Skip to main content
NCBI home page
Mediators of Inflammation logoLink to Mediators of Inflammation
. 2023 May 31;2023:1097706. doi: 10.1155/2023/1097706

Therapeutic Role and Potential Mechanism of Resveratrol in Atherosclerosis: TLR4/NF-κB/HIF-1α

Lin Guo 1, Xiaolu Zhang 1, Nuan Lv 1, Luming Wang 1, Jiali Gan 1, Xijuan Jiang 1,✉, Yijing Wang 2,✉
PMCID: PMC10247328  PMID: 37292256

Abstract

Atherosclerosis, the main pathological basis of cardiovascular disease, is a chronic inflammatory disease that severely affects the quality of human life. Resveratrol (Res) is a natural polyphenol that is a major component of many herbs and foods. The present study analyzed resveratrol from the perspective of visualization and bibliometric analysis and found that resveratrol is closely related to the inflammatory response in cardiovascular diseases (associated with atherosclerosis). To explore the specific molecular mechanism of resveratrol, network pharmacology and Kyoto Encyclopedia of Genes and Genomes (KEGG) were used, in which HIF-1α signaling may be a key pathway in the treatment of AS. Furthermore, we induced the polarization of macrophage RAW264.7 to M1 type to generate inflammatory response by the combination of lipopolysaccharide (LPS) (200 ng/mL) + interferon-γ (IFN-γ) (2.5 ng/mL). LPS and IFN-γ increased the inflammatory factor levels of IL-1β, TNF-α, and IL-6 in RAW264.7, and the proportion of M1-type macrophages also increased, but the expression of inflammatory factors decreased after resveratrol administration, which confirmed the anti-inflammatory effect of resveratrol in AS. In addition, we found that resveratrol downregulated the protein expression of toll-like receptor 4 (TLR4)/NF-κB/hypoxia inducible factor-1 alpha (HIF-1α). In conclusion, resveratrol has a significant anti-inflammatory effect, alleviates HIF-1α-mediated angiogenesis, and prevents the progression of AS through the TLR4/NF-κB signaling pathway.

1. Introduction

Atherosclerosis is the primary pathological basis of cardiovascular disease (CVD) which is a key cause of mortality worldwide [1]. It is now well established that atherosclerosis is a chronic inflammatory disease with immune cells infiltrated [2, 3]. Furthermore, analyzing AS from a pathophysiological perspective, the progression of AS involves endothelial damage, abnormal lipid metabolism, and hemodynamic changes, and immunoreactive substances can be detected at each stage, demonstrating that AS is a chronic vascular inflammatory disease mediated by multiple risk factors [1, 4]. Macrophages are the sentinels of mammalian tissue homeostasis, intrinsic, and adaptive immunity [5, 6]. When endothelial cell (EC) is activated, a variety of inflammatory factors are expressed, such as interleukin (IL)-8, intercellular adhesion molecule-1 (ICAM-1), and vascular adhesion molecule-1 (VCAM-1), and, influenced by their microenvironment, monocyte precursors are generated. This is followed by differentiation into macrophages, in addition to accumulated lipoproteins or inflammatory factors. The initial motivation of macrophages may beneficial, but the conversion of phagocytosed oxidized low-density lipoprotein (ox-LDL) into foam cells eventually leads to a massive accumulation of foam cells, promoting plaque formation and exacerbating AS. Macrophages are highly plastic, and the combination of lipopolysaccharide (LPS), interferon-γ (IFN-γ), and stimulation with interleukin (IL)-4 is the most commonly used activation methods to induce macrophage polarization towards the M1 type [7]. Resveratrol is a natural polyphenol expressed within a wide range of plants and is found in 72 species of plants including mulberries and grapes [7, 8]. Resveratrol was first noticed in 1992 for the protective effects of red wine on the heart [9]. Since then, research on resveratrol has intensified, with numerous studies confirming the benefits of resveratrol on chronic diseases, including CVD, diabetes, Alzheimer's disease, and various cancers [10]. And resveratrol has diverse biological activities, including antioxidant, anti-inflammatory, antiproliferative, antiaging, and vascular modulating properties [11] (molecular formula of resveratrol Figure 1).

Figure 1.

Figure 1

Open in a new tab

Chemical structure of resveratrol (PubChem CID: 445154).

Bibliometrics is an effective subject evaluation method based on quantitative analysis and citation analysis of article topics, showing the overall development of a subject and the internal connections between related subjects [12]. Network pharmacology is a systematic and comprehensive study of the mechanisms of drugs which can assess pharmacological effects from biological aspect. Based on a network of drug-disease mechanism analysis, the relevant mechanisms for multitargeted drug treatment of diseases can be obtained [13].

In this study, the bibliometric method and network pharmacology were used to analyze the resveratrol, and the cluster and therapeutic target genes of resveratrol on AS were systematically analyzed. The results suggested that resveratrol exerted its anti-AS mechanism by inhibiting the inflammatory response. Furthermore, lipopolysaccharide- (LPS-) induced RAW264.7 model was constructed for validation. The specific process is shown in Figure 2.

Figure 2.

Figure 2

Open in a new tab

The flow chart of resveratrol in atherosclerosis.

2. Material and Methods

2.1. Material

RAW264.7 (ATCC number: TIB-71) were purchased from Hunan Fenghui Biotechnology Co., Ltd. Resveratrol (SR8070) and LPS (L8880) were purchased from Solarbio Technology Co., Ltd. (Beijing, China). CoCl2 was purchased from Sigma Company. IFN-γ (315-05) was purchased from PeproTech Company in the United States. ELISA kits of TNF-α, IL-1β, and IL-6 (SEA133Mu, SEA563Mu, and SEA079Mu) were purchased from Wuhan Cloud-Clone Company. Primer was purchased from Shengong Biotechnology Co., Ltd. (Shanghai, China). The LDH kit (A020-2-2) was purchased from Nanjing Jiancheng Biotechnology Co., Ltd. FITC-CD11c and PE-CD206 (11-0114-82, 12-2061-82) antibody were purchased from Thermo Fisher Scientific Co., Ltd. The antibody of TLR4, HIF-1α, and P-NF-κB p65 (ab13556, ab239366, and ab32536) was purchased from Abcam in the UK.

