JG-2068 using key intermediate 3, JG-2001-X.

7-Chloro-8-ethyl-10-(2-((3-fluorobenzyl)oxy)ethyl)benzo[g]pteridine-2,4(3H,10H)-dione (20b, JG-2069)

Yellow solid (yield 15 mg, 14%); TLC: neat EtOAc, Rf = 0. 5; visualize with UV. HPLC: 95.6% (HPLC RT 7.06 min); ¹H NMR (400 MHz, DMSO-d₆) δ 11.44 (s, 1H), 8.19 (s, 1H), 8.04 (s, 1H), 7.29-7.23 (m, 1H), 7.05-6.95 (m, 2H), 6.87 (d, J = 10 Hz,1H), 4.88-485(m, 2H), 4.46(s, 2H), 3.93-3.91 (m, 2H), 2.86 (q, J = 7.6 Hz, 2H), 1.16 (t, J = 7.6 Hz 3H); LCMS (ESI) m/z 429.0 & 431.0(M & M+2).

7-Chloro-8-ethyl-10-(2-((4-methylbenzyl)oxy)ethyl)benzo[g]pteridine-2,4(3H,10H)-dione (20c, JG-2070)

Yellow solid (yield 15 mg, 58%); TLC: neat EtOAc, Rf = 0. 4; visualized with UV. HPLC: 95.03% (HPLC RT 7.2 min); ¹H NMR (400 MHz, DMSO-d₆) δ 11.43(s, 1H), 8.18 (s, 1H), 7.99(s, 1H), 6.98 (d, J=8 Hz, 2H), 6.94 (d, J = 8 Hz, 2H), 4.82 (t, J = 4.8, 2H), 4.37(s, 2H), 3.87 (t, J = 4.8, 2H), 2.86(t, J = 7.6, 2H), 2.22(s, 3H), 1.18(t, J = 7.2 Hz, 3H); LCMS (ESI) m/z 425.2 & 427.1(M & M+2).

7-Chloro-8-ethyl-10-(2-((3-(trifluoromethyl)benzyl)oxy)ethyl)benzo[g]pteridine-2,4(3H,10H)-dione (20d, JG-2071)

Yellow solid (yield 90 mg, 30%); TLC: neat EtOAc, Rf = 0. 8; visualized with UV. HPLC: 95.06% (HPLC RT 7.65 min); ¹H NMR (400 MHz, DMSO-d₆) δ 11.44(s, 1H), 8.18 (s, 1H), 8.03(s, 1H), 7.56 (d, J = 7.2 Hz, 1H), 7.48-7.41(m, 2H), 7.36(s, 1H), 4.89 (t, J = 4.8, 2H), 4.54(s, 2H), 3.96 (t, J = 4.8, 2H), 2.81 (q, J = 7.2Hz, 2H), 1.09 (t, J = 7.2 Hz, 3H); LCMS (ESI) m/z 479.1 & 481(M & M+2).

7-Chloro-8-ethyl-10-(2-(pyridin-2-ylmethoxy)ethyl)benzo[g]pteridine-2,4(3H,10H)-dione (20e, JG-2072)

Yellow solid (yield 36 mg, 22%); TLC: neat EtOAc, Rf = 0. 4; visualized with UV. HPLC: 95.05% (HPLC RT 3.93 min); ¹H NMR (400 MHz, DMSO-d₆) δ 11.45 (s, 1H) 8.43-8.42 (m, 1H), 8.35(d, 1H), 8.18 (s, 1H), 8.02(s, 1H), 7.51 (d, J = 7.6 Hz, 1H), 7.25 (dd, J = 4.8 & 8Hz, 1H), 4.86 (t, 2H), 4.49 (s, 2H), 3.93 (t, 2H), 2.84 (q, J = 7.2 Hz, 2H), 1.13(t, J=7.2Hz, 3H); LCMS (ESI) m/z 412.0 & 414.0 (M & M+2).

7-Chloro-8-ethyl-10-(2-(naphthalen-2-ylmethoxy)ethyl)benzo[g]pteridine-2,4(3H,10H)-dione (20f, JG-2073)

Yellow solid (yield 46 mg, 26%); TLC: neat EtOAc, Rf = 0. 6; visualized with UV. HPLC: 95.01% (HPLC RT 7.98 min); ¹H NMR (400 MHz, DMSO-d₆) δ 11.43 (s, 1H), 8.17 (s, 1H), 8.03(s, 1H), 7.86-7.70 (m, 3H), 7.58(s, 1H), 7.50-7.46(m, 2H), 7.22(d, J = 8.4Hz, 1H), 4.89 (t, 2H), 4.61(s, 2H), 3.96(t, J = 4.8, 2H), 2.79(q, J=7.2Hz, 2H), 1.09(t, J = 7.6 Hz, 3H), LCMS (ESI) m/z 461.1 & 463.1(M & M+2).

10-(2-((3-Bromobenzyl)oxy)ethyl)-7-chloro-8-ethylbenzo[g]pteridine-2,4(3H,10H)-dione (20g, JG-2084)

Yellow solid (yield 10 mg, 14%); TLC: neat EtOAc, Rf = 0. 6; visualized with UV. HPLC: 95.77% (HPLC RT 7.57 min); ¹HNMR (400 MHz, DMSO-d₆) δ 11.44(s, 1H) ,8.19(s, 1H), 8.03(s, 1H), 7.39 (d, J = 7.6Hz, 1H), 7.20-7.10 (m,3H), 4.87 (t, 2H), 4.44(s, 2H), 3.93(t, 2H), 2.87(q, J = 6.8, 2H), 1.15(t, J = 7.2Hz, 3H); LCMS (ESI) m/z 488.9 & 490.9 (M & M+2).

10-(2-([1,1'-Biphenyl]-4-ylmethoxy)ethyl)-7-chloro-8-ethylbenzo[g]pteridine-2,4(3H,10H)-dione (20h, JG-2085)

Yellow solid (yield 2 mg, 1%); TLC: neat EtOAc, Rf = 0. 4; visualized with UV. HPLC: 95.06% (HPLC RT 7.65 min); ¹H NMR (400 MHz, DMSO-d₆) δ 11.44 (s, 1H), 8.18 (s, 1H), 8.03(s, 1H), 7.61 (d, J = 7.2 Hz, 2H), 7.51-7.35(m, 5H), 7.19(d, J= 8.0Hz, 2H), 4.87 (m,2H), 4.49 (s, 2H), 3.93 (m, 2H), 2.85 (q, J = 7.2Hz, 2H), 1.15 (t, J = 7.6 Hz, 3H); LCMS (ESI) m/z 487.1 & 489.3(M & M+2).

7-Chloro-8-ethyl-10-(2-((4-methoxybenzyl)oxy)ethyl)benzo[g]pteridine-2,4(3H,10H)-dione (20i, JG-2002-G4)

Yellow solid (yield 17 mg, 18%); TLC: 10% MeOH in DCM, Rf = 0. 9; visualized with UV. HPLC: 93.33% (HPLC RT 6.99 min); ¹H NMR (400 MHz, DMSO-d₆) δ 11.44 (s, 1H), 8.19 (s, 1H), 7.98(s, 1H), 7.02(d, J = 8.4Hz, 2H), 6.74(d, J = 8.4Hz, 2H), 4.81(m, 2H), 4.36(bs, 2H), 3.86 (bs, 2H), 3.70(s, 3H), 2.85 (q, 2H), 1.17(t, 3H); LCMS (ESI) m/z 441.8 & 443.9 (M & M+2).

