Abstract
Cystic fibrosis (CF) was earlier thought to be a disease prevalent in the West among Caucasians. However, quite a number of recent studies have uncovered CF cases outside of this region, and reported hundreds of unique and novel variant forms of CFTR. Here, we discuss the evidence of CF in parts of the world earlier considered to be rare; Africa, and Asia. This review also highlighted the CFTR mutation variations and new mutations discovered in these regions. This discovery implies that the CF data from these regions were earlier underestimated. The inadequate awareness of the disease in these regions might have contributed towards the poor diagnostic facilities, under-diagnosis or/and under-reporting, and the lack of CF associated health policies. Overall, these regions have a high rate of infant, childhood and early adulthood mortality due to CF. Therefore, there is a need for a thorough investigation of CF prevalence and to identify unique and novel variant mutations within these regions in order to formulate intervention plans, create awareness, develop mutation specific screening kits and therapies to keep CF mortality at bay.
Keywords: Cystic Fibrosis, Caucasian, Africa, Asia
1. Introduction
Cystic Fibrosis (CF) was initially predominantly recorded within Caucasians of Northern and Western European ancestry (Fernald et al., 1990). Startlingly, recent studies revealed the possibility of more CF cases in regions earlier presumed to be rare. This includes Africa (De Boeck, 2020) and Asia (Banjar et al., 2021). According to CF registries in many of the European countries, it is evident that immigrants from both Africa and Asia have been diagnosed with CF especially in the UK, US, and France (Mekki et al., 2021). More studies have also reported CF cases in Africa and Asia, with some rare and novel mutational variants specific to some ethnic groups (Mathew et al., 2021).
Furthermore, recent studies from the non-Caucasian regions, especially the West Asia and some countries in North Africa that form the Middle East geopolitical zone (the Arab ethnicity), have reported incidence similar to the West (Banjar et al., 2021). This implies that CF might be underestimated in many parts of the world probably due to early Caucasian perception, poor diagnostic tools, lack of medical awareness, under-diagnosed or/and under-reporting (Stewart and Pepper, 2016), or probably due to the lack of CF associated health policies. These regions are presently facing similar challenges earlier recorded by the West from fifty years ago when more than 90% of infants with CF died from persistent diarrhoea and chronic malnutrition due to pancreatic failure before their second birthday (Mehta, G., Macek, M., Jr, Mehta, A., & European Registry Working Group, 2010).
Cystic Fibrosis is grouped into seven classes, denoted as class I–VII, depending on the cellular phenotype and prognostic consequences. These classes are based on either the molecular protein translation, cellular processing, or gating of the CFTR (Wei et al., 2020). Many CFTR variants go unclassified as more unique and novel variants are continuously identified around the globe (Maiuri et al., 2017). Understanding and designing therapies for specific defects have benefited thus far from this classification (Cooney et al., 2018). Class I–III and VII variants typically cause the severe type form of CF, whereas classes IV–VI mutations cause the milder form of CF (Marson et al., 2016).
This review discusses the general outlook of the CF incidences and novel CFTR mutations identified from parts of the world earlier considered to be rare; this includes Africa and Asia. We therefore emphasize the need for a thorough investigation of CF prevalence, and identification of unique and novel mutations within these regions. Optimistically, this should assist in the development of intervention plans, and mutation-specific diagnostic kits and drug/therapy.
2. Cystic Fibrosis in Africa
Evidence of CF in Africa dated back to the late 1970s in both the white and black population (Super, 1975), with the European c.1521_1523delCTT(p.Phe508del) variant diagnosed as the most common (more than 80%) among the white population than the coloured CF cohort (Herbert and Retief, 1992). Several other CF variants were identified among native African in diaspora, African-Americans, and African-Europeans (Stewart and Pepper, 2016). According to the newborn screening (NBS) cohort in France, the incidence of CF among people of African descent increased from 1% in 2000 to 10% in 2019, with the most notable variant identified was the c.2988 + 1G>A (3120 + 1G>A), which was most prevalent in patients of Congolese origin (Mayer Lacrosniere et al., 2021). The variant c.3197G>A (p.Arg1066His), c.3607A>G (p.Ile1203Val), c.273 + 4A>G (p.Gly91 = ), c.579 + 1G >T (711 + 1G>A), c.C233dup, c.1657C >T (p.Arg553X), and c.54-5940_273 + 10250del21kb (p.Ser18ArgfsX16; CFTRdel19-21) were other variants found in this cohort in patients with Congo, Sierra Leone, Cameroon, Senegal, Côte d'Ivoire and Mali ancestry respectively. Another study from France of a CF cohort of patients with diverse ethnic backgrounds and racial origins has identified novel variants, such as c.2991G>C (p.Leu997Phe) North Africa and c.4230C>A (p.Cys1410) from Sub-Saharan Africa. The c.2290C >T (p.Arg764) variant was also discovered in patients with Sub-Saharan African ancestry. This novel variant was recently discovered in an African-American patient (Mayer Lacrosniere et al., 2021). Although the majority of countries in Sub-Saharan Africa have not reported any incidents of CF to date, this suggests the potential existence of disease in that region.