2.2. Data and Methods for Bibliometrics

“Resveratrol AND Disease” and “Resveratrol AND Atherosclerosis”, all as the topic, were searched in the Web of Science core collection database until November 1, 2022, and the timespan was 1985-2022. The main data extracted included keywords, literature titles, and references. And data was analyzed using VOS viewer [14].

2.3. Gene Dataset Acquisition of Resveratrol and Atherosclerosis

Genes of resveratrol were gathered from the databases: Swiss Target Prediction Database (http://www.swisstargetprediction.ch) and the Similarity Ensemble Approach (SEA) Database (https://sea.bkslab.org/). With “Atherosclerosis” as the keyword, genes of atherosclerosis were gathered from the databases: the Online Mendelian Inheritance in Man (OMIM, http://www.omim.org/), GeneCards (https://www.genecards.org/), and DrugBank Database (https://go.drugbank.com), and just “Homo sapiens” proteins linked to atherosclerosis were selected.

2.4. KEGG Pathway Analysis

DAVID Bioinformatics Resources (https://david.ncifcrf.gov) is an integrated biological knowledge base containing large volumes of genes and proteins and extracting meaningful biological information that can be analyzed online, including Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis. The effective target proteins of resveratrol and AS were imported into the DAVID database for KEGG pathway enrichment analysis, and “Homo sapiens” was used as the selected target to obtain the effective functions and important pathways of resveratrol for the treatment of AS.

2.5. Cell Culture and Treatments

The RAW264.7 cell line (ATCC No. TIB-71) in this study was provided by Fenghui Biotechnology (Hunan Province, China). Resveratrol (Res) was purchased from Beijing Solarbio Technology (Lot SR8070). The cells were cultured in DMEM high sugar medium (Gibco, Lot C11995500BT) containing 10% fetal bovine serum (FBS, BI Biotechnology, Lot 04-001-1ACS) and 1% mixture of penicillin and streptomycin, placed in a cell culture incubator at 37°C with 5% CO2, and regularly changed and passaged, and logarithmic growth phase cells were taken for experiments. The control group, model group, Res high-dose group (10 μmol/L), Res medium-dose group (5 μmol/L), and Res low-dose group (1 μmol/L) were set up (the dose concentrations were obtained by reference to the literature) [15]. The protective effect of resveratrol on the inflammatory response was investigated through the combination of LPS (200 ng/mL, China Solarbio Technology, Lot. L8880) + IFN-γ (2.5 ng/mL, PeproTech, USA, Lot. 315-05) to induce macrophages for 12 h to build the inflammation model and to verify whether resveratrol (10 μmol/L) acts through HIF-1α to attenuate the inflammatory response using the HIF-1α agonist CoCl2 (100 μmol/L, Sigma).

2.6. CCK-8 Assay for Macrophage Viability

RAW264.7 cells were inoculated in 96-well plates at a density of 1.5 × 105 cells/mL in a well volume of 100 μL. After 24 h incubation, the supernatant was discarded and 12 h synchronized. After 2 h of administration according to the above experimental groups, LPS + IFN-γ was added to induce inflammation. After further 12 h incubation, 10 μL of CCK8 solution was added to each well, and the OD value at 450 nm was measured. The calculation formula is as follows: cell survival rate = [(As − Ab)/(Ac − Ab)] × 100% (As: the experimental group, Ac: control group, Ab: blank group).

2.7. LDH Efflux Assay to Detect Cellular Damage

The procedure was as described in Section 2.6. The LDH level in the cell supernatant was measured according to the instructions of the LDH Assay Kit (Nanjing Jiancheng Biotechnology, Lot: A020-2-2). The calculation formula is as follows: LDH content = (measured well OD − control well OD)/(average standard well OD − average blank well OD) × 200.

2.8. Flow Cytometry Detects M1 Polarization in Macrophages

The procedure was as described in Section 2.6. Digested cells were transferred to 1.5 mL centrifuge tubes, centrifuged and washed in PBS. Cells were washed three times in PBS and then labelled with FITC-CD11c marker, PE-CD206 (11-0114-82, 12-2061-82, Thermo Fisher Scientific Co., Ltd), at 4°C for 30 min. The labelled cells were analyzed using a flow cytometer.

2.9. ELISA Detects Inflammatory Factor Levels

The procedure was as described in Section 2.6. The supernatant was collected, and the levels of cellular inflammatory factors IL-1β, TNF-α, and IL-6 of each group were measured in ELISA kit (Wuhan Cloud-Clone Company, China).

2.10. Detection of NO Content

The procedure was as described in Section 2.6. The supernatant was collected, and the NO content in the supernatant was measured with the NO assay kit, and the OD value was detected at 540 nm.

2.11. Quantitative Real-Time PCR Analysis

RAW264.7 cells were inoculated in 12-well plates at a density of 1.5 × 105 cells/mL in a well volume of 2000 μL. The procedure was as described in Section 2.6. Trizol reagent was added to each well to extract total cellular RNA. cDNA was obtained by inversion and used as a template for real-time PCR analysis (RCP reaction system 20 μL, reaction conditions: predenaturation at 95°C for 10 min, denaturation at 95°C for 15 s, annealing at 60°C for 1 min, 40 cycles). Statistical analysis of the data was performed using the 2−ΔΔCT method, and the internal reference was GAPDH (the primer sequences are shown in Table 1).

Table 1.

Primer sequences for PCR.

Name Sequence (5′ to 3′) Length/bp
IL-1β F ACCCTCACACTCACAAACCA 246
R GGCAGAGAGGAGGTTGACTT
IL-6 F AGACTTCCATCCAGTTGCCT 113
R CAGGTCTGTTGGGAGTGGTA
TNF-α F CCACCACGCTCTTCTGTCTA 118
R TGGTTTGTGAGTGTGAGGGT
TLR4 F AGGCAGCAGGTGGAATTGTA 174
R GGTCCAAGTTGCCGTTTCTT
HIF-1α F AGGTGGAGGAGCTGTTGTAC 184
R CTCTGCTCATCATCCGACCT
Open in a new tab

2.12. Western Blot Analysis

Digest the cells, collect the cell suspension, and transfer to a 1.5 mL centrifuge tube, centrifuge and discard the supernatant. Proteins of cells were extracted using RIPA lysis buffer for 30 minutes. Equal amounts of protein lysates were transferred to PVDF membrane. After blocking with milk for 2 h, antibodies were added to identify protein level, at 4°C overnight. The secondary antibody incubation solution was incubated for 2 h at room temperature in a shaker, then washed 3 times. The PVDF membrane was placed in ECL developing solution.