2-(Benzyloxy)ethan-1-amine (17j, 2003-A2)

To a solution of (bromomethyl)benzene (CAS:100-39-0) (1.0 g, 5.23 mmol, 1 eq) in THF (10 mL), NaH (0.19 g, 7.84 mmol, 1.5 eq) and 2-(2-hydroxyethyl)isoindoline-1,3-dione (0.89 g, 5.23 mmol, 1eq ) were added, and the reaction mixture was stirred at RT for 3h. After completion of the reaction as indicated by TLC, the reaction mixture was poured into water (50 mL) and extracted with ethyl acetate (3 x 50 mL). The combined organic layer was dried over anhydrous sodium sulphate and concentrated under vacuum to obtain yellow liquid (1.19 g,72.40 %). The crude was forwarded to the next step. To a solution of 2-(2-(benzyloxy)ethyl)isoindoline-1,3-dione (1.19g) in ethanol(17 mL), hydrazine hydrate (1.7 ml ) was added, and the reaction mixture was stirred at 90 ⁰C for 30 min. After completion of the reaction, as indicated by TLC, the reaction mixture was filtered, and the filtrate was concentrated under vacuum. The filtrate was poured into water (50 mL) and extracted with (9:1 DCM: MeOH) (3 x 50 mL). The combined organic layer was dried over anhydrous sodium sulphate and concentrated under vacuum to afford a yellow liquid (0.60g, 93.80 %) LCMS (ESI) m/z 152.1 (M+1)

N-(2-(Benzyloxy)ethyl)-4-chloro-5-ethyl-2-nitroaniline (18j, JG-2003-A3)

To a solution of 1,4-dichloro-2-ethyl-5-nitrobenzene (3, JG-2001-X) (0.29g, 1.31 mmol, 1.0eq) in DMSO (9 mL), 2-(benzyloxy)ethan-1-amine (17j, JG-2003-A2) (0.600 g, 3.95 mmol, 3.0 eq) was added, and the reaction mixture was heated at 190°C under microwave irradiation for 15 min. After completion of the reaction, as indicated by TLC, the reaction mixture was poured into ice-cold water (50 mL) and extracted with ethyl acetate (3 x 50 mL). The combined organic layer was dried over anhydrous sodium sulphate and concentrated under vacuum to obtain an orange solid. The crude was carry forwarded for the next step without any purification. LCMS (ESI) m/z 335.3 (M+1).

N1-(2-(Benzyloxy)ethyl)-4-chloro-5-ethylbenzene-1,2-diamine (19j, JG-2003-A4)

To a solution of N-(2-(benzyloxy)ethyl)-4-chloro-5-ethyl-2-nitroaniline (18j, JG-2003-A3) (1.03g, 3.08 mmol, 1.0 eq) in EtOH: water (10:2.5 mL), Zn Dust (1.60g, 24.5 mmol, 8.0 eq) and NH₄Cl (1.31g, 25.52 mmol, 8.0 eq) were added and stirred at 80 °C for 2.5 hr. After completion of the reaction as indicated by TLC, the reaction mixture was filtered through Celite, and the filtrate was concentrated under reduced pressure. The filtrate was poured into ice-cold water (50 mL) and extracted with ethyl acetate (3 x 50 mL). The combined organic layer was dried over anhydrous sodium sulphate and concentrated under vacuum. The crude product was purified by column chromatography (30 % ethyl acetate/hexane) to obtain the title compound (0.16g, 17.15 %, over 2 steps). LCMS (ESI) m/z 304.6 & 306.9 (M & M+2).

10-(2-(Benzyloxy)ethyl)-7-chloro-8-ethylbenzo[g]pteridine-2,4(3H,10H)-dione (20j, JG-2003)

To a solution of N1-(2-(benzyloxy)ethyl)-4-chloro-5-ethylbenzene-1,2-diamine (19j, JG-2003-A4) (0.15 g, 0.493 mmol, 1.0 eq) in AcOH (3 mL), alloxan monohydrate (CAS No: 2244-11-3) (0.078g, 0.49 mmol, 1.0 eq) and boric anhydride (0.068 g, 0.98 mmol, 2.0 eq) were added, and the reaction mixture was stirred at 80°C for 1 hr. After completion of the reaction, as indicated by TLC. The reaction mixture was poured into ice-cooled water (10 mL), and the solid was filtered. The crude product was triturated with diethyl ether to obtain the title compound as a yellow solid (0.065g, 32.13 %). TLC: 10% MeOH in DCM, Rf = 0. 5; visualized with UV. HPLC: 100% (HPLC RT 6.90 min); ¹H NMR (400 MHz, DMSO-d₆) δ 11.44 (s, 1H), 8.19 (s, 1H), 8.03 (s, 1H), 7.22 - 7.11 (m, 5H), 4.85 (t, 2H), 4.45 (s, 2H), 3.91 (t, J = 4.8 Hz, 2H), 2.87 (q, J = 7.2 Hz, 2H), 1.17 (t, J = 7.2 Hz, 3H); LCMS (ESI) m/z 411.6 & 413.6 (M & M+2).

7-Chloro-8-ethyl-10-(2-isobutoxyethyl)benzo[g]pteridine-2,4(3H,10H)-dione (24a, JG-2016)

2-Isobutoxyethan-1-amine (21a, JG-2016-A1)

To a solution of 2-methylpropan-1-ol (25g, 337.2 mmol, 1 eq) in DMF (250 mL/ 10V), 60 % NaH (67.45g, 1686.4 mmol, 5.0 eq) was added portion wise and stirred at 0°C temperature for 1h under nitrogen atmosphere. 2-chloroethan-1-amine hydrochloride (CAS: 870-24-6) (58.68 g, 505.9 mmol, 1.5 eq) was added portion-wise to the reaction mixture and stirred at room temperature for 4h. After completion of the reaction as indicated by TLC, the reaction mixture was poured into aqueous sodium chloride solution and extracted with ethyl acetate (3 x 2L). The combined organic layer was dried over anhydrous sodium sulphate and concentrated under vacuum to 300 ml, then washed with water (2 x 500 mL). The organic layer was dried over anhydrous sodium sulphate and concentrated under vacuum to afford yellow biphasic liquid (21.48 g, 54.34 %) crude material, which was directly used in the next step without further purification. LCMS: (ESI) m/z 118.2(M+1)

4-Chloro-5-ethyl-N-(2-isobutoxyethyl)-2-nitroaniline (22a, JG-2016-A2)

To a solution of 1,4-dichloro-2-ethyl-5-nitrobenzene (3, JG-2001-X) (5.0 g, 22.72 mmol, 1.0 eq) in DMSO (5 mL), 2-isobutoxyethan-1-amine (21a, JG-2016-A1) (13.31 g, 113.6 mmol, 5.0 eq) was added and stirred at 170 °C temperature for 5h. After completion of the reaction as indicated by TLC, the reaction mixture was poured into ice-cooled water (300 mL) and extracted with ethyl acetate (3 x 100 mL). The combined organic layer was dried over anhydrous sodium sulphate and concentrated under vacuum. The crude was further purified by column chromatography (4% ethyl acetate/hexane) to afford yellow liquid (5.0 g, 73.16%) LCMS: (ESI) m/z 301.3, 303.3(M & M+2).

4-Chloro-5-ethyl-N1-(2-isobutoxyethyl)benzene-1,2-diamine (23a, JG-2016-A3)

To a solution of 4-chloro-5-ethyl-N-(2-isobutoxyethyl)-2-nitroaniline (22a, JG-2016-A2) (6.1 g, 20.28 mmol, 1.0 eq) in ethanol: water (8:2v) Zn Dust (10.60 g, 162.2 mmol, 8.0 eq) and NH4Cl (8.67g, 162.2 mmol, 8.0 eq) were added and stirred the reaction mixture at room temperature for 30 min at room temperature. TLC indicated the completion of the reaction. The reaction mixture was frittered through celite, and the filtrate was extracted with ethyl acetate (2 x 50 mL). The organic layer was dried over anhydrous sodium sulphate and concentrated under reduced pressure to afford yellow liquid (5.24g, 95.41 %). The crude product was used in the next step without further purification. LCMS: (ESI) m/z 271.3, 273.2(M&M+2).

7-Chloro-8-ethyl-10-(2-isobutoxyethyl)benzo[g]pteridine-2,4(3H,10H)-dione (24a, JG-2016)

To a solution of 4-chloro-5-ethyl-N1-(2-isobutoxyethyl)benzene-1,2-diamine (23a, JG-2016-A3) (5.24 g, 19.35 mmol, 1.0 eq) in AcOH (25 mL) alloxan monohydrate (CAS: 2244-11-3) (3.09 g, 19.35 mmol, 1.0 eq) and boric anhydride (2.69 g, 38.70 mmol, 2.0 eq) were added and stirred at 50 °C temperature for 30 min. The reaction mixture was poured into ice-cooled water (100 mL) and extracted with ethyl acetate (3 x 50 mL). The reaction mixture was dried over anhydrous sodium sulphate, and the filtrate was concentrated under reduced pressure. The crude product was further purified by column chromatography (80 % ethyl acetate/hexane), and the pure fractions were concentrated under vacuum to afford a yellow solid (2.8g, 38.40 %). TLC: 5% MeOH in DCM, Rf = 0. 3; visualized with UV. HPLC: 95.05% (HPLC RT 6.67 min); ¹H NMR (400 MHz, DMSO-d₆) δ 11.44 (s, 1H), 8.18 (s, 1H), 8.03 (s, 1H), 4.80 (t, 2H), 3.78 (t, J = 4.8 Hz, 2H), 3.12 (d, J = 6.4 Hz, 2H), 2.91 (q, J = 7.2 Hz, 2H), 1.62 (m, 1H), 1.27 (t, J = 7.4 Hz, 3H), 0.70 (d, J = 6.7 Hz, 6H); ¹³C NMR (100 MHz, DMSO-d₆) δ 160.02, 155.90, 150.98, 148.36, 139.41, 134.18, 132.92, 130.83, 130.59, 118.68, 77.73, 67.57, 45.16, 28.47, 27.68, 19.46, 14.16; LCMS: (ESI) m/z 377.3, 379.3(M&M+2).