Presently, the Northern (Morocco, Algeria, Tunisia, Libya, Egypt & Sudan) and Southern (Namibia, Zimbabwe, & South Africa) sections of Africa account for the majority of the continent's CF statistics (Stewart and Pepper, 2016). Preliminary statistics are currently available from three countries in Western Africa (Senegal, Ghana, and Cameroon) and one country in Eastern Africa (Rwanda) (Stewart and Pepper, 2016, Owusu et al., 2021). Historically, South Africa was the first country to report cases of CF in Africa, with white populations experiencing a higher incidence of the disease (70%) than coloured populations (0.7% Indians and 9.7% Blacks), and mixed-race populations (19%) (Zampoli et al., 2021). The c.1521_1523delCTT accounts for 63.1% all variants identified in South Africa, found at 58.1% homozygous and 32% compound heterozygous states. It was the most prevalent variant in the white population (76%) (Zampoli et al., 2021). The c.2988 + 1G>A (9.5%) variant was the second most common in the black population, presenting mostly (56.1–67.6%) in homozygous state (Zampoli et al., 2021, Van Rensburg et al., 2018). Furthermore, c.3140-26A>G (3272-26A>G) was found to be the second most common (3.98%) variant in the white South African population. Other variants discovered included c.1585-1G>A, c.2374C >T (p.Arg792X), c.3731G>A (p.Gly1244Glu), c.2051delA (p.Lys684SerfsX38), and c.3064_3117delGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCAA (p.Val1022_Gln1039del) (Owusu et al., 2021, Zampoli et al., 2021). A novel large CFTR2,3(21 kb); c.54–1161-c.1603del2875 (5.56%) was discovered in the black South African population (Van Rensburg et al., 2018). Several other variants were identified within this population, however at low frequency. They are listed in Table 2.
Table 2.
List of CF Variants Less Common Across the Different Regions of Africa and Asia.
Although the coverage CF frequency in the Northern part of Africa was not comprehensive, smaller scale studies were able to identify predominantly European variants including c.1521_1523delCTT, c.1624G >T and c.3909C>G alongside several unique/novel variants within this population (Loumi et al., 2008). In the late 1990s, a novel variant; c.422C>A (p.Ala141Asp) was identified in an Algerian patient in France (Gouyat et al., 1997). Using diagnostic sequencing, more novel and distinctive variations were identified in the Algerian population. These variants were notably diagnosed at significant high frequency in this population. They are c.2562T>C (p.Thr854Thr), c.1408A>G (p.Met470Val), c.4521G>A, and c.869 + 11C >T at 27.7%, 15.2%, 12.5% and 9.7% respectively. Other unique variants diagnosed in Algeria include c.2991G>C (p.Leu997Phe), c.743 + 40A>G (875 + 40A>G), c.1210–12T (Mathew et al., 2021), c.1584G>A, and c.3870A>G (p.Pro1290 = ). Several additional common variants were also identified, most frequent include the c.1521_1523delCTT(16.7%), c.3909C>G (8.3%), c.579 + 1G >T(8.3%), and 2183AA>G at 4.2% frequency (Loumi et al., 2008).
Unlike Algeria, variants c.1521_1523delCTT (47.06–56%) and c.3310G >T (p.lu1104X) (16.18%) were the most frequent in Tunisia, alongside the common variants c.1624G >T, c.3846G>A, c.3909C>G, c.579 + 1G >T, and c.254G>A (Messaoud et al., 2005, Boussetta et al., 2018). Other variant such as c.2766del8, c.3497T>G (p.Phe1166Cys) and c.3128T>G (p.Leu1043Arg) were exclusively found in a study of patients in Tunisia (Messaoud et al., 2005), while c.1993A >T (p.Thr665Ser) was initially exclusively identified amongst Tunisians but more recently identified in Egyptian patients (Messaoud et al., 2005, El-Seedy et al., 2017). Two more rare Tunisian specific variants identified were c.57G>A (p.Trp19X), reported in only two cases since 2013, and more recently the c.680T>G (p.Leu227Arg) (Sediki et al., 2016). Additionally, c.3607A>G, c.1679 + 5A>G (1811 + 5A>G), c.4136 + 2T>G (4268 + 2T>G) and c.3729delAinsTCT variants, were also identified among the Tunisians and the Middle Easterns. Morocco and Libya have reported only very few cases of CF from a 32 CFTR gene assay screening of random samples, identifying only variants c.1521_1523delCTT and c.1210–12T (Mathew et al., 2021) splicing variants (Ratbi et al., 2008). Earlier studies of Moroccan migrants in Europe were presented with c.1624G >T, c.1652G>A, c.3909C>G, and c.3846G>A variants (Estivill et al., 1997). Some of these variants were also identified in the Libyan population, with the most common were c.3310G >T (40% frequency), c.1521_1523delCTT (30%), c.1670delC (10%) and c.3909C>G (5%) (Fredj et al., 2011).
Although located in Africa, CF incidence in Egypt was mostly reported alongside the countries in West Asia constituting the Middle East geopolitician zone and also be due to ethnicity linkage. Unlike most countries in Africa, Egypt has established a CF centre at Cairo University and a registry since 2006. Since then, 27 mutations have been identified within the Egyptian population as of 2017 (Fathy et al., 2016). The most frequently identified variants were c.1521_1523delCTT (58%), 2183AA>G (10%), c.3870A>G and c.3484C >T (p.Arg1162X) at 6% each. Variants c.1364C>A, c.443T>C (p.Ile148Thr) and c.1408G>A were identified at 4% each (Sahami et al., 2014). Additionally, the c.1210–12T (Mathew et al., 2021) (28.6%) and c.3752G>A(p.Ser1251Asn) (3.6%) variants were also commonly identified in the Egyptians. Two novel mutations identified in the Egyptians were c.1766 + 3A>G (1898 + 3A>C) and c.1993A >T (Stewart and Pepper, 2016). In contrast, Sudan reported only 35 cases mainly recorded from the Northern part of Sudan (Hamouda et al., 2020), uniquely identifying c.1736A>G (p.Asp579Gly) and c.3304A >T (p.Arg1102X) mutations as the most common within the population (Stewart and Pepper, 2016).