2.13. Statistical Analysis

Using SPSS 22.0, the data was expressed as means ± SEM, and the differences between groups were compared using one-way ANOVA and graphing with GraphPad 8.0. P < 0.05 was a significant difference, and P < 0.01 is a very significant difference.

3. Results

3.1. Bibliometric Analysis of Resveratrol and Atherosclerosis

“Resveratrol AND Disease” as the topic was for searched 6775 articles, with 50 times as inclusion criteria, and involved 246 topic terms (Figure 3(a)). “Resveratrol AND Atherosclerosis” as the topic was searched for 599 articles, with 20 times as inclusion criteria, and involved 50 topic terms (Figure 3(b)). As shown in Figure 3(a), the red cluster is the first dominant cluster (resveratrol, cardiovascular disease, atherosclerosis, coronary heart disease, heart, heart disease, etc.), highlighting the importance of resveratrol, which can be inferred to be closely related to cardiovascular disease and atherosclerosis. Atherosclerosis is an inflammatory condition in which endothelial injury predisposes to endothelial lipid accumulation and plaque formation [16]. Studies have shown that resveratrol regulated endothelial function in various ways, such as impaired vasorelaxation, leukocyte adhesion, aging, and mesenchymal transition [17]. Besides, resveratrol regulated the atherosclerotic lesion area by regulating blood lipids, including total cholesterol, triglyceride, and low-density lipoprotein [18–20]. Also, it inhibited the expression of matrix metalloproteinase-9, CD40 ligand (CD40L), and inflammatory factors [18]. Similarly, resveratrol regulated lipid metabolism and inhibited inflammation development through the TGF/ERK signaling pathway, playing a beneficial role in AS [21]. As shown in Figure 3(b), the red cluster was the first dominant cluster of resveratrol and atherosclerosis (resveratrol, cardiovascular disease, atherosclerosis, coronary heart disease, and antioxidant) that were associated with resveratrol's role as an antioxidant in AS. The second cluster (macrophage, inflammation, endothelial cells, smooth-muscle-cells, NF-kappa-b, etc.) found that resveratrol on AS was closely related to anti-inflammatory effects, and NF-kappa-b pathway played an important role.

Figure 3.

Figure 3

Open in a new tab

Bibliometric analysis of resveratrol and atherosclerosis: (a) bibliometric analysis of resveratrol and (b) bibliometric analysis of resveratrol and atherosclerosis.

3.2. Potential Target Genes and Network Analysis

Swiss Target retrieved 69 candidate target genes, and SEA Target retrieved 78 candidate target genes, and a total of 98 resveratrol candidate target genes was identified (Supplementary Table 1: The 98 target genes of resveratrol). Based on the Disease Gene database, with 1276 in GeneCards, 100 is in DrugBank, and 215 is in OMIM. A total of 1364 genes associated with AS were identified after remove duplicates (Supplementary Table 2: The 1364 genes associated with AS). Forty genes were identified by matching potential targets of resveratrol and AS (Figure 4(a)). To further analyze the possible pharmacological mechanisms involved in AS and resveratrol, we performed KEGG pathway analysis on the 40 genes and retrieved 43 significant pathways (P < 0.05). Of these, 20 significant pathways were shown in Figure 4(b). The main mechanism of resveratrol in AS was closely related to the anti-inflammatory response, and the HIF-1 pathway was the most significant pathway.

Figure 4.

Figure 4

Open in a new tab

Network pharmacology of resveratrol and atherosclerosis: (a) overlapping genes of resveratrol and atherosclerosis and (b) KEGG pathway analysis on the 40 overlapping genes.

3.3. Experimental Validation

3.3.1. Resveratrol Inhibited the Inflammatory Response in RAW264.7 Cells

Resveratrol can reduce the inflammatory response. When LPS + IFN-γ acted on macrophages, the cells were stimulated to develop an inflammatory response, and the levels of inflammatory factors IL-6, TNF-α, and IL-1β were significantly increased. However, this phenomenon was reversed by the resveratrol, and the best effect was seen in Res high-dose group (10 μmol/L) [15]. The CCK8 and LDH results indicated the viability of the cells and the degree of damage, and the small differences between the components suggested less damage to the cells. LPS + IFN-γ-induced cells elevated NO levels and decreased by resveratrol intervention (Figure 5).

Figure 5.

Figure 5

Open in a new tab

Resveratrol inhibited the inflammatory response in RAW264.7 cells. (a–c) The release of IL-1β, TNF-α, and IL-6 in cell supernatant was measured by ELISA kits. (d–f) The mRNA levels of IL-1β, TNF-α, and IL-6. (g) Cellular viability for RAW264.7 cells. (h) The release of LDH. (i) NO expression. Data were presented as mean ± SD. ∗P < 0.05; ∗∗P < 0.01.

3.3.2. Resveratrol Inhibited Macrophage Polarization towards M1 Type

Resveratrol inhibited M1 polarization of macrophages and CD206 as a marker for the M1 type macrophages. Flow cytometry analysis showed a significantly higher proportion of M1 type macrophages with LPS + IFN-γ-induced and a reversal of the result after resveratrol intervention, in a drug concentration-dependent manner (Figure 6).

Figure 6.

Figure 6

Open in a new tab

Effects of resveratrol on the M1 type macrophage. (a–f) Flow cytometric analysis of M1 macrophages. Data were presented as mean ± SD. ∗P < 0.05; ∗∗P < 0.01.

3.3.3. Resveratrol Inhibited the Expression of TLR4, NF-κB, and HIF-1α

Based on bibliometrics, network pharmacology, and experimental validation, resveratrol was found to reduce the inflammatory response. The mRNA expression of TLR4 and HIF-1α was significantly upregulated in macrophages after LPS + IFN-γ induced, and resveratrol reversed the phenomenon. And protein levels were verified to be consistent, with resveratrol reduced TLR4, p-NF-κB p65, and HIF-1α protein expression (Figure 7).