The following compounds, 24b-g, were made according to the procedure described in the above example 24a, JG-2016 using 3, JG-2001-X, and various amine side chains.

7-Chloro-10-(2-(cyclohexylmethoxy)ethyl)-8-ethylbenzo[g]pteridine-2,4(3H,10H)-dione (24b, JG-2005)

Yellow solid (0.007 g, 13.81%). TLC: neat EtOAc, Rf = 0. 6; visualize with UV. HPLC: 95.17% (HPLC RT 8.55 min); 1HNMR (400MHz, DMSO-d₆) δ 11.44(s,1H), 8.20(s,1H), 8.04(s,1H), 4.81(t,2H), 3.78(t,2H), 3.15(d, J = 6.0,2H), 2.92(q, J = 7.6,2H), 1.56-1.46(m, 5H), 1.29-0.98(m, 7H), 0.77-72(m, 2H); LCMS (ESI) m/z 417.3 & 419.2(M&M+2).

7-Chloro-8-ethyl-10-(2-(neopentyloxy)ethyl)benzo[g]pteridine-2,4(3H,10H)-dione (24c, JG-2014)

Yellow solid (35 mg, 17 %). TLC: 5% MeOH in DCM, Rf = 0. 4; visualized with UV. HPLC: 95.05% (HPLC RT 6.67 min); 1H NMR (400 MHz, DMSO-d₆ ppm) δ 11.43 (s, 1H), 8.19 (s, 1H), 8.05 (s, 1H), 4.83 (bs, 2H), 3.81 (bs, 2H), 3.00 (s, 2H), 2.92 (q, J = 7.6Hz, 2H), 1.29 (t, J = 7.4 Hz, 3H), 0.67 (s, 9H); LCMS: (ESI) m/z 391.1, 393.1(M& M+2).

7-Chloro-10-(2-(cyclopentylmethoxy)ethyl)-8-ethylbenzo[g]pteridine-2,4(3H,10H)-dione (24d, JG-2006)

Yellow solid (yield 8 mg, 6%); TLC: 5% MeOH in DCM, Rf = 0. 3; visualized with UV. HPLC: 98.54% (HPLC RT 7.86 min); ¹H NMR (400 MHz, DMSO-d₆) δ 11.44 (s, 1H), 8.19 (s, 1H), 8.03 (s, 1H), 4.80 (t, 2H), 3.79 (t, J = 4.8 Hz, 2H), 3.23 (d, J = 6.8 Hz, 2H), 2.91 (q, J = 7.2 Hz, 2H), 1.95-1.88 (m, 1H),1.49-1.38(m, 6H), 1.27 (t, J = 7.6 Hz, 3H), 1.04-0.95 (m, 2H), LCMS (ESI) m/z 403.1 & 405.1 (M & M+2).

7-Chloro-8-ethyl-10-(2-(2,2,2-trifluoroethoxy)ethyl)benzo[g]pteridine-2,4(3H,10H)-dione (24e, JG-2015)

Yellow solid (yield 12 mg, 8%); TLC: 10% MeOH in DCM, Rf = 0. 5; visualized with UV. HPLC: 99.47% (HPLC RT 6.74 min); ¹H NMR (400 MHz, DMSO-d₆) δ 11.46 (s, 1H), 8.20 (s, 1H), 8.00 (s, 1H), 4.85 (s, 2H), 4.09-4.00(m, 4H), 2.91 (q, J = 7.2 Hz, 2H), 1.27 (t, J = 7.6 Hz, 3H); LCMS (ESI) m/z 403.0 & 405.1 (M & M+2).

7-Chloro-8-ethyl-10-(2-(furan-3-ylmethoxy)ethyl)benzo[g]pteridine-2,4(3H,10H)-dione (24f, JG-2008)

Yellow solid (yield 28 mg, 10%); TLC: 5% MeOH in DCM, Rf = 0. 4; visualized with UV. HPLC: 97.32% (HPLC RT 6.38 min); ¹H NMR (400 MHz, DMSO-d₆) δ 11.44 (s, 1H), 8.19 (s, 1H), 7.99 (s, 1H), 7.55-7.53(m, 2H), 6.24(s, 1H), 4.80 (t, 2H), 4.33(s, 2H), 3.83(t, 2H), 2.89 (q, J = 7.2 Hz, 2H), 1.20 (t, J = 7.6 Hz, 3H); LCMS (ESI) m/z 401.0 & 403.0 (M & M+2).

4-((2-(7-Chloro-8-ethyl-2,4-dioxo-3,4-dihydrobenzo[g]pteridin-10(2H)-yl)ethoxy)methyl)benzonitrile (24g, JG-2092)

Yellow solid (yield 41 mg, 20%); TLC: 5% MeOH in DCM, Rf = 0. 2; visualized with UV. HPLC: 96.4% (HPLC RT 6.59 min); ¹H NMR (400 MHz, DMSO-d₆) δ 11.45 (s, 1H), 8.19 (s, 1H), 8.02 (s, 1H), 7.71(d, J = 8.0Hz, 2H), 7.31(d, J = 8.0Hz, 2H), 4.87 (bs, 2H), 4.56 (s, 2H), 3.93(bs, 2H), 2.87 (q, J = 7.2 Hz, 2H), 1.15 (t, J = 7.2Hz, 3H); LCMS (ESI) m/z 436.0 & 438.0 (M & M+2).

7-Chloro-8-ethyl-10-(2-(pyrazin-2-ylmethoxy)ethyl)benzo[g]pteridine-2,4(3H,10H)-dione (28, JG-2011)

2-(Pyrazin-2-ylmethoxy)ethan-1-amine (25, JG-2011-A2)

Pyrazin-2-ylmethanol, (CAS 6705-33-5) (100 mg, 1 eq) was mixed with NaH (5 eq) and CAS 39684-80-5 (2 eq) in THF, then chilled to 0 ^oC on ice and allowed to warm to room temperature for 3 h. Product formation25, (JG-2011-A2) was confirmed by TLC and LCMS, purified by reverse phase chromatography (yield 590 mg).

7-Chloro-8-ethyl-10-(2-(pyrazin-2-ylmethoxy)ethyl)benzo[g]pteridine-2,4(3H,10H)-dione (28, JG-2011)

3 (JG-2001-X) (238 mg, 1 eq) was combined with 25, (JG-2011-A2) (3 eq) in DMSO, then heated to 190 ⁰C for 15 minutes in a microwave. Product formation 26 (JG-2011-A3) was observed by TLC and LCMS and purified by column chromatography (yield 63 mg). Then, 26 (JG-2011-A3) (63 mg, 1 eq) was combined with Zn (8 eq) and NH₄Cl (8 eq) in an 8:2 mixture of ethanol:water, reacted for 30 minutes at 80 ⁰C and product formation 27, (JG-2011-A4) was confirmed by TLC, LCMS, purified by column chromatography (yield 54 mg). Next, 27, (JG-2011-A4) (54 mg, 1 eq) was mixed with alloxan, boric acid, and acetic acid, heated to 80 ⁰C for 15, and product formation 28, (JG-2011) was observed, confirmed by TLC, and purified by column chromatography (yield 7 mg, 14%). TLC: 10% MeOH in DCM, Rf = 0. 9; visualized with UV. HPLC: 95.81% (HPLC RT 5.53 min) ¹H NMR (400 MHz, DMSO-d₆, ppm) δ 11.46 (s, 1H), 8.52 (s, 2H), 8.42 (s, 1H), 8.20 (s, 1H), 8.08 (s, 1H), 4.90 (s, 2H), 4.63 (s, 2H), 4.02 (s, 2H), 2.86 (s, 2H), 1.16 (s, 3H); LCMS, calc’d 412.83 (ESI) m/z; found 413.64 (ESI) m/z.