Unfortunately, there are relatively non-existing CF reports from countries within the Central, Western and Eastern parts of Africa. However, there are few studies conducted in South Africa and Europe which reported cases of patients from these African regional origins. Variants identified in patients with Central African ancestry include c.2988 + 1G>A, c.3327C>A (p.Tyr1109Ter), c.273 + 1G>A, c.1521_1523delCTT and c.273 + 4A>G (p.Gly91 = ) identified in Cameroonians (Stewart and Pepper, 2016, Mayer Lacrosniere et al., 2021), while variants c.3197G>A, c.399insT, c.2988 + 1G>A, c.287C>A (p.Ala96Glu), and c.933C>A (p.Phe311Leu) were identified in the Congolese (Mayer Lacrosniere et al., 2021). Studies in South Africa have recorded CF in patients of Malawi, Zimbabwe, Mozambique (Owusu et al., 2021) and Botswana origins (Super, 1975). Novel variant (c.541161-c.164 + 1603del2875) was identified in a Zimbabwean patient, alongside the common c.2988 + 1G>A (Stewart and Pepper, 2016). A number of variants were earlier identified in Rwandan patients, some of which are known variants as listed in Table 2. Additionally, novel variants were also identified; these include c.610G>A (p.Ala204Thr), V348M, T577T, c.3468 + 5G>A (3272–32T>C), c.*2G>A (4575 + 2G>A), and c.1176 + 30G>C (Ser212Ser) (Mutesa et al., 2009).
Countries in Sub-Saharan Africa lack the availability of sweat testing, which might be a major barrier in diagnosing CF in the region (Owusu et al., 2021). Nonetheless, there were evidences of CF in this region following diagnosis in patients of Sub-Saharan Africa descends in other countries. For instance, a study conducted in South Africa reported CF in a patient of West African descendants of Ghana (Owusu et al., 2020). This finding led to CF screening in Ghana, which resulted in the discovery of positive CF cases with the identification of variants c.1364C>A (p.Ala455Glu), Exon 12d deletion, c.1397C>A or c.1397C>G (p.Ser466X) and c.1373G >T (p.Gly458Val) (Owusu et al., 2021). More CF variants were identified in patients of West African descent, including IVS2 + 28A>G, c.(2988 + 1_2989-1)_(3468 + 1_3469-1)del (Ex17a-Ex18del), c.4136 + 1G>A, 711 + 1G>A, and c.4230C>A in Senegalese. While c.3700A>G and c.1521_1523delCTT variants were also identified in patients of Sierra Leone descend in France (Stewart and Pepper, 2016, Mayer Lacrosniere et al., 2021). Furthermore, c.1657C >T, CFTRdel19-21, c.3745delC (3745delC) and c.4242 + 1G>A were identified in the West African descendants of Mali, while c. C233dup variant in patients of Côte d'Ivoire descend (Mayer Lacrosniere et al., 2021).
Variant c.2988 + 1G>A has earlier been linked to the black Africans, with a detection frequency of 40% and 12% in patients of African and European descents, respectively (Stewart and Pepper, 2016). This is supported by data from the West, with the highest frequency (12.3%) detection among African-Americans and in native African patients (Macek et al., 1997). Conversely, the common European variants: c.3846G>A, c.1624G >T and c.3909C>G, were found to be genetically linked to the Arabs of North Africa and to the Caucasians of South Africa through the Mediterranean ancestry (Van Rensburg et al., 2018). Similar to the Caucasian CF, c.1521_1523delCTT is a recurring variant amongst Africans. Other variants common in Africa include c.254G>A(p.Gly85Glu), c.1679 + 1G>C (1811 + 1G>C), c.1210-1G>C(1342-1G>C) (Stewart and Pepper, 2016), c.1652G>A and c.350G>A(p.Arg117His) (Maiuri et al., 2017). Although only a handful of countries in Africa have reported CF cases, the majority of these countries have reported a diagnosis of novel mutations with 100% frequency such as c.1609delA in Algeria, EX17a-EX18del in Senegal, and c.3327C>A in Cameroon (Stewart and Pepper, 2016).
There are no published CF data from many countries in the Western and Central Africa. For instance, a PubMed search review on Nigeria conducted by Akanbi and colleagues (2009) using “Nigeria and Lung” resulted in no indexed report of CF cases from the country. Another study by Oguonu et al. (2014) reported no record of CF from a 5-year (2007–2012) hospital data analysis on the prevalence of paediatric respiratory conditions (Oguonu et al., 2014). However, based on anecdotal reports, there have been a few undocumented cases of suspected CF child mortality from the country. Although there is no published current report of CF in Kenya, two cases of CF in patients of Kenyan descent were reported in 1959 (Paodoa et al., 1999).
3. Cystic Fibrosis in Asia
Cystic fibrosis in Asia is reported to be rare as confirmed by data from the West, where fewer people with Asian ancestry have CF (<1% incidence in the UK). Those with CF show relatively milder clinical manifestations as compared to the other populations (Bosch et al., 2017). The incidences of CF among Asian immigrants in Canada, the United Kingdom and United State were 1 in 9200, 1 in 10, 000, and 1 in 40, 000, respectively (Singh et al., 2015). A number of CFTR mutational variants have been identified among the Asian population, with the common variant c.1521_1523delCTT recorded at low frequency (Singh et al., 2015).