Figure 7.

Figure 7

Open in a new tab

Resveratrol inhibited the expression of TLR4, NF-κB, and HIF-1α. (a, b) The mRNA levels of TLR4 and HIF-1α. (c–e) The protein levels of TLR4, p-NF-κB p65, and HIF-1α. Data were presented as mean ± SD. ∗P < 0.05; ∗∗P < 0.01.

3.3.4. HIF-1α Is the Key for Resveratrol to Inhibit the M1 Type Macrophage

CoCl2, an agonist of HIF-1α, enhanced the expression of HIF-1α and reversed the effect of resveratrol on macrophages. Flow cytometry verified that CoCl2 induced a significant upregulation of the proportion of M1 macrophages. And resveratrol had a mitigating effect on M1 macrophages, which was led by CoCl2 induced. In addition, NO expression was followed by a similar phenomenon (Figure 8).

Figure 8.

Figure 8

Open in a new tab

Effect of CoCl2 and resveratrol on M1 type macrophages. (a–e) Flow cytometric analysis of M1 macrophages. (f) NO expression. Data were presented as mean ± SD. ∗P < 0.05; ∗∗P < 0.01.

3.3.5. Effect of CoCl2 and Resveratrol on Inflammatory Factors

The expression of HIF-1α led to an increase of inflammatory factors as well. And CoCl2 counteracted the anti-inflammatory effect of resveratrol and suggested that HIF-1α was the key target of resveratrol, which reduced the inflammatory response (Figure 9).

Figure 9.

Figure 9

Open in a new tab

Effect of CoCl2 and resveratrol on inflammatory factors. (a–c) The release of IL-6, TNF-α, and IL-1β in cell supernatant was measured by ELISA kits. (d–f) The mRNA levels of IL-6, TNF-α, and IL-1β. Data were presented as mean ± SD. ∗P < 0.05, ∗∗P < 0.01.

4. Discussion and Conclusion

AS is a serious health problem with high morbidity and high mortality worldwide, and its incidence increases with age [22]. In terms of physiopathology, the pathogenic mechanisms of AS are complex. AS is a lipid-driven arterial disease, but it is always accompanied by chronic nonresolving inflammation [23]. Macrophages play an important role in the inflammatory response and are the key immune cells closely involved in the pathogenesis of AS and are important targets for AS diagnosis and new therapies [24]. Various triggers of AS promote the accumulation of M1 type macrophages in the coronary arteries, which cannot be digested to form foam cells, leading to plaque formation [25, 26]. Therefore, there is an urgent need to find more effective therapeutic strategies to suppress the inflammatory response, gain insight into the pathogenic mechanisms, and curb the progression of AS. Bibliometrics is the analysis of the literature and its measurement characteristics to predict the current trends of a field [27]. In this study, a literature search and analysis were conducted using resveratrol and AS as the subject term and found that resveratrol played an important anti-inflammatory role in AS. Network pharmacology is a new approach to elucidate the mechanisms of drugs in disease [13]. In this study, 98 resveratrol-associated genes and 1364 AS-associated genes and 40 overlapping genes were identified by network pharmacology [13]. To gain a deeper effects of resveratrol on AS, we performed KEGG pathway enrichment and obtained 43 pathways, of which the top 20 pathways were mainly associated with inflammatory responses, and the important one involved was HIF-1 pathway. In addition, our subsequent experiments showed that resveratrol reduced the inflammation in AS by inhibiting HIF-1α, an important target in the HIF-1 pathway, NF-κB, and TLR4.

A growing body of research suggests that resveratrol plays an important role in the treatment of the inflammatory response to AS [20, 28]. In this study, we found that resveratrol and AS targets were closely associated with inflammation and that the HIF-1 pathway played an important role. Resveratrol was showed to exert anti-inflammatory effects in AS by inhibiting bisphenol A (BPA), elevated sirtuin 1, and Nijmegen breakage syndrome 1 (NBS1) expression [29]. And sirtuin 1 inhibited nuclear translocation of NF-κB and reduced hyaluronate synthase 2 expression [30]. Resveratrol can also inhibit the inflammatory response to AS by directly targeting IL-1β [31]. TLR4 is a typical pattern recognition receptor in the intrinsic immune response, which induces the recruitment of leukocytes to smooth muscle cells and the release of inflammatory factors such as IL-6 [32, 33]. However, resveratrol can inhibit the TLR4 pathway. NF-κB is an important nuclear transcription factor in the inflammatory response, mediated the transcription of inflammatory factors, and released large amounts of inflammatory factors, and NF-κB is also influenced by TLR4 [34, 35]. In addition to the primary role of macrophages in the AS inflammatory response, adhesion of monocytes to ECs also produced inflammatory factors [2, 36]. Studies have demonstrated that resveratrol attenuates the TNF-α-induced degradation of IκB-α and nuclear translocation of NF-κB p65 by inflammatory factors and reduces macrophage expression in the aorta [37–40]. Thus, resveratrol's inhibition of TLR4 also affects NF-κB, thereby inhibiting the inflammatory response [41, 42].

HIF-1 was found to be an important pathway by KEGG analysis. During the development of AS, extracellular matrix, lipids, and macrophages generate plaques, indirectly appear hypoxic areas, and activate the HIF-1 pathway and its associated factors. HIF-1 consists of HIF-1β and the oxygen-sensitive HIF-1α, which enter the nucleus to initiate a series of translational expressions in hypoxic plaque tissue and plaques [43]. Although HIF-1α also has some dominant functions, within macrophages, it is mainly involved in inflammatory responses, angiogenesis, and metabolic reprogramming [44]. The expression of HIF-1α also inhibits the expression of the transporter protein ABCA1 and ApoA1, preventing macrophages from removing excess lipids and exacerbating hypoxia and inflammatory responses [45–47].