tert-butyl 4-((2-(7-chloro-8-ethyl-2,4-dioxo-3,4-dihydrobenzo [g] pteridin-10 (2H)-yl) ethoxy) methyl) piperidine-1-carboxylate (33, JG-2009)

tert-Butyl 4-((2-aminoethoxy)methyl)piperidine-1-carboxylate (29, JG-2009-A1)

To a solution of tert-butyl 4-(hydroxymethyl)piperidine-1-carboxylate (0.5 g, 2.30 mmol, 1 eq) in DMF (20 mL), Sodium hydride (0.93 g, 23.20 mmol, 10.0 eq) was added portion wise at 0°C, and the reaction mixture was allowed to stir for 1 hr at 0°C. 2-chloroethan-1-amine hydrochloride (CAS: 870-24-6) (0.54 g, 4.60 mmol, 2eq) was added slowly at 0°C, and the reaction mixture was stirred at 0° to room temperature for 16 hr. After completion of the reaction as indicated by TLC, the reaction mixture was quenched into ice-cold water (20 mL) and extracted with ethyl acetate (3 x 20 mL). The combined organic layer was dried over anhydrous sodium sulphate and concentrated under vacuum to afford crude colorless liquid (0.93g, quantitative). The reaction was only monitored by TLC and used immediately in the next step.

tert-Butyl 4-((2-((4-chloro-5-ethyl-2-nitrophenyl)amino)ethoxy)methyl)piperidine-1-carboxylate (30, JG-2009-A2)

To a solution of 1,4-dichloro-2-ethyl-5-nitrobenzene (3, JG-2001-X) (0.25 g, 1.10 mmol, 1 eq) in DMSO (4.0 mL), 4-((2-aminoethoxy)methyl)piperidine-1-carboxylate (29, JG-2009-A1) (0.9 g, 4.50 mmol, 4.0 eq) was added and heated at 190°C under microwave irradiation for 7 min. After completion of the reaction as indicated by TLC, the reaction mixture was poured into water (10 mL) and extracted with ethyl acetate (3 x 10 mL). The combined organic layer was dried over anhydrous sodium sulphate and concentrated under vacuum to afford yellow liquid (0.27 g, quantitative), LCMS: (ESI) m/z 442.01

The crude material was directly used in the next step without further purification.

tert-Butyl 4-((2-((2-amino-4-chloro-5-ethylphenyl) amino) ethoxy) methyl) piperidine-1-carboxylate (31, JG-2009-A3)

To a solution of tert-butyl 4-((2-((4-chloro-5-ethyl-2-nitrophenyl)amino)ethoxy)methyl)piperidine-1-carboxylate (30, JG-2009-A2) (0.27 g, 6.10 mmol, 1.0 eq) in EtOH: water (8:2 mL), Zn Dust (0.261 g, 4.80 mmol, 8.0 eq) and NH4Cl (0.32 g, 4.80 mmol, 8.0eq) were added and stirred at 50 °C for 1 hr. After completion of the reaction as indicated by TLC, the reaction mixture was filtered through Celite, and the filtrate was extracted with ethyl acetate (2 x 50 mL). The combined organic layers were dried over anhydrous sodium sulphate and concentrated under reduced pressure to obtain crude product as a sticky solid (0.24 g, quantitative), LCMS: (ESI) m/z 412.2 & 414.2 (M & M+2),

Note: Crude material was directly used in the next step without further purification.

tert-Butyl 4-((2-(7-chloro-8-ethyl-2,4-dioxo-3,4-dihydrobenzo [g] pteridin-10 (2H)-yl) ethoxy) methyl) piperidine-1-carboxylate (32, JG-2009-Boc)

To a solution of tert-butyl 4-((2-((2-amino-4-chloro-5-ethylphenyl) amino) ethoxy) methyl) piperidine-1-carboxylate (31, JG-2009-A3) (0.24 g, 0.58 mmol, 1.0 eq) in AcOH (5.0 mL), alloxan monohydrate (CAS: 2244-11-3) (0.093 g, 0.58 mmol, 1.0 eq) and boric anhydride (0.081 g, 1.10 mmol, 2.0 eq) were added. The reaction mixture was stirred at 50 °C for 5 min. After completion of the reaction as indicated by TLC, the reaction mixture was quenched with ice-cold water (30 mL) slowly and stirred for 20 min. Allowing the crude product to precipitate. The reaction mass was filtered over a micro Buckner funnel, and the solid was washed with ice-cold water (5 ml × 2). The solid was dried under reduced pressure to afford a reddish brown solid. The crude product was triturated with acetonitrile (10 ml×2) to obtain the title compound as a yellow solid (0.01 g, 3.0 %). LCMS: (ESI) m/z 518.1 & 520.1 (M & M+2).

2,2,2-Trifluoroacetaldehyde compound with 7-chloro-8-ethyl-10-(2-(piperidin-4-ylmethoxy) ethyl) benzo [g] pteridine-2,4(3H,10H)-dione (33, JG-2009)

To a solution of tert-butyl 4-((2-(7-chloro-8-ethyl-2,4-dioxo-3,4-dihydrobenzo [g] pteridin-10 (2H)-yl) ethoxy) methyl) piperidine-1-carboxylate (32-Boc, JG-2009-Boc) (0.02 g, 0.038 mmol, 1 eq) in DCM (2 mL), Trifluoroacetic acid (0.011 mL, 0.15 mmol, 4.0 eq) was added at 0°C, and the reaction mixture was allowed to stir for 2hr at room temperature. After completion of the reaction, as indicated by TLC, the reaction mixture was concentrated under vacuum and dried under reduced pressure. The crude was triturated with diethyl ether (10ml × 2) to obtain the title compound as a yellow solid (0.013 g, 81.25%). TLC: 15% MeOH in DCM, Rf = 0. 3; visualized with UV. HPLC: 93.33% (HPLC RT 6.99 min); ¹H NMR: (400Mz, DMSO-d₆) δ 11.49 (s, 1H), 8.40 (bs, 2H), 8.21 (s, 1H), 8.00 (s, 1H), 4.80 (t, 2H), 3.81 (t, 2H), 3.26 (d, J = 6.4Hz, 2H), 3.10-3.06 (m, 2H), 2.93 (q, J = 7.2Hz, 2H), 2.85-2.60 (m, 2H), 1.75-1.55 (m, 3H), 1.28 (t, J = 7.6Hz, 3H), 1.20-1.10(m, 2H); LCMS: (ESI) m/z 418.1 & 420.0 (M & M+2);

7-Chloro-8-ethyl-10-(2-(p-tolyloxy)ethyl)benzo[g]pteridine-2,4(3H,10H)-dione (37a, JG-2082)

2-(p-Tolyloxy)ethan-1-amine (34a, JG-2082-A1)

To a solution of p-cresol (0.20 g, 1.85 mmol, 1 eq) and 2-chloroethylamine hydrochloride (0.21g, 1.85 mmol, 1.0 eq) in DMF (35 mL), sodium hydride (0.46 g, 9.25 mmol, 5 eq) was added, and the reaction mixture was stirred at room temperature for 18h at room temperature. The reaction mixture was quenched with ice water (25 mL) and extracted with ethyl acetate (3 x 50 mL). The combined organic phases were dried over anhydrous sodium sulphate and concentrated under vacuum. The crude product was purified by column chromatography to obtain the title compound as a white gummy solid. (0.12 g, 42.8%). LCMS (ESI) m/z 152.02(M+1)

4-Chloro-5-ethyl-2-nitro-N-(2-(p-tolyloxy)ethyl)aniline (35a, JG-2082-A2)

A solution of 2-(p-tolyloxy)ethan-1-amine (34a, JG-2082-A1) (0.120 g, 0.794 mmol, 1 eq) and 1,4-dichloro-2-ethyl-5-nitrobenzene (3, JG-2001-X) (0.21 g, 0.794 mmol, 1.0 eq), in DMSO (2 mL) was heated at 190°C under microwave irradiation for 20 min. The reaction mixture was poured into water (25 mL) and extracted with ethyl acetate (2 x 25 mL). The organic phase was dried over anhydrous sodium sulphate and concentrated under vacuum. The crude product was purified by column chromatography (20% ethyl acetate/hexane) to obtain the title compound as a yellow solid. (0.100 g, 37.70%). LCMS: (ESI) m/z 335.13(M+1)

4-Chloro-5-ethyl-N1-(2-(p-tolyloxy)ethyl)benzene-1,2-diamine (36a, JG-2082-A3)

To a solution of 4-chloro-5-ethyl-2-nitro-N-(2-(p-tolyloxy)ethyl)aniline (35a, JG-2082-A2) (0.10 g, 0.299 mmol, 1 eq) in ethanol (10 mL) and water (2 mL), Zinc dust (0.156 g, 2.39 mmol, 8 eq), and ammonium chloride (0.128 g, 2.39 mmol, 8 eq) were added, and the reaction mixture was stirred at 90°C 2h. After completion of the reaction as indicated by TLC, the reaction mixture was filtered through celite and washed with ethyl acetate (50ml). The filtrate was washed with water (50 ml), and the organic phase was dried over anhydrous sodium sulphate. The combined organic layers were concentrated under vacuum to afford the crude product as a yellow liquid. (0.080 g, 88.01%). LCMS: (ESI) m/z 305.1 & 307.1(M & M+2).