3.1. Cystic Fibrosis in Western Asia (The Middle East)
A study by Hammoudeh et al. collectively summarised the incidence rate of CF from the past few decades in some Arab countries both in West Asia and North Africa, which are categorized as the under the Middle East geopolitical zone due to their ethnic similarities (Hamouda et al., 2020). The study found that the CF incidence in the West Asia ranges from 1 in 2500 to 1 in 16,000 live births. This includes Bahrain at 1:5800–7700, Jordan 1:2560, Kuwait 1:3500, Oman 1:2410, Saudi Arabia 1:4243, United Arab Emirate (UAE) 1:15876, Egypt 1:2664, and Morocco 1:1680 live births (Hamouda et al., 2020). Even though the F508del variant was not the most common, it was a common variant among the Arab countries both in West Asia and North Africa that include Saudi Arabia, United Arab Emirates (UAE), Oman, Lebanon, Jordan, Syria, Qatar, Algeria, Egypt, and Tunisia (Banjar and Angyalosi, 2015, AbdulWahab et al., 2021).
A study from the Kingdom of Saudi Arabia identified CF cases with a few novel variants that include; c.1418del (p.Gly473fs) which identified (17–20%) as the most common variant in the country (Banjar et al., 2021, Banjar and Angyalosi, 2015). Other novel variants identified include c.416A >T (p.His139Leu) which is unique to Saudi Arabia, c.579 + 1G >T, and c.1507del9 (Banjar and Angyalosi, 2015). These variants have different geographical distributions; c.1418del being most common in the Northern part, c.3700A>G in the Central, Southern and Western parts, while c.2988 + 1G>A in the Eastern part of Saudi Arabia (Banjar and Angyalosi, 2015). The latter variant (c.2988 + 1G>A) had an ancestry origin linked to Africa (Alibakhshi et al., 2008). Variants such as c.254G>A, c.I507del9, and c.3909C>G (Lopes-Pacheco, 2020) were common in the West and the Mediterranean. Some of the other common variants identified within population of Saudi Arabia were c.3700A>G, c.2988 + 1G>A, c.579 + 1G >T, c.416A >T (p.His139Leu), c.1911delG (p.Gln637HisfsX26), c.1645A>C (p.Ser549Arg), and c.1652G>A at 12%, 11%, 9%, 6%, 5% and 1.5% respectively (Banjar et al., 2021).
Variant c.3700A>G was identified as the most common (65–66.7%) within population in Qatar (Hamouda et al., 2020, AbdulWahab et al., 2021). This variant was first described in South France (AbdulWahab et al., 2021). The c.1521_1523delCTT variant (15.5%) was also identified within the population of Qatar. The other variants identified in Qatar are also listed in Tables 1 and 2. The United Arab Emirates (UAE), unlike the neighbouring Saudi Arabia and Qatar, lacked a comprehensive study on CF. Only one article reported of a rare variant c.1647T>G (p.Ser549Arg), which was diagnosed heterogeneously in all CF patients while heterogenous c.1521_1523delCTT mutation was diagnosed in 80% of all cases (Frossard et al., 1998).
Table 1.
List of Common CF Variants Across the Different Regions of Africa and Asia.
One CF case was reported in Kuwait in 1973, eight in 1977 and a few more in the 1980 s at an incidence of 1 in 3500 live births (Kollberg, 1986). However there are no recent available records of incidence and type of variants from Kuwait. Similarly, Bahrain lacks recent records on CF, with the most current incidence at 1 in 5800 live births as at 2002 (Eskandarani, 2002). Unlike Kuwait, some variants have been identified in Bahrain, with 2043delG (30.8%) variant as the most common, followed by p.His139>Leu (548A >T) and c.4041C>G (4041C>G), each at 19.3%. Others variants identified include c.1521_1523delCTT (7.7%), c.1161delC, c.1624G >T (p.Gly542Ter), c.2988 + 1G>A, and c.3529A >T (p.K1177X) variants, at 3.8% each (Eskandarani, 2002). In Oman, c.1647T>A (p.Ser549Arg) (75%) and c.1521_1523delCTT (14%) variants were the most common identified variants, similar to that recorded in the UAE. (Frossard et al., 1998) Variants c.1733-1734delTA and c.1175T>G (p.Val392Gly) identified at the rate of 7% and 4%, respectively, are both rare and novel (Fass et al., 2014). Tow addition novel variants; c. 4242 + 1G>C (Fass et al., 2014, Al Balushi et al., 2021) and c.575A >T (Al Sa’idi, L., Al Busaidi, N., Al Bimani, M., 2021); were also identified within the Omanis. Recently, c.2988 + 1G>A, L578delTA, c.1069G>A (p.Ala357Thr), and c.3718-2477C >T variants were identified for the first time within Omanis (Al Balushi et al., 2021).
Jordan recorded a low frequency of c.1521_1523delCTT (7.4%) as compared to the other countries in the Middle East. Six novel variants; c.164 + 9A >T, c.1163C >T, c.2279C >T, c.360delA (p.K120fs), c.3876delA (p.Val1293TyrfsX35) and c.3731G>A (p.Gly1244Glu) have been identified within the population. More variants such as c.1545_1546delTA (p.Tyr515X), c.3718-2477C >T (3849 + 5A>G) and c.54-5940_273 + 10250del21kb p.Ser18ArgfsX16; CFTRdele2,3(21 kb) were also identified (Rawashdeh and Manal, 2000). Similarly, low frequency of c.1521_1523delCTT (2.78%) was detected among patients in the Children Welfare Hospital Baghdad in Iraq as compared to other Middle Eastern countries. Iraq detected 34 variants with the majority (∼70%) of these variants were associated with the polymorphic variants of IVS8, namely 5T, 7T, and 9T (Abdul-Qadir et al., 2021). Other common variants detected, although in lower frequency, were c.2988 + 1G>A and c.3846G>A at 4.17% each, c.3484C >T (2.78%), c.3140-26A>G (1.38%), c.1040G>C(1.38%), and c.2051_2052delAAinsG (1.38%) variants. A novel variant: c.1519_1521delATC (p.Ile507del) was also reported from this study at the rate of 1.3% (Abdul-Qadir et al., 2021). Contrary, another study from Al-Imamian Al-Kadhimiyain Teaching Hospital Iraq reported c.1408A>G (p.Met470Val) variant as the most common at 36.66%, followed by c.1521_1523delCTT at 16.6% (Zaidan et al., 2020). This supports an earlier finding by Sahami and team, where c.1408A>G was identified at 74.1% frequency, followed by c.1521_1523delCTT (14.81%), c.1397C>A (p.Ser466X) and c.3107C >T (p.Thr1036Ile) at 1.85% each (Katznelson and Ben-Yishay, 1978).