The two most important factors in AS are dyslipidemia and inflammatory response [48, 49]. Most of the top 20 pathways obtained from the KEGG analysis were closely linked to the inflammatory response, excluding most hormones with inflammatory responses, such as prolactin, which inhibited TLR-4/NF-κB pathway and reduced the expression of inflammatory cytokines [50, 51]. Relaxin downregulated TLR4 expression and increased M2 type macrophages, exerting a protective effect [52]. It is also enriched in lipid and AS-related pathways, and resveratrol has been shown to have pharmacological effects in preventing LDL oxidation in AS [53]. Resveratrol was showed to improve low shear stress and oxidative stress to treat AS [54]. Letter pathways such as lipolysis [55], human cytomegalovirus infection [56], diabetic complication-related pathways [57, 58], and C-type lectin receptor signaling pathway are all closely related to the inflammatory response [59]. In response to the aforementioned pathways, resveratrol inhibited adipogenesis in mice on a high-fat diet, promoting lipolysis in adipose tissue [60, 61], and inhibited viral induced activation of epidermal growth factor receptor (EGFR), significantly reducing human cytomegalovirus DNA replication [62, 63]. Additionally, a large number of studies confirmed that resveratrol can reduce insulin resistance and played a beneficial role in chronic inflammation in diabetic patients [64, 65]. In THP-1 cells and RAW264.7 cells, resveratrol inhibited bacterial phagocytosis by macrophages by downregulating the expression of C-type lectin receptor [66]. The HIF-1 pathway was screened as a major pathway, and although, it was well studied in terms of inflammatory responses [67, 68]. It has proved that resveratrol and omega-3 can significantly improve the histopathological damage of atherosclerosis in vivo [69], but studies of resveratrol's anti-inflammatory effects via the HIF-1 pathway are extremely rare and even less in AS. Therefore, our results showed that resveratrol inhibited the inflammatory response by modulating the TLR4/NF-κB/HIF-1α pathway, suggesting that resveratrol exerted a protective effect against AS through its anti-inflammatory effects.

In summary, resveratrol is a drug with multitarget and multipathway and especially plays an important anti-inflammatory role in the inflammatory response, and it is expected to be a therapeutic or preventive drug for AS. Bibliometric study and network pharmacology of resveratrol revealed that the key pathway through anti-inflammatory was closely related to the TLR4/NF-κB/HIF-1α pathway. Further validation of other pathways is an important way to explore the mechanisms associated with resveratrol.

Acknowledgments

This study was supported by the National Natural Science Foundation of China (no. 82074211), the Natural Science Foundation of Tianjin City, China (no. 21JCQNJC01170), and the 2020 Annual Graduate Students Innovation Fund (School of Integrative Medicine, Tianjin University of Traditional Chinese Medicine, Tianjin, China (no. ZXYCXLX202014)).

Contributor Information

Xijuan Jiang, Email: jxj2668@tjutcm.edu.cn.

Yijing Wang, Email: wangyj1986@tjutcm.edu.cn.

Data Availability

All data generated or analyzed during this study are included in this published article.

Conflicts of Interest

The authors declare that the paper was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Authors' Contributions

Lin Guo and Xiaolu Zhang drafted the manuscript. Xijuan Jiang and Yijing Wang designed and supervise the manuscript. Nuan Lv verified the contents and revised the manuscript. Luming Wang and Jiali Gan critically revised the manuscript. All authors reviewed and approved the final manuscript. Lin Guo and Xiaolu Zhang contributed equally to this work and are considered co-first authors.

Supplementary Materials

Supplementary Materials

The supplementary material for this article can be found. Supplementary Table 1: the identified 98 potential targets of resveratrol. Supplementary Table 2: the identified 1364 genes relevant to atherosclerosis.

Click here for additional data file. (61.2KB, zip)