7-Chloro-8-ethyl-10-(2-(p-tolyloxy)ethyl)benzo[g]pteridine-2,4 (3H,10H)-dione (37a, JG-2082)

To a solution of 4-chloro-5-ethyl-N1-(2-(p-tolyloxy)ethyl)benzene-1,2-diamine (36a, JG-2082-A3) (0.080 g, 0.29 mmol, 1.0 eq) in AcOH (30 mL) alloxan monohydrate(CAS: 2244-11-3) (0.042 g, 0.296 mmol, 1.0 eq), and Boric anhydride (0.041g, 0.592 mmol, 2.0 eq) were added, and the reaction mixture was stirred at 80 °C for 2h. The reaction mixture was quenched with ice-cooled water (35 mL) and extracted with ethyl acetate (2 x 50 mL). The combined organic phases were dried over anhydrous sodium sulphate and concentrated under reduced pressure. The crude product was further purified by column chromatography (100 % ethyl acetate) to afford a yellow solid (0.010g, 8.24%); TLC: 15% EtOAc in Hexane, Rf = 0; visualized with UV. HPLC: 97.24% (HPLC RT 7.50 min); 1H NMR (400 MHz, DMSO-d₆): δ: 11.45 (s, 1H), 8.21 (s, 1H), 8.10(s, 1H), 7.05(d, J=8.4Hz, 2H), 6.75(d, J=8.0Hz, 2H), 4.99 (t, 2H), 4.37 (t, 2H), 2.92 (q , 2H), 2.19(s, 3H), 1.28 (t, J= 7.6Hz, 3H); LCMS: (ESI) m/z 410.9 & 413.2(M & M+2).

Note: The following compounds 37b-p were made according to the procedure described for 37a (JG-2082) using compound 3 (JG-2001-X) and the respective amines.

7-Chloro-8-ethyl-10-(3-phenoxypropyl)benzo[g]pteridine-2,4(3H,10H)-dione (37b, JG-2067)

Yellow solid (yield 10 mg, 14%); TLC: 5% MeOH in DCM, Rf = 0. 2; visualized with UV. HPLC: 96.54% (HPLC RT 7.59 min); ¹H NMR (400 MHz, DMSO-d₆): δ: 11.42 (s, 1H), 8.22 (s, 1H), 7.90 (s, 1H), 7.29-7.25 (m, 2H), 6.94-6.85 (m, 3H), 4.76 (bs, 2H), 4.11 (t, 2H), 2.82 (q, J = 7.6Hz, 2H), 2.24 (bs, 2H), 1.16 (t, J = 7.2Hz, 3H); LCMS (ESI) m/z 411.0 & 413.0(M &M+2).

7-Chloro-8-ethyl-10-(3-(4-fluorophenoxy)propyl)benzo[g]pteridine-2,4(3H,10H)-dione (37c, JG-2074)

Solid (yield 6 mg, 10%); TLC: 5% MeOH in DCM, Rf = 0. 4; visualized with UV. HPLC: 97.03% (HPLC RT 7.31 min); ¹H NMR (400MHz, DMSO-d₆, ppm) δ 11.43 (s, 1H), 8.20 (s, 1H), 7.86 (s, 1H), 7.08 (t, J = 8.8 Hz, 2H), 6.84 (m, J = 4 Hz, 2H), 4.75 (t, 2H), 4.07 (t, J = 5.6 Hz, 2H), 2.81 (q, J = 7.6 Hz, 2H), 2.21 (m, J = 6.4 Hz, 2H), 1.14 (t, J = 7.2 Hz, 3H); LCMS: (ESI) m/z 429.0 & 431.0(M &M+2).

7-Chloro-8-ethyl-10-(3-(3-(trifluoromethyl)phenoxy)propyl)benzo[g]pteridine-2,4(3H,10H)-dione (37d, JG-2076)

Solid (yield 4 mg, 7%); TLC: 5% MeOH in DCM, Rf = 0. 3; visualized with UV. HPLC: 100% (HPLC RT 7.87 min); ¹H NMR (400 MHz, DMSO-d₆): δ: 11.43 (s, 1H), 8.21 (s, 1H), 7.91 (s, 1H), 7.52-7.48 (m, 1H), 7.28-7.11 (m, 3H), 4.77 (t, 2H), 4.20(bs, 2H), 2.80 (q, J = 7.6Hz, 2H), 2.30-2.20 (m, 2H), 1.12 (t, J = 7.2Hz, 3H); LCMS: (ESI) m/z 479.0 & 481.0(M &M+2).

7-Chloro-8-ethyl-10-(3-(p-tolyloxy)propyl)benzo[g]pteridine-2,4(3H,10H)-dione (37e, JG-2077)

Solid (yield 37 mg, 28%); TLC: 5% MeOH in DCM, Rf = 0. 2; visualized with UV. HPLC: 100% (HPLC RT 7.79 min); ¹H NMR (400 MHz, DMSO-d₆): δ: 11.42 (s, 1H), 8.21 (s, 1H), 7.88 (s, 1H), 7.06 (d,J= 8.0Hz, 2H), 6.76 (d, J = 8.4 Hz, 2H), 4.74 (t, 2H), 4.08 (t, J = 5.6Hz, 2H), 2.82 (q, J = 7.6Hz, 2H),2.21(s, 3H), 2.20-2.15(m, 2H), 1.17 (t, J = 7.2Hz, 3H); LCMS: (ESI) m/z 425.0 & 427.0(M &M+2).

7-Chloro-10-(3-(3,5-difluorophenoxy)propyl)-8-ethylbenzo[g]pteridine-2,4(3H,10H)-dione (37f, JG-2078)

Solid (yield 9 mg, 9%); TLC: neat EtOAc, Rf = 0. 6; visualized with UV. HPLC: 96.7% (HPLC RT 7.51 min); ¹H NMR (400 MHz, DMSO): δ: 11.44 (s, 1H), 8.23 (s, 1H), 7.89 (s, 1H), 6.80-6.75 (m, 1H), 6.64-6.61 (m, 2H), 4.74 (t, 2H), 4.15 (t, J = 5.6Hz, 2H), 2.85 (q, J= 7.6Hz, 2H), 2.24-2.21(m, 2H), 1.18 (t, J = 7.6Hz, 3H); LCMS: (ESI) m/z 447.0 & 449.0(M &M+2).

10-(3-([1,1'-Biphenyl]-4-yloxy)propyl)-7-chloro-8-ethylbenzo[g]pteridine-2,4(3H,10H)-dione (37g, JG-2086)

Yellow solid (yield 50 mg, 40%); TLC: 30% EtOAc in Hexane, Rf = 0. 5; visualized with UV. HPLC: 99.64% (HPLC RT 8.38 min); ¹H NMR (400 MHz, DMSO-d₆): δ: 11.44 (s, 1H), 8.21 (s, 1H), 7.90 (s, 1H), 7.61-7.56(m, 4H), 7.41 (dd, J = 7.6Hz, 2H), 7.30 (t, J = 7.2Hz, 1H), 6.95(d, J = 8.4Hz, 2H), 4.75 (t, 2H), 4.17 (t, J = 5.6Hz, 2H), 2.82 (q, J = 7.2Hz, 2H), 2.28-2.25(m, 2H), 1.16 (t, J = 7.2Hz, 3H); LCMS: (ESI) m/z 487.0 & 489.0(M &M+2).

10-(3-(4-Bromophenoxy)propyl)-7-chloro-8-ethylbenzo[g]pteridine-2,4(3H,10H)-dione (37h, JG-2087)

Solid (yield 10 mg, 8%); TLC: 5% MeOH in DCM, Rf = 0. 2; visualized with UV. HPLC: 98.8% (HPLC RT 7.94 min); ¹H NMR (400 MHz, DMSO-d₆): δ: 11.43 (s, 1H), 8.21 (s, 1H), 7.88 (s, 1H), 7.43 (d, J = 8.4Hz, 2H), 6.84 (d, J = 8.8 Hz, 2H), 4.73 (bs, 2H), 4.11 (t, 2H), 2.82 (q , J = 7.2Hz, 2H), 2.30-2.25(m, 2H), 1.17 (t, J= 7.2Hz, 3H); LCMS: (ESI) m/z 490.9 & 492.9(M &M+2).