Between 1946 and 1976, Israel had an incidence approximating to the Caucasians of European ancestry with a total of 140 CF cases (Stafler et al., 2016). Unlike most of the countries in West Asia, Israel early on established the population carrier screening (PCS) for CF early on in 1999, which recorded a rapid decline in incidence, from 14.5 per 100,000 live births in 1990 to 6 per 100,000 live births in 2011 (Orgad et al., 2001). CF incidence and variant spectrum varies across the three ethnicities of the Israeli population (75% Jews, 20% Arabs and 5% others). Out of the 95 CF births recorded between 2004 and 2011, 64% were Jews and 36% were Arabs (Orgad et al., 2001). The Israel Jews are made up of sub-ethnic groups; Ashkenazi, Balkan, Tunisian, Libyan, Turkish, Georgian, Moroccan, Iranian, and Sephardi Jews (Quint et al., 2005). These Jewish communities have lived isolated from each other, hence the respective CF genetic load difference, with the highest CF detection amongst the Ashkenazi (69%), followed by Moroccan Jews (12.1%), and Balkan Jews (7.5%). The CF amongst the Iranian and Yemenis Jews (each at 0.7%) in Israel was very rare, presented with rare and unique variants c.2856G>C and c.3911T>G respectively (Mei-Zahav et al., 2018). The only variant identified in the Georgian Jews community was the unique variant c.1075C>A(p.Gln359Lys) (Essawi et al., 2015). In general, most frequent variants identified in Israel Jewish communities include W1282X (31.1%), F508del (35.6%), c.1624G >T (8.5%), c.3718-2477C >T (4.6%), c.3909C>G (3.6%), c.1075C>A and c.273 + 1G>A each at 2.8% (Mei-Zahav et al., 2018). Several others variants identified in the earlier mentioned West Asian countries were present in the cohort notably were c.254G>A, c.1647T>A, c.3700A>G, and, 3121-1G> (Orgad et al., 2001, Quint et al., 2005, Mei-Zahav et al., 2018). Variants c.3266G>A and c.3276C>G were unique to this population while c.1585-1G>A was previously identified in South Africa. On the other hand, variants c.2988 + 1Kbdel8.6 Kb, 2183AA>G and c.3883_3886delATTT were identified also in the Arab populations (Orgad et al., 2001).
More than 17 different CF variants were reported in Palestine (El-Shanti, 2020), at an earlier prevalence of 4 in 100,000 (Siryani et al., 2015) and a current incidence of 2.53 in 10,000 live births (El-Shanti, 2020). About 62.5% of the identified cases have at least a single allele of c.1521_1523delCTT; hence making it the most frequent (37.5%) variant in Palestine. Just like many countries in West Asia, the common variants apart form c.1521_1523delCTT are c.2988 + 1G>A (12.5%), c.3909C>G (4.69%), c.254G>A (4.69%), as well as c.2988 + 1Kbdel8.6 Kb (4.69%). While c.3846G>A was mostly identified in heterogeneous compound, either with c.1521_1523delCTT (3.13%) or other unidentified (4.69%) variant (Siryani et al., 2015). In another study of a Palestinian cohort, c.1393-1G>A appeared to be the most common variant (Jarjour et al., 2018). Recently, a rare variant; c.3623del (p.Gly1208AlafsX3) was identified in a Palestinian-Lebanese child (Al-Baba and Zetoune, 2021).
As for Syria, 13 variants were identified while 22% of the variants remain undetectable (Des Georges et al., 1997). Just like Palestine, the most common variants identified in the Syrian were c.1521_1523delCTT (18–36%), c.3846G>A (12–17%), and c.3909C>G (6–8%). Other common variants were c.1040G>C (p.Arg347Pro) at 6%, c.399T>C/c.443T>C, CFTR del2-3(21 kb) and c.1766 + 1G >T at 5% each (Des Georges et al., 1997). Recently, four more variants, c.2657 + 5G>A, c.2052delA, c.3718-2477C >T, and c.262_263delTT (p.Leu88IlefsX22), were detected in the Syrian cohort (Farra et al., 2010). Similarly, in Lebanon two putative novel variants, c.2016_2018del (p.Glu672del) and IVS21-28G>A, were diagnosed in the Lebanon cohort (Dogru et al., 2020). However, the most common CF variants were c.1521_1523delCTT, c.3846G>A, c.3909C>G, and c.11C >T at 37.5%, 15.6%, 9.4% and 7% respectively. (Dogru et al., 2020, Yiallouros et al., 2021).