References

  • 1.Wolf D., Ley K. Immunity and inflammation in atherosclerosis. Circulation Research . 2019;124(2):315–327. doi: 10.1161/CIRCRESAHA.118.313591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Jia M., Li Q., Guo J., et al. Deletion of BACH1 attenuates atherosclerosis by reducing endothelial inflammation. Circulation Research . 2022;130(7):1038–1055. doi: 10.1161/CIRCRESAHA.121.319540. [DOI] [PubMed] [Google Scholar]
  • 3.Bouchareychas L., Duong P., Covarrubias S., et al. Macrophage exosomes resolve atherosclerosis by regulating hematopoiesis and inflammation via microRNA cargo. Cell Reports . 2020;32(2, article 107881) doi: 10.1016/j.celrep.2020.107881. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Pedro-Botet J., Climent E., Benaiges D. Atherosclerosis and inflammation. New therapeutic approaches. Medicina Clínica . 2020;155(6):256–262. doi: 10.1016/j.medcli.2020.04.024. [DOI] [PubMed] [Google Scholar]
  • 5.Tabas I., Bornfeldt K. E. Intracellular and intercellular aspects of macrophage immunometabolism in atherosclerosis. Circulation Research . 2020;126(9):1209–1227. doi: 10.1161/CIRCRESAHA.119.315939. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Zhu Y., Xian X., Wang Z., et al. Research progress on the relationship between atherosclerosis and inflammation. Biomolecules . 2018;8(3):p. 80. doi: 10.3390/biom8030080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Meng T., Xiao D., Muhammed A., Deng J., Chen L., He J. Anti-inflammatory action and mechanisms of resveratrol. Molecules . 2021;26(1):p. 229. doi: 10.3390/molecules26010229. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Malaguarnera L. Influence of resveratrol on the immune response. Nutrients . 2019;11(5):p. 946. doi: 10.3390/nu11050946. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Renaud S., de Lorgeril M. Wine, alcohol, platelets, and the French paradox for coronary heart disease. Lancet . 1992;339(8808):1523–1526. doi: 10.1016/0140-6736(92)91277-f. [DOI] [PubMed] [Google Scholar]
  • 10.Cheng C. K., Luo J. Y., Lau C. W., Chen Z. Y., Tian X. Y., Huang Y. Pharmacological basis and new insights of resveratrol action in the cardiovascular system. British Journal of Pharmacology . 2020;177(6):1258–1277. doi: 10.1111/bph.14801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Zhang L. X., Li C. X., Kakar M. U., et al. Resveratrol (RV): a pharmacological review and call for further research. Biomedicine & Pharmacotherapy . 2021;143, article 112164 doi: 10.1016/j.biopha.2021.112164. [DOI] [PubMed] [Google Scholar]
  • 12.Brandt J. S., Hadaya O., Schuster M., Rosen T., Sauer M. V., Ananth C. V. A bibliometric analysis of top-cited journal articles in obstetrics and gynecology. JAMA Network Open . 2019;2(12, article e1918007) doi: 10.1001/jamanetworkopen.2019.18007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Wang S., Ma J., Zeng Y., et al. Icariin, an up-and-coming bioactive compound against neurological diseases: network pharmacology-based study and literature review. Drug Design, Development and Therapy . 2021;15(15):3619–3641. doi: 10.2147/DDDT.S310686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.van Eck N. J., Waltman L. Software survey: VOSviewer, a computer program for bibliometric mapping. Scientometrics . 2010;84(2):523–538. doi: 10.1007/s11192-009-0146-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Song F., Zhang Y., Pan Z., Zhang Q., Lu X., Huang P. Resveratrol inhibits the migration, invasion and epithelial-mesenchymal transition in liver cancer cells through up-regulating miR-186-5p expression. Zhejiang Da Xue Xue Bao Yi Xue Ban . 2021;50(5):582–590. doi: 10.3724/zdxbyxb-2021-0197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Richards G. A., Theron A., Tintinger G., Anderson R. The effects of dabigatran and rivaroxaban on markers of polymorphonuclear leukocyte activation. Pharmaceuticals . 2018;11(2):p. 46. doi: 10.3390/ph11020046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Parsamanesh N., Asghari A., Sardari S., et al. Resveratrol and endothelial function: a literature review. Pharmacological Research . 2021;170, article 105725 doi: 10.1016/j.phrs.2021.105725. [DOI] [PubMed] [Google Scholar]
  • 18.Ji W., Sun J., Hu Z., Sun B. Resveratrol protects against atherosclerosis by downregulating the PI3K/AKT/mTOR signaling pathway in atherosclerosis model mice. Experimental and Therapeutic Medicine . 2022;23(6):p. 414. doi: 10.3892/etm.2022.11341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Ma Y., Li D., Liu W., et al. Resveratrol on the metabolic reprogramming in liver: implications for advanced atherosclerosis. Frontiers in Pharmacology . 2021;12(12, article 747625) doi: 10.3389/fphar.2021.747625. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Santana T. M., Ogawa L. Y., Rogero M. M., Barroso L. P., Alves de Castro I. Effect of resveratrol supplementation on biomarkers associated with atherosclerosis in humans. Complementary Therapies in Clinical Practice . 2022;46, article 101491 doi: 10.1016/j.ctcp.2021.101491. [DOI] [PubMed] [Google Scholar]
  • 21.Guo S., Zhou Y., Xie X. Resveratrol inhibiting TGF/ERK signaling pathway can improve atherosclerosis: backgrounds, mechanisms and effects. Biomedicine & Pharmacotherapy . 2022;155, article 113775 doi: 10.1016/j.biopha.2022.113775. [DOI] [PubMed] [Google Scholar]
  • 22.Libby P. The changing landscape of atherosclerosis. Nature . 2021;592(7855):524–533. doi: 10.1038/s41586-021-03392-8. [DOI] [PubMed] [Google Scholar]
  • 23.Bhattacharya P., Kanagasooriyan R., Subramanian M. Tackling inflammation in atherosclerosis: are we there yet and what lies beyond? Current Opinion in Pharmacology . 2022;66, article 102283 doi: 10.1016/j.coph.2022.102283. [DOI] [PubMed] [Google Scholar]
  • 24.Chen W., Schilperoort M., Cao Y., Shi J., Tabas I., Tao W. Macrophage-targeted nanomedicine for the diagnosis and treatment of atherosclerosis. Nature Reviews Cardiology . 2022;19(4):228–249. doi: 10.1038/s41569-021-00629-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Eshghjoo S., Kim D. M., Jayaraman A., Sun Y., Alaniz R. C. Macrophage polarization in atherosclerosis. Genes . 2022;13(5):p. 756. doi: 10.3390/genes13050756. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Wang Y., Shi R., Zhai R., et al. Matrix stiffness regulates macrophage polarization in atherosclerosis. Pharmacological Research . 2022;179, article 106236 doi: 10.1016/j.phrs.2022.106236. [DOI] [PubMed] [Google Scholar]