3-(3-(7-Chloro-8-ethyl-2,4-dioxo-3,4-dihydrobenzo[g]pteridin-10(2H)-yl)propoxy)benzonitrile (37i, JG-2088)

Solid (yield 45 mg, 17%); TLC: 5% MeOH in DCM, Rf = 0. 3; visualized with UV. HPLC: 100% (HPLC RT 6.86 min);¹H NMR (400 MHz, DMSO): δ: 11.44 (s, 1H), 8.22 (s, 1H), 7.90 (s, 1H), 7.49-7.38 (m, 2H), 7.33 (s, 1H), 7.20(dd, J=8.0 & 1.6Hz, 1H), 4.75 (t, 2H), 4.19(t, J = 5.6Hz, 2H), 2.83 (q, J = 7.6Hz, 2H), 2.26-2.23 (m, 2H), 1.16 (t, J = 7.2Hz, 3H); LCMS: (ESI) m/z 436.1 & 438.1(M &M+2).

7-Chloro-8-ethyl-10-(2-phenoxyethyl)benzo[g]pteridine-2,4(3H,10H)-dione (37j, JG-2034)

Yellow solid (yield 41 mg, 29%); TLC: Neat EtOAc, Rf = 0. 3; visualized with UV. HPLC: 95.01% (HPLC RT 7.35 min); ¹H NMR (400 MHz, DMSO-d₆): δ: 11.46 (s, 1H), 8.22 (s, 1H), 8.13 (s, 1H), 7.26(t, J = 8Hz, 2H), 6.94-6.85 (m, 3H), 5.02 (t, 2H), 4.43(bs, 2H), 2.93 (q , J = 7.2Hz, 2H), 1.29 (t, J = 7.6Hz, 3H); LCMS: (ESI) m/z 397.50 & 399.62(M &M+2).

7-Chloro-8-ethyl-10-(2-(4-fluorophenoxy)ethyl)benzo[g]pteridine-2,4(3H,10H)-dione (37k, JG-2079)

Brown solid (yield 16 mg, 17%); TLC: 5% MeOH in DCM, Rf = 0. 3; visualized with UV. HPLC: 90.82% (HPLC RT 7.1 min); ¹H NMR (400 MHz, DMSO-d₆): δ: 11.45 (s, 1H), 8.21 (s, 1H), 8.11(s, 1H), 7.10-7.06(m, 2H), 6.88-6.84(m, 2H), 5.00 (t, 2H), 4.39 (t, 2H), 2.92 (q , J = 7.2Hz, 2H), 1.26 (t, J = 7.6Hz, 3H); LCMS: (ESI) m/z 415.0 & 417.0(M &M+2).

7-Chloro-8-ethyl-10-(2-(3-fluorophenoxy)ethyl)benzo[g]pteridine-2,4(3H,10H)-dione (37l, JG-2080)

Dark brown solid (yield 16 mg, 5%); TLC: 5% MeOH in DCM, Rf = 0. 4; visualize with UV. HPLC: 97.26% (HPLC RT 7.58 min); ¹H NMR (400 MHz, DMSO-d₆): δ: 11.46 (s, 1H), 8.21 (s, 1H), 8.09(s, 1H), 7.28-7.25(m, 1H), 6.76-6.67(m, 3H), 5.01 (t, 2H), 4.44 (t, 2H), 2.92 (q, J= 7.2Hz, 2H), 1.26 (t, J = 7.6Hz, 3H); LCMS: (ESI) m/z 415.0 & 417.1(M &M+2).

7-Chloro-8-ethyl-10-(2-(3-(trifluoromethyl)phenoxy)ethyl)benzo[g]pteridine-2,4(3H,10H)-dione (37m, JG-2081)

Brown solid (yield 16 mg, 3%); TLC: 10% MeOH in DCM, Rf = 0. 3; visualized with UV. HPLC: 97.26% (HPLC RT 7.58 min); ¹H NMR (400 MHz, DMSO-d₆): δ: 11.46 (s, 1H), 8.21 (s, 1H), 8.13(s, 1H), 7.48(t, J = 7.6Hz, 1H), 7.27(d, J = 7.2Hz,, 1H), 7.17(d, J = 8Hz, 1H), 7.09(s, 1H), 5.04 (t, 2H), 4.51 (t, 2H), 2.91 (q, J = 7.2Hz, 2H), 1.28 (t, 3H); LCMS: (ESI) m/z 465.0 & 467.0(M &M+2).

7-Chloro-10-(2-(3,5-difluorophenoxy)ethyl)-8-ethylbenzo[g]pteridine-2,4(3H,10H)-dione (37n, JG-2083)

White solid (yield 8 mg, 3%); TLC: 10% MeOH in DCM, Rf = 0. 2; visualized with UV. HPLC: 92.12% (HPLC RT 7.34 min); ¹H NMR (400 MHz, DMSO-d₆): δ: 11.46 (s, 1H), 8.21 (s, 1H), 8.05(s, 1H), 6.79-6.77(m,1H), 6.65-6.63(m, 2H), 5.01 (t, 2H), 4.46 (t, 2H), 2.92 (q, J = 7.2Hz, 2H), 1.27 (t, J = 7.6Hz, 3H); LCMS: (ESI) m/z 433.0 & 435.0(M &M+2).

10-(2-([1,1'-Biphenyl]-4-yloxy)ethyl)-7-chloro-8-ethylbenzo[g]pteridine-2,4(3H,10H)-dione (37o, JG-2089)

Orange solid (yield 80 mg, 25%); TLC: 5% MeOH in DCM, Rf = 0. 4; visualized with UV. HPLC: 100% (HPLC RT 8.13 min); ¹H NMR (400 MHz, DMSO-d₆): δ: 11.45 (s, 1H), 8.21 (s, 1H), 8.13(s, 1H), 7.57-7.55(m,4H), 7.42-7.27(m, 3H), 6.95(d, J= , 2H), 5.04 (t, 2H), 4.48 (t, 2H), 2.93 (q, J = 7.2Hz, 2H), 1.29 (t, J = 7.2Hz, 3H); LCMS: (ESI) m/z 473.2 & 475.1(M &M+2).

10-(2-(4-Bromophenoxy)ethyl)-7-chloro-8-ethylbenzo[g]pteridine-2,4(3H,10H)-dione (37p, JG-2090)

Yellow solid (yield 8 mg, 5%); TLC: neat EtOAc, Rf = 0. 3; visualized with UV. HPLC: 94.1% (HPLC RT 7.73 min); ¹H NMR (400 MHz, DMSO-d₆): δ: 11.46 (s, 1H), 8.21 (s, 1H), 8.11 (s, 1H), 7.42 (d, J = 8.8Hz, 2H), 6.83 (d, J = 8.8Hz, 2H), 5.00 (t, 2H), 4.41 (t, 2H), 2.93 (q, 2H), 1.28 (t, J = 7.6Hz, 3H); LCMS: (ESI) m/z 474.8 & 476.9 (M& M+2).