Although Turkey is a European country, part of turkey is in the West Asia. Like Egypt, it is also classified as the Middle East geopolitical zone. The first reported case of CF in Turkey dated back to 1973, and the lack of CF data from that time prompted for the establishment of the Turkish National CF registry in 2017, which swiftly attained 30% (23 CF centres) coverage just between 2017 and 2020, recording an incidence of 2.9 per 10,000 live births. Just like in Europe, c.1521_1523delCTT (28%), c.3909C>G (4.9%), and c.1624G >T (4.5%) were the most common variants observed in Turkey, with 25.2% of the variants remaining unidentified. Other common variants in the Turkish population were c.1545_1546delTA (p.Tyr515X), c.254G>A, 2183AA>G and c.2657 + 5G>A (Izumikawa et al., 2009). Similarly, neighbouring Cyprus also recently established a national CF registry, and identified c.1521_1523delCTT (45.2%) variant as the most common. The novel variant p.Leu346Pro was an indigenous variant in 2007, and is currently diagnosed as the second most common (6.7%) variant in Cyprus (Yamashiro et al., 1997). Two new rare and novel variants, c.2629T>G (p.Ser877Ala) and c.531dupT (p.Gly178TripfsX5), were also recently identified and presumed unique to Cypriot descents. Other rare variants identified in this population were CFTR-dup2 (3.8%) and a compound heterogeneous c.4200_4201delTG (p.Cys1400Terfs)/c.489 + 3A>G variant (Yamashiro et al., 1997). Several other variants have also been identified within the population, as seen in Table 1, with linkages to the Arabian ancestry in the West Asia and North Africa, as well as the Jewish Greek and European Caucasian ancestries (Yamashiro et al., 1997).
Many variants identified in West Asia have been identified in both Africa and the other Asian regions. This include c.(2988 + 1_2989-1)_(3468 + 1_3469-1)del, c.1000C >T, c.1210–12T (Mathew et al., 2021), and c.1364C>A. other Caucasian known variants are also common to both Africa and Asia; these include c.1521_1523delCTT, c.1624G >T, c.1652G>A, are among others, this is summarized in Table 1.
3.2. Cystic Fibrosis in East, South and South-East Asia
Over the years, an increase in CF cases have been reported from both East, South and South-East Asia. For instance, Japan had about 150 cases between the year 1951–2009 (Norzila et al., 2005), with an incidence of 1 in 350,000 (Yang et al., 2017). Malaysia reported of 16 cases between 1987 and 2003 based on a positive sweat test (Iwasa et al., 2001), and 10 cases were reported from Korea (Jung et al., 2011). Just as presumed in Africa, with several early deaths resulting from CF in East and South Asia were recorded before the age of 13 from jaundice, malnutrition, pneumonia, and neonatal meconium ileus (Tomoda et al., 2018). Many countries in these regions have little or no detection of the c.1521_1523delCTT variant, with the majority of the CF cases diagnosed at a later age, even though their medical records indicated CF phenotypic expression persisted since their early childhood (Kunitomo et al., 1991, Zilfalil et al., 2006). For instance, a case of a Japanese with medical history of CF symptoms who was tested negative by a CF genetic panel at early childhood (7 months), was later found to have CF at the age of 23 (Zilfalil et al., 2006). Nevertheless, more studies in Asia since the early 2000s have identified known and novel variants through direct genomic DNA sequencing. Although rare, the c.1521_1523delCTTl and c.1657C >T variants have been identified within these population alongside unique variants (Zheng and Cao, 2017, Tian et al., 2016, Kularatnam et al., 2015). For instance, the c.1521_1523delCTTl variant was identified in compound heterogeneous state mostly in children of European and Asian parentage (Eurasians), alongside other Asia variant variants. In China, the c.1521_1523delCTTl was diagnosed heterogeneously alongside the Chinese common variant c.2909G>A (p.Gly970Asp) (Prasad et al., 2010), or with c.2738A>G in Sri Lankan (Mei-Zahav et al., 2005).
3.3. Cystic Fibrosis in South Asia
Although c.1521_1523delCTT is a common variant across South Asia (Iran, India, Pakistan, and Sri Lanka), it has a lesser incidence (19%–44%) compared to that in the Western nations (Kabir et al., 2020). As of the late 1990 s, Canada, the United Kingdom, and the United States all reported similar CF incidence rates in the Indian ethnic group. South Asian immigrants were less likely to have c.1521_1523delCTT than the general population according to these countries national data registries (44–46% versus 65.1% and above). About 56% of the South Asian CF patients in these countries had either c.1647T>A (6%) or had other unidentified variants (Siddique et al., 2018). Furthermore, an extensive analysis to uncover unique variants apart from the c.1647T>A variant, identified variants including c.653T>A (p.Leu218X) (7.7%), c.1393-1G>A, c.3718-2477C >T, and c.1175T>G (p.Val392Gly) each at 3.8%, which were found in the South Asian population of Canada. Additionally, with the exception of c.1521_1523delCTT, none of the common Caucasian variants identified in the Canadian general populations were found in the South Asians (Siddique et al., 2018). Meanwhile, 26.7% of the CF alleles of the Canadian South Asian cohort remained unidentified, which was significantly high compared to the 8.2% unidentified in the general CF population of Canada (Siddique et al., 2018).
A number of CF cases were recorded from three tertiary care hospitals in Bangladesh from 2000 to 2017. However, the type of CF variants identified were not reported. Confirmatory sweat test was conducted using fast, cheap and effective sweat testing technique, which was locally developed. Out of the 224 enrolled CF suspected patients, 95 were confirmed to have CF from sweat chloride test, exhibiting different range of CF symptoms (Sharma Pandey et al., 2019). The first recorded case of CF in Nepal was of a 2 month male infant presented with severe anaemia and hypoproteinaemia, but was negative for the common Caucasian variants c.1521_1523delCTT, c.1624G >T, c.1652G>A and c.1657C >T (Ashavaid et al., 2012). The second case was identified in a day-old infant enrolled in a pilot study for newborn screening in Nepal, who unfortunately did not survive beyond the third month. Based on the pilot study, the prevalence rate of CF in Nepal was 1 per 4360 live births (Aziz et al., 2017).