  • 27.Zhang S., Zhao D., Jia W., et al. A bibliometric analysis and review of recent researches on TRPM7. Channels . 2020;14(1):203–215. doi: 10.1080/19336950.2020.1788355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Peñalver P., Zodio S., Lucas R., de-Paz M. V., Morales J. C. Neuroprotective and anti-inflammatory effects of pterostilbene metabolites in human neuroblastoma SH-SY5Y and RAW 264.7 macrophage cells. Journal of Agricultural and Food Chemistry . 2020;68(6):1609–1620. doi: 10.1021/acs.jafc.9b07147. [DOI] [PubMed] [Google Scholar]
  • 29.Yang Y., Liu C., Yang J., et al. Impairment of sirtuin 1-mediated DNA repair is involved in bisphenol A-induced aggravation of macrophage inflammation and atherosclerosis. Chemosphere . 2021;265, article 128997 doi: 10.1016/j.chemosphere.2020.128997. [DOI] [PubMed] [Google Scholar]
  • 30.Caon I., Bartolini B., Moretto P., et al. Sirtuin 1 reduces hyaluronan synthase 2 expression by inhibiting nuclear translocation of NF-κB and expression of the long-noncoding RNA HAS2-AS1. Journal of Biological Chemistry . 2020;295(11):3485–3496. doi: 10.1074/jbc.RA119.011982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Vahdat-Lasemi F., Aghaee-Bakhtiari S. H., Tasbandi A., Jaafari M. R., Sahebkar A. Targeting interleukin-β by plant-derived natural products: implications for the treatment of atherosclerotic cardiovascular disease. Phytotherapy Research . 2021;35(10):5596–5622. doi: 10.1002/ptr.7194. [DOI] [PubMed] [Google Scholar]
  • 32.Fu Y. J., Xu B., Huang S. W., et al. Baicalin prevents LPS-induced activation of TLR4/NF-κB p65 pathway and inflammation in mice via inhibiting the expression of CD14. Acta Pharmacologica Sinica . 2021;42(1):88–96. doi: 10.1038/s41401-020-0411-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Ciesielska A., Matyjek M., Kwiatkowska K. TLR4 and CD14 trafficking and its influence on LPS-induced pro-inflammatory signaling. Cellular and Molecular Life Sciences . 2021;78(4):1233–1261. doi: 10.1007/s00018-020-03656-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Ju M., Liu B., He H., et al. microRNA-27a alleviates LPS-induced acute lung injury in mice via inhibiting inflammation and apoptosis through modulating TLR4/MyD88/NF-κB pathway. Cell Cycle . 2018;17(16):2001–2018. doi: 10.1080/15384101.2018.1509635. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Zusso M., Lunardi V., Franceschini D., et al. Ciprofloxacin and levofloxacin attenuate microglia inflammatory response via TLR4/NF-kB pathway. Journal of Neuroinflammation . 2019;16(1):p. 148. doi: 10.1186/s12974-019-1538-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Shao Y., Saredy J., Yang W. Y., et al. Vascular endothelial cells and innate immunity. Arteriosclerosis, Thrombosis, and Vascular Biology . 2020;40(6):e138–e152. doi: 10.1161/ATVBAHA.120.314330. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Repossi G., Das U. N., Eynard A. R. Molecular basis of the beneficial actions of resveratrol. Archives of Medical Research . 2020;51(2):105–114. doi: 10.1016/j.arcmed.2020.01.010. [DOI] [PubMed] [Google Scholar]
  • 38.Furat Rencber S., Kurnaz Ozbek S., Eraldemır C., et al. Effect of resveratrol and metformin on ovarian reserve and ultrastructure in PCOS: an experimental study. Journal of Ovarian Research . 2018;11(1):p. 55. doi: 10.1186/s13048-018-0427-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Shang X., Lin K., Yu R., et al. Resveratrol protects the myocardium in sepsis by activating the phosphatidylinositol 3-kinases (PI3K)/AKT/mammalian target of rapamycin (mTOR) pathway and inhibiting the nuclear factor-κB (NF-κB) signaling pathway. Medical Science Monitor . 2019;25(25):9290–9298. doi: 10.12659/MSM.918369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Song X., Liu L., Peng S., et al. Resveratrol regulates intestinal barrier function in cyclophosphamide-induced immunosuppressed mice. Journal of the Science of Food and Agriculture . 2022;102(3):1205–1215. doi: 10.1002/jsfa.11458. [DOI] [PubMed] [Google Scholar]
  • 41.Xu X., Liu X., Yang Y., et al. Resveratrol exerts anti-osteoarthritic effect by inhibiting TLR4/NF-κB signaling pathway via the TLR4/Akt/FoxO1 Axis in IL-1β-stimulated SW1353 cells. Drug Design, Development and Therapy . 2020;14(14):2079–2090. doi: 10.2147/DDDT.S244059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Rahimifard M., Maqbool F., Moeini-Nodeh S., et al. Targeting the TLR4 signaling pathway by polyphenols: a novel therapeutic strategy for neuroinflammation. Ageing Research Reviews . 2017;36:11–19. doi: 10.1016/j.arr.2017.02.004. [DOI] [PubMed] [Google Scholar]
  • 43.Knutson A. K., Williams A. L., Boisvert W. A., Shohet R. V. HIF in the heart: development, metabolism, ischemia, and atherosclerosis. The Journal of Clinical Investigation . 2021;131(17, article e137557) doi: 10.1172/JCI137557. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Thomas C., Leleu D., Masson D. Cholesterol and HIF-1α: dangerous liaisons in atherosclerosis. Frontiers in Immunology . 2022;13(13, article 868958) doi: 10.3389/fimmu.2022.868958. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Jain T., Nikolopoulou E. A., Xu Q., Qu A. Hypoxia inducible factor as a therapeutic target for atherosclerosis. Pharmacology & Therapeutics . 2018;183:22–33. doi: 10.1016/j.pharmthera.2017.09.003. [DOI] [PubMed] [Google Scholar]
  • 46.Libby P., Buring J. E., Badimon L., et al. Atherosclerosis. Nature Reviews Disease Primers . 2019;5(1):p. 56. doi: 10.1038/s41572-019-0106-z. [DOI] [PubMed] [Google Scholar]
  • 47.Bogomolova A. M., Shavva V. S., Nikitin A. A., et al. Hypoxia as a factor involved in the regulation of the apoA-1, ABCA1, and complement C3 gene expression in human macrophages. Biochemistry . 2019;84(5):529–539. doi: 10.1134/S0006297919050079. [DOI] [PubMed] [Google Scholar]
  • 48.Ruparelia N., Choudhury R. Inflammation and atherosclerosis: what is on the horizon? Heart . 2020;106(1):80–85. doi: 10.1136/heartjnl-2018-314230. [DOI] [PubMed] [Google Scholar]