10-(2-Aminoethyl)-7-chloro-8-ethylbenzo[g]pteridine-2,4(3H,10H)-dione 2,2,2-trifluoroacetate (41, JG-2025)

tert-Butyl (2-((4-chloro-5-ethyl-2-nitrophenyl)amino)ethyl)carbamate (38, JG-2025-A1)

1,4-dichloro-2-ethyl-5-nitrobenzene (3, JG-2001-X) (3.0 g, 13.63 mmol, 1 eq) and tert-butyl (2-aminoethyl)carbamate (CAS: 57260-73-8) (2.18 g, 13.63 mmol, 1.0 eq) were stirred neat at 150°C temperature. After 18h of stirring, TLC analysis confirmed consumption of 3. The reaction mixture was slowly poured into water (100 mL) and extracted with ethyl acetate (2 x 75 mL). The combined organic phases were dried over anhydrous sodium sulphate and concentrated under vacuum. The crude material was purified by column chromatography (30 % ethyl acetate/hexane) as a yellow solid (3.01g, 64.3 %). LCMS: (ESI) m/z 344.6 & 346.6(M+1)

tert-Butyl (2-((2-amino-4-chloro-5-ethylphenyl)amino)ethyl)carbamate (39, JG-2025-A2)

To a solution of tert-butyl (2-((4-chloro-5-ethyl-2-nitrophenyl)amino)ethyl)carbamate (38, JG-2025-A1) (3.0 g, 8.72 mmol) in ethanol: water (8:2V, 40 mL), Zn Dust (4.56 g, 69.8 mmol, 8.0 eq), and NH4Cl (3.73 g, 69.8 mmol, 8.0 eq) were added, and the reaction mixture was stirred at 80°C. Reaction progress was further monitored using TLC (mobile phase: 20% ethyl acetate in hexane); after 6h of stirring, TLC analysis confirmed consumption of 38. The reaction mixture was filtered through celite. The filtrate was poured into water (75 mL) and extracted with ethyl acetate (2 x 100 mL). The combined organic phases were dried over anhydrous sodium sulphate and concentrated under reduced pressure. The crude product material was directly used in the next step (2.8g, Quantitative). LCMS: (ESI) m/z 314.6 & 316.6(M & M+2).

tert-Butyl (2-(7-chloro-8-ethyl-2,4-dioxo-3,4-dihydrobenzo[g]pteridin-10(2H)-yl)ethyl)carbamate (40, JG-2025-Boc)

To a solution of tert-butyl (2-((2-amino-4-chloro-5-ethylphenyl)amino)ethyl)carbamate (39, JG-2025-A2) (2.75g, 8.70 mmol, 1.0 eq) in AcOH (30 mL), alloxan monohydrate (CAS: 2244-11-3) (1.54 g, 8.70 mmol, 1.0 eq) and boric anhydride (1.36 g, 17.53mmol, 2.0 eq) were added. The reaction mixture was stirred at 80 °C temperature. Reaction progress was further monitored using TLC (mobile phase: 100 % ethyl acetate in hexane). After 2h of stirring, TLC analysis confirms the consumption of SM. The reaction mixture was slowly poured into ice-cooled water (100 mL) and extracted with ethyl acetate (2 x 100 mL). The organic phase was dried over anhydrous sodium sulphate and concentrated under reduced pressure. The crude product was further purified by column chromatography (100 % ethyl acetate) to obtain a yellow solid (2.15 g, 58.9 %) LCMS: (ESI) m/z 420.80 & 422.8 (M& M+2)

10-(2-Aminoethyl)-7-chloro-8-ethylbenzo[g]pteridine-2,4(3H,10H)-dione 2,2,2-trifluoroacetate (41, JG-2025)

To a solution of tert-butyl (2-(7-chloro-8-ethyl-2,4-dioxo-3,4-dihydrobenzo[g]pteridin-10(2H)-yl)ethyl)carbamate (40, JG-2025-Boc) (2.0 g, 4.77 mmol, 1.0 eq) in DCM (30 mL), TFA (10.86 g, 95.2 mmol, 20.0 eq) was added, and the reaction mixture was stirred at room temperature for 6h. Reaction progress was monitored using TLC (100% ethyl acetate/ hexane). The reaction mixture was concentrated under vacuum, triturated with MTBE and diethyl ether, and again dried under vacuum to afford the product as a yellow solid (1.85g, 90.2 %). TLC: neat EtOAc, Rf = 0; visualized with UV. HPLC: 92.01% (HPLC RT 4.06 min); 1H NMR (400 MHz, DMSO-d₆): δ: 11.58 (s, 1H), 8.29 (s, 1H), 7.95 (bs, 4H), 4.87 (t, 2H), 3.23 (bs, 2H), 2.96 (q, 2H), 1.31 (t, 3H); LCMS: (ESI) m/z 320.51 (M+1).

Synthesis of amide derivatives 42a-c using 41

N-(2-(7-Chloro-8-ethyl-2,4-dioxo-3,4-dihydrobenzo[g]pteridin-10(2H)-yl)ethyl)acetamide (42a, JG-2052)

To a solution of 10-(2-aminoethyl)-7-chloro-8-ethylbenzo[g]pteridine-2,4(3H,10H)-dione (41, JG-2025) (0.050 g, 0.156 mmol, 1 eq) in DMF (2 mL), potassium carbonate (0.064g, 0.468 mmol, 3 eq), and acetyl chloride (0.014 mg, 0.188 mmol, 1.2 eq) were added and the reaction mixture was stirred at room temperature for 18h. The reaction mixture was poured into water (25 mL) and extracted with ethyl acetate (75 mL). The organic phases were dried over anhydrous sodium sulphate and concentrated. The crude material was purified by column chromatography (5 % methanol/dichloromethane) to obtain the title compound as a yellow solid (5 mg, 3.55 %). TLC: neat EtOAc, Rf = 0.5; visualized with UV. HPLC: 93.47% (HPLC RT 5.23 min); 1H NMR (400 MHz, DMSO-d₆): δ: 11.49 (s, 1H), 8.24 (s, 1H), 8.16 (t, 1H), 8.06 (s, 1H), 4.62 (t, 2H), 3.43 (t, 2H), 2.94 (q, 2H), 1.71 (s, 3H), 1.32 (t, 3H); LCMS: (ESI) m/z 362.1 & 364.3 (M& M+2).

N-(2-(7-Chloro-8-ethyl-2,4-dioxo-3,4-dihydrobenzo[g]pteridin-10(2H)-yl)ethyl) benzamide (42b, JG-2051)

To a solution of 10-(2-aminoethyl)-7-chloro-8-ethylbenzo[g]pteridine-2,4(3H,10H)-dione (41, JG-2025) (0.076g, 0.63 mmol, 1 eq) in DMF (2 mL), DIPEA (0.30 mL, 1.88 mmol, 3eq), HATU (0.36g, 0.94 mmol, 1.5eq), and benzoic acid (0.20 g, 0.63 mmol, 1eq) were added. The reaction mixture was stirred at room temperature for 18h. The reaction mixture was poured into water (25 mL) and extracted with ethyl acetate (2 x 25 mL). The combined organic phases were dried over anhydrous sodium sulphate and concentrated under vacuum. The crude material was purified by column chromatography (100 % ethyl acetate) to obtain the title compound as a yellow solid (0.030g, 11.2 %). TLC: neat EtOAc, Rf = 0.6; visualized with UV. HPLC: 97.91% (HPLC RT 6.23 min); 1H NMR (400 MHz, DMSO-d₆): δ: 11.53 (s, 1H), 8.65 (t, 1H), 8.22 (s, 1H), 8.01 (s, 1H), 7.61 (d, J = 7.2Hz, 2H), 7.51-7.37 (m, 3H), 4.79 (t, 2H), 3.79-3.72 (m, 2H), 2.76 (q, 2H), 1.14 (t, 3H); LCMS (ESI) m/z 424.6 & 426.6(M & M+2);

N-(2-(7-Chloro-8-ethyl-2,4-dioxo-3,4-dihydrobenzo[g]pteridin-10(2H)-yl)ethyl)isobutyramide (42c, JG-2053)

Using the above protocol (42b), we synthesized the derivative (42c) by reacting isobutyric acid with 41 followed by purification producing a yellow solid (yield 20 mg, 16 %); TLC: neat EtOAc, Rf = 0.6; visualized with UV. HPLC: 96.48% (HPLC RT 5.61 min) and confirmed by recording ¹H NMR (400 MHz, DMSO-d₆): δ: 11.50 (s, 1H), 8.24 (s, 1H), 8.03 (s, 1H), 7.97 (t, 1H), 4.67 (t, 2H), 3.55 (m, 2H), 2.94 (q, J = 7.6Hz, 2H), 2.14(hept, 1H), 1.34 (t, J = 7.2Hz, 3H), 0.81 (d, J = 6.8Hz, 6H); LCMS (ESI) m/z 390.7 & 392.7(M & M+2).