In India, the increase in the CF incidences was associated with studies tracking the underlying genetic linkages to the high rate of infertility in males. This was due to congenital bilateral absence of vas deferens in more than 95% of males with CF (Kabir et al., 2020, Harendra de Silva et al., 1994). The T5 splicing and c.1521_1523delCTT variants were identified as the most common underlying genetic alteration at the rates of 52% and 23% respectively (Kabir et al., 2020, Harendra de Silva et al., 1994). Like many countries in Asia, several other common and unique variants were identified in India, these are listed in Table 2.
In a study conducted in Pakistan, CF patients were genetically screened the common variants. However, only c.1647T>A and c.1521_1523delCTT were identified. The recent incidence of found at 17.3%. However, a recent study reported c.1521_1523delCTT at an incidence of 27.9% (Indika et al., 2019). This was similar to the study by Shastri and team, who also identified c.1521_1523delCTT at the rate of 26.5% (homozygous in 20 patients and heterozygous in 13 patients of the 100 patients in the studies). The majority of the CF alleles (67%) in their study remained unidentified. Other rare variants identified in their study include c.1161delC (1.5%), c.1647T>A, c.1002-7_1002-5delTTT, c.3718-2477C >T at 1%. Novel variants identified from this cohort include c.1002-7_1002-5delTTT, c.445G >T (p.Gly149Ter) and c.547C>A (p.Leu183Ile). More novel variants identified in Indian and Pakistani population include c.3986-3987delC, p.1792InsA, c.206T>A (p.Leu69His), c.473G>A (Ser158Asn), c.1478A >T (Gln493Leu), c.1507A>C (p.Ile503Leu), c.3985G>C (Glu1329Gln) and c.744-6del4 that represented 15% of the CF alleles (Kabir et al., 2020, Aziz et al., 2017). Variants c.1521_1523delCTT, and c.1647T>A were the most common variants in the Indian/Pakistan cohort at 17% and 5.7% respectively. Apart from c.1521_1523delCTT, a few other Western variants were also identified, although rare, except for c.350G>A which was found at 3.4%. (Kabir et al., 2020, Aziz et al., 2017, Indika et al., 2019).
The first available recorded case of CF in Sri Lanka was of a 5 year girl presented with bronchopneumonia and recurrent chest infection since six weeks of age. She was tested positive using the sweat test (Masekela et al., 2013). Rare cases of CF were also reported in Sri Lanka, with unique types of mutation, potentially linked to genetic flow from India and Europe (Alibakhshi et al., 2021). Just like in South Africa's (Kawase et al., 2022), CF cases in Sri Lanka were initially presented as kwashiorkor, but later confirmed as CF with c.1393-1G>A in one allele while the second mutation could not be identified (Siddique et al., 2018). Similar to India and Pakistan, c.1521_1523delCTT (69.74%) mutation is the most common variant in Sri Lankans, mostly diagnosed in a heterogenous state. Variants c.53 + 1G >T, c.2052dup, c.(273 + 1_274-1)_(1679 + 1_1680-1)del (CFTRdele4-11) and c.1393-1G>A identified in this population were previously reported in European CF patients (Alibakhshi et al., 2021). Also detected were rare variant c.1161delC previously identified in India and Pakistan, while variants c.1367T>C (Val456Ala) and c.2738A>G are unique to Sri Lanka. (Mei-Zahav et al., 2005, Alibakhshi et al., 2021).
Earlier investigations Alibakhshi et al (Alibakhshi et al., 2008) were unable to identify more than 40% of the variants in the Iranian population; however, a subsequent study by Alibakhshi et al. in (2021) identified more than 100 variants in Iran. These included eight novel variants c.406-8TNC, p.A566D, c.2576delA, c.2752-1_275delGGTGGCinsTTG, p.T10361, p.W1145R, c.3850-24GNA, and c.1342-?_1524+?del, all identified at a low frequency (Wakabayashi-Nakao et al., 2019). Like many countries, c.1521_1523delCTT (18%-21.22%) was diagnosed as the most common variant in the population (Wakabayashi-Nakao et al., 2019). Other common variants in the population include c.2051_2052delAAinsG (6.5%), c.1397C>G (5.8%), c.3909C>G (4.3%), 2789 + 5G>A (4.3%), c.1624G >T (3.6%), c.2988 + 1G>A (3.6%), c.1000C >T (2.9%) and c.2998delA (p.Ile1000LeufsX2) (2.9%). (Wakabayashi-Nakao et al., 2019).
3.4. Cystic Fibrosis in East Asia
Large deletions and duplications of CFTR gene were frequently detected in Japanese CF patients by direct sequencing. This included the most common variant; c.2908 + 1085_3367 + 260del7201 (exon 16–17 deletion/CFTRdele16-17b), which also a unique variant to CF patients of Asian descent (Iso et al., 2019). This was the most diagnosed variant (70%) in Japanese CF patients (Sohn et al., 2019). Other unique and frequent variants in the population were −966T>G, c.1408A>G, c.2562T>G (p.Thr854 = ), c.3468G >T (p.Leu1156Phe), c.4056G>C (p.Gln1352His), c.4357C >T (Koh et al., 2006). More unique variants identified in Japan include c.1040G>A (p.Arg347His), D979A, c.3254A>G (p.His1085Arg), c.455T>G (p.Met152Arg), and c.1549T>A (p.Tyr517His) (Norzila et al., 2005). Other variants identified in this populations are listed in Table 2. Recently, another novel variant was identified in Japanese CF patients, which was characterized by the deletion of the entire promoter region (ASZ1 3′ flanking region) of CFTR gene (Guo et al., 2018). These variants alongside c.650A>G (p.Glu217Gly), c.1666A>G, and c.3468G >T (p.Leu1156Phe) were also unique to Asia and frequently identified in compound heterogenous states with either c.1408A>G and (TG) polymorphism 5T, 7T, 11/12T variants (Koh et al., 2006).