  • 49.Poznyak A., Grechko A. V., Poggio P., Myasoedova V. A., Alfieri V., Orekhov A. N. The diabetes mellitus-atherosclerosis connection: the role of lipid and glucose metabolism and chronic inflammation. International Journal of Molecular Sciences . 2020;21(5):p. 1835. doi: 10.3390/ijms21051835. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Olmos-Ortiz A., Déciga-García M., Preciado-Martínez E., et al. Prolactin decreases LPS-induced inflammatory cytokines by inhibiting TLR-4/NFκB signaling in the human placenta. Molecular Human Reproduction . 2019;25(10):660–667. doi: 10.1093/molehr/gaz038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Reuwer A. Q., van Eijk M., Houttuijn-Bloemendaal F. M., et al. The prolactin receptor is expressed in macrophages within human carotid atherosclerotic plaques: a role for prolactin in atherogenesis? The Journal of Endocrinology . 2011;208(2):107–117. doi: 10.1677/JOE-10-0076. [DOI] [PubMed] [Google Scholar]
  • 52.Zhang S., Li L., Chen W., Xu S., Feng X., Zhang L. Natural products: the role and mechanism in low-density lipoprotein oxidation and atherosclerosis. Phytotherapy Research . 2021;35(6):2945–2967. doi: 10.1002/ptr.7002. [DOI] [PubMed] [Google Scholar]
  • 53.Zhang M., Xue Y., Chen H., et al. Resveratrol inhibits MMP3 and MMP9 expression and secretion by suppressing TLR4/NF- κ B/STAT3 activation in Ox-LDL-treated HUVECs. Oxidative Medicine and Cellular Longevity . 2019;2019(2019):15. doi: 10.1155/2019/9013169.9013169 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Wang Z., Zhang J., Li B., et al. Resveratrol ameliorates low shear stress-induced oxidative stress by suppressing ERK/eNOS-Thr495 in endothelial cells. Molecular Medicine Reports . 2014;10(4):1964–1972. doi: 10.3892/mmr.2014.2390. [DOI] [PubMed] [Google Scholar]
  • 55.Senga S., Kobayashi N., Kawaguchi K., Ando A., Fujii H. Fatty acid-binding protein 5 (FABP5) promotes lipolysis of lipid droplets, de novo fatty acid (FA) synthesis and activation of nuclear factor-kappa B (NF- κB) signaling in cancer cells. Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids . 2018;1863(9):1057–1067. doi: 10.1016/j.bbalip.2018.06.010. [DOI] [PubMed] [Google Scholar]
  • 56.Gugliesi F., Pasquero S., Griffante G., et al. Human cytomegalovirus and autoimmune diseases: where are we? Viruses . 2021;13(2):p. 260. doi: 10.3390/v13020260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Jahan H., Choudhary M. I. Gliclazide alters macrophages polarization state in diabetic atherosclerosis in vitro via blocking AGE-RAGE/TLR4-reactive oxygen species-activated NF-k β nexus. European Journal of Pharmacology . 2021;894, article 173874 doi: 10.1016/j.ejphar.2021.173874. [DOI] [PubMed] [Google Scholar]
  • 58.Chen J., Peng H., Chen C., et al. NAG-1/GDF15 inhibits diabetic nephropathy via inhibiting AGE/RAGE-mediated inflammation signaling pathways in C57BL/6 mice and HK-2 cells. Life Sciences . 2022;311(Part A, article 121142) doi: 10.1016/j.lfs.2022.121142. [DOI] [PubMed] [Google Scholar]
  • 59.Brown G. D., Willment J. A., Whitehead L. C-type lectins in immunity and homeostasis. Nature Reviews. Immunology . 2018;18(6):374–389. doi: 10.1038/s41577-018-0004-8. [DOI] [PubMed] [Google Scholar]
  • 60.Beijers R. J., Gosker H. R., Sanders K. J., et al. Resveratrol and metabolic health in COPD: a proof-of-concept randomized controlled trial. Clinical Nutrition . 2020;39:2989–2997. doi: 10.1016/j.clnu.2020.01.002. [DOI] [PubMed] [Google Scholar]
  • 61.Li S., Xu Y., Guo W., et al. The impacts of herbal medicines and natural products on regulating the hepatic lipid metabolism. Frontiers in Pharmacology . 2020;11(11):p. 351. doi: 10.3389/fphar.2020.00351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Chen Y., Liu S., Leng S. X. Chronic low-grade inflammatory phenotype (CLIP) and senescent immune dysregulation. Clinical Therapeutics . 2019;41(3):400–409. doi: 10.1016/j.clinthera.2019.02.001. [DOI] [PubMed] [Google Scholar]
  • 63.Evers D. L., Wang X., Huong S. M., Huang D. Y., Huang E. S. 3,4′,5-trihydroxy- trans -stilbene (resveratrol) inhibits human cytomegalovirus replication and virus-induced cellular signaling. Antiviral Research . 2004;63(2):85–95. doi: 10.1016/j.antiviral.2004.03.002. [DOI] [PubMed] [Google Scholar]
  • 64.Mahjabeen W., Khan D. A., Mirza S. A. Role of resveratrol supplementation in regulation of glucose hemostasis, inflammation and oxidative stress in patients with diabetes mellitus type 2: a randomized, placebo-controlled trial. Complementary Therapies in Medicine . 2022;66, article 102819 doi: 10.1016/j.ctim.2022.102819. [DOI] [PubMed] [Google Scholar]
  • 65.Hu H. C., Lei Y. H., Zhang W. H., Luo X. Q. Antioxidant and anti-inflammatory properties of resveratrol in diabetic nephropathy: a systematic review and meta-analysis of animal studies. Frontiers in Pharmacology . 2022;13(13, article 841818) doi: 10.3389/fphar.2022.841818. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Iyori M., Kataoka H., Shamsul H. M., et al. Resveratrol modulates phagocytosis of bacteria through an NF-κB-Dependent gene program. Antimicrobial Agents and Chemotherapy . 2008;52(1):121–127. doi: 10.1128/AAC.00210-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Korbecki J., Simińska D., Gąssowska-Dobrowolska M., et al. Chronic and cycling hypoxia: drivers of cancer chronic inflammation through HIF-1 and NF-κB activation: a review of the molecular mechanisms. International Journal of Molecular Sciences . 2021;22(19, article 10701) doi: 10.3390/ijms221910701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Korbecki J., Kojder K., Kapczuk P., et al. The effect of hypoxia on the expression of CXC chemokines and CXC chemokine receptors-a review of literature. International Journal of Molecular Sciences . 2021;22(2):p. 843. doi: 10.3390/ijms22020843. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Mosavi S. S., Rabizadeh S., Yadegar A., et al. Therapeutic effects of resveratrol and omega-3 in mice atherosclerosis: focus on histopathological changes. BMC Complementary Medicine and Therapies . 2023;23(1):p. 81. doi: 10.1186/s12906-023-03899-9. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Materials

The supplementary material for this article can be found. Supplementary Table 1: the identified 98 potential targets of resveratrol. Supplementary Table 2: the identified 1364 genes relevant to atherosclerosis.

Click here for additional data file. (61.2KB, zip)

Data Availability Statement

All data generated or analyzed during this study are included in this published article.

Articles from Mediators of Inflammation are provided here courtesy of Wiley

RESOURCES