Synthesis of sulfonamide side chain derivatives 43a-g using 41

N-(2-(7-Chloro-8-ethyl-2,4-dioxo-3,4-dihydrobenzo[g]pteridin-10(2H)-yl)ethyl) benzene sulfonamide (43a, JG-2057)

To a solution of 10-(2-aminoethyl)-7-chloro-8-ethylbenzo[g]pteridine-2,4(3H,10H)-dione (41, JG-2025) (0.100 g, 0.313 mmol, 1 eq) in DMF (2 mL), potassium carbonate (0.13 g, 0.939 mmol, 3 eq), and benzenesulfonyl chloride (0.083 g, 0.188 mmol, 1.2 eq) were added and stirred for 18h at room temperature. The reaction mixture was poured into water (50 mL) and extracted with ethyl acetate (2 x 25 mL). The combined organic phases were dried over anhydrous sodium sulphate and concentrated under vacuum. The crude material was purified by column chromatography (100 % ethyl acetate) as a yellow solid (0.012 g, 8.35 %). TLC: neat EtOAc, Rf = 0.4; visualized with UV. HPLC: 95.65% (HPLC RT 6.42 min) ¹H NMR (400 MHz, DMSO-d₆): δ: 11.50 (s, 1H), 8.22 (s, 1H), 7.97 (t, 1H), 7.91 (s, 1H), 7.72 (d, J = 7.6Hz, 2H), 7.62-7.51(m, 3H), 4.66 (t, 2H), 3.23-21 (m, 2H), 2.93 (q, 2H), 1.32 (t, 3H); LCMS: m/z 460.78 (M+1).

The following compounds, 43b-d, were made according to the procedure described for 43a (JG-2057) using 41 (JG-2025) and respective sulfonyl chlorides.

N-(2-(7-Chloro-8-ethyl-2,4-dioxo-3,4-dihydrobenzo[g]pteridin-10(2H)-yl)ethyl)-4-(trifluoromethyl)benzenesulfonamide (43b, JG-2062)

Yellow solid (yield 6 mg, 5%); TLC: 10% MeOH in DCM, Rf = 0. 4; visualized with UV. HPLC: 97% (HPLC RT 7.46 min); ¹H NMR (400 MHz, DMSO-d₆): δ: 11.51 (s, 1H),8.20(bs, 1H), 8.18 (s, 1H), 7.95-7.89 (m, 5H), 4.66 (t, 2H), 3.29 (t, 2H), 2.90 (q, J = 7.2Hz, 2H), 1.30 (t, J = 7.6Hz, 3H); LCMS: (ESI) m/z 428.2 & 430.1 (M & M+2).

N-(2-(7-Chloro-8-ethyl-2,4-dioxo-3,4-dihydrobenzo[g]pteridin-10(2H)-yl)ethyl)-3-fluorobenzenesulfonamide (43c, JG-2063)

Yellow solid (yield 7 mg, 7%); TLC: 10% MeOH in DCM, Rf = 0. 4; visualized with UV. HPLC: 95.17% (HPLC RT 6.81 min); ¹H NMR (400 MHz, DMSO-d₆): δ: 11.50 (s, 1H),8.20 (s, 1H), 8.10 (bs, 1H), 7.90 (s, 1H), 7.58-7.44(m, 4H), 4.66 (t, 2H), 3.27 (t, 2H), 2.92 (q, J = 7.6Hz, 2H), 1.31 (t, J = 7.6Hz, 3H); LCMS: (ESI) m/z 478.1 & 480.1 (M & M+2).

N-(2-(7-Chloro-8-ethyl-2,4-dioxo-3,4-dihydrobenzo[g]pteridin-10(2H)-yl)ethyl)pyridine-3-sulfonamide (43d, JG-2064)

Yellow solid (yield 10 mg, 7%); TLC: neat EtOAc, Rf = 0.6; visualized with UV. HPLC: 93.31% (HPLC RT 5.81 min); ¹H NMR (400 MHz, DMSO-d₆): δ: 11.50 (s, 1H), 8.86(s, 1H), 8.77 (d, J =3.6Hz, 1H), 8.30 (bs, 1H), 8.21(s, 1H), 8.13-8.11(m, 1H), 7.96(s, 1H), 7.58-7.54(m, 1H), 4.66 (t, 2H), 3.52-3.40 (m, 2H), 2.92 (q, J = 7.2Hz, 2H), 1.31 (t, J = 7.2Hz, 3H); LCMS: (ESI) m/z 461.1 & 463.2 (M & M+2).

N-(2-(7-Chloro-8-ethyl-2,4-dioxo-3,4-dihydrobenzo[g]pteridin-10(2H)-yl)ethyl)-2-methyl propane-1-sulfonamide (43e, JG-2061)

To a solution of 10-(2-aminoethyl)-7-chloro-8-ethylbenzo[g]pteridine-2,4(3H,10H)-dione (41, JG-2025) (0.050g, 0.156 mmol, 1 eq) in DMF (3 mL), triethylamine (0.06 mL, 0.468 mmol, 3eq) and isobutylsulfonyl chloride (0.025g, 0.156 mmol, 1eq) were added, and the reaction mixture was stirred at room temperature for 18h. The reaction mixture was poured into water (50 mL) and extracted with ethyl acetate (2 x 25 mL). The combined organic phases were dried over anhydrous sodium sulphate and concentrated under vacuum. The crude material was purified by column chromatography (100 % ethyl acetate) to obtain the title compound as a yellow solid (0.012 g, 8.35 %). TLC: neat EtOAc, Rf = 0.5; visualized with UV. HPLC: 95.54% (HPLC RT 6.64 min); ¹H NMR (400 MHz, DMSO-d₆): δ: 11.50 (s, 1H), 8.24 (s, 1H), 7.97 (s, 1H), 4.68 (t, 2H), 3.39 (t, 2H), 2.95-2.90 (m, 4H), 2.00 (hept, 1H), 1.32 (t, J = 7.6Hz, 3H), 0.97 (d, J = 6.4Hz, 6H); LCMS: (ESI) m/z 440.3 & 442.3 (M & M+2).

The following compounds, 43f and 43g, were made according to the procedure described for 43e (JG-2061) using 41 (JG-2025) and respective sulfonyl chlorides.

N-(2-(7-Chloro-8-ethyl-2,4-dioxo-3,4-dihydrobenzo[g]pteridin-10(2H)-yl)ethyl)cyclopropane sulfonamide (43f, JG-2060)

Yellow solid (yield 16 mg, 23%); TLC: neat EtOAc, Rf = 0.4; visualized with UV. HPLC: 95.67% (HPLC RT 5.74 min); ¹H NMR (400 MHz, DMSO-d₆): δ: 11.49 (s, 1H), 8.23 (s, 1H), 7.95 (s, 1H), 7.33 (t, 1H), 4.70 (t, 2H), 3.50-3.40 (m, 2H), 2.92 (q, 2H), 2.60-2.40 (m, 1H), 1.30 (t, 3H), 0.91-0.86 (m, 4H); LCMS: m/z 424.0 & 426.0 (M & M+2).

N-(2-(7-Chloro-8-ethyl-2,4-dioxo-3,4-dihydrobenzo[g]pteridin-10(2H)-yl)ethyl)naphthalene-2-sulfonamide (43g, JG-2065)

Yellow solid (yield 18 mg, 22%); TLC: neat EtOAc, Rf = 0.6; visualized with UV. HPLC: 97.71% (HPLC RT 7.1 min); ¹H NMR (400 MHz, DMSO-d₆): δ: 11.47 (s, 1H), 8.34 (s, 1H), 8.06-7.97 (m, 5H) 7.97 (s, 1H), 7.68-7.63(m, 3H), 4.64 (t, 2H), 3.39-3.30 (m, 2H), 2.88 (q, J=7.2Hz, 2H), 1.27 (t, J = 7.2Hz, 3H); LCMS: (ESI) m/z 510.2 & 512.2 (M& M+2).

ABBREVIATIONS

AcOH

acetic acid

ANOVA

analysis of variance

CBP

CREB-binding protein

CETSA

cellular thermal shift assay

CI

confidence interval

C_max

maximum plasma concentration

CoA

co-enzyme A

DIPEA

N,N-Diisopropylethylamine

DTP

Developmental Therapeutics Program

EDC

1-Ethyl-3-(3′-dimethylaminopropyl)carbodiimide

EtOH

ethanol

FMN

flavin mononucleotide

GCN5

General control non-depressible 5

HATU

hexafluorophosphate azabenzotriazole tetramethyl uronium

H4K12

histone H4 lysine 12

HAT1

Histone acetyltransferase 1

HOBT

hydroxybenzotriazole

HRP

horseradish peroxidase

KAT

lysine acetyltransferase

K_D

dissociation constant

LoD

limit of detection

LoQ

limit of quantification

MEGM

mammary epithelial growth media

MeOH

methanol

MW

microwave

MYST2

MOZ, YBF2/SAS3, SAS2 And TIP60 Protein 2

NSC

Cancer Chemotherapy National Service Center

NSG

NOD scid gamma

PCAF

P300/CBP-associated factor

Rbap46

Retinoblastoma binding protein P46

SD

standard deviation

shRNA

short hairpin RNA

SPR

surface plasmon resonance

SW

signal window

TEA

triethylamine