Similarly, South Korea also reported a 50% allele prevalence of c.2908 + 1085_3367+ (p.(Gly970_Thr1122del), which is also known as CFTRdele16-17b (Liu et al., 2020). Earlier CF studies in South Korea identified c.293A>G and c.658C >T(p.Gln220X) variants which had been previously identified in France and England, respectively (Ahn et al., 2005), and recently in China (Cui et al., 2020, Liu et al., 2015). The c.293A>G (18.8%) variant was found be high recurring variant (Kunitomo et al., 1991). Variants IVS8-T5-M470V and c.1408A>G polymorphism, synonymous to East Asia, is highly associated with congenital bilateral absence of the vas deferens (Lin et al., 2019).
In China, the most common variant was the c.2909G>A, diagnosed at 31.6–37.5% allele frequency (Cui et al., 2020, Liu et al., 2015). Over the years, quite a number of rare novel variants have been identified among patients of Chinese origin. An earlier study reported of a novel and unique c.1766 + 5G >T (1898 + 5G >T) variant, identified in patients of Chinese origin. Other novel mutations identified in the Chinese population are exon 7–11 deletion (ΔE7-E11), c.3635delTa (V1212Afs15), c.1997T4Ga, c.2907A4C, and △E7-E11(c.744-?_1584 +?del) (Prasad et al., 2010). More novel variants discovered include c.579 + 1_579 + 2insACAT, c.753_754delAG, c.699C>A, c.1240X (Q414X), c.1117-1G>C, c.3140-454_c.3367 + 249del931ins13, c.607A >T, c.325T>G (Y109D), exon 2–3 deletion ΔE2-3 (c.54-?_273 +?del, △E2–3), and c.1716C>A (Cui et al., 2020, Liu et al., 2015). Other common variants identified in China include c.1766 + 5G >T (13%), c.3911T>G (8.7%), c.263T>A (4.1%), c.293A>G (4.1%), c.1666A>G, and c.595C >T, each at 3.3% frequency. Several other common variants have been identified in this population (Cui et al., 2020, Liu et al., 2015). Interestingly, the c.1521_1523delCTT is extremely rare and when present, was commonly found in a heterozygous state alongside another type of variant (Prasad et al., 2010).
The most common variant in South China-Hong Kong was c.3068T>G, followed by c.1766 + 5G >T, while the China’s most frequent variant; c.2909G>A was not diagnosed in the study (Suwanjutha et al., 1998). Just a handful of CF cases have been reported in Taiwan. Nevertheless, three novel CFTR mutations; E7X, 989-992insA and S308X were detected among Taiwanese CF patients (Teeratakulpisarn et al., 2006). Variant c.920G>A (S308X) was diagnosed in a heterogenous state alongside c.1408G>A (Wang et al., 2019). Furthermore, c.1766 + 5G >T and c.3068T>G variants were discovered at the highest frequency. A literature review of Taiwanese CF patients by Wang et al., (Wang et al., 2019), recorded the c.1766 + 5G >T (50%) variant as the most common in the cohort and was predominantly presented in a heterogenous state along with 2215insG + G2816A (33.33%). Only one case of the European variant c.1657C >T (16.67%) was reported, and was presented in a homozygous state (Lumpaopong et al., 2009). Another study of Taiwanese CF patients reported one and two homogenous cases of c.3718-2477C >T and c.1657C >T, respectively, while the both c.1766 + 5G >T and c.3068T>G were presented in heterogeneous states with each other (Teeratakulpisarn et al., 2006).
3.5. Cystic Fibrosis in South-East Asia
Just like Taiwan, the most common identified CF variant in Thailand was the c.1766 + 3A>G, occurring in 9 out of the 14 alleles reported (Van de Vosse et al., 2010). Variants c.1364C>A (p.Ala455Glu), c.4200_4201delTG (p.Cys1400X), c.3074C>A, and c.273 + 1G>A, were also recorded in Thailand, alongside two novel variants; c.738G>A (p.Lys246=; W202X) and c.869 + 3A >T (1001 + 3A >T). Only two cases of c.1521_1523delCTT were recorded within this population; one case had homozygous c.1521_1523delCTT (Ngiam et al., 2006), while the other was heterozygous c.1521_1523delCTT presented alongside the rare variant p.Phe311Leu (Padilla et al., 2022). Indonesia also reported of one novel variant: c.1303C>G (p.Leu435Val), and some known variant including c.861C>G, c.1666A>G, c.2052dup and eight types of polymorphism (Ngukam et al., 2004). The c.1666A>G and c.2052dup variants were also reported in the Chinese population of Singapore; however, at a higher frequency, alongside I125T and I2TG5T variants (Nam et al., 2005). Malaysia also reported of 16 cases between 1987 and 2003 based on a positive sweat test (Iwasa et al., 2001) however no variants were specifically reported. Recently, the Philippines has successfully implemented expanded newborn screening and is projecting about 100 CF cases per year based on the CF prevalence rate (5 cases per year) in Filipinos in California, USA (Luu and Chilvers, 2011). However, there is currently no available literature record of CF in the Philippines.
3.6. Cystic Fibrosis in Central Asia and other Asian countries
To date, Central Asia, Bangladesh, Brunei, Bhutan, Cambodia, Laos, Maldives, Myanmar, and Vietnam have no literature evidence of CF cases. However, a novel CFTR mutation c.3373G>C (Ex17b) was identified in a Laotian patient in France, presented with congenital bilateral absence of the vas deferens (Scotet et al., 2020). Similarly, Japanese researchers reported the first recorded CF cases (37 CF cases) in Vietnamese in Hanoi. All patients were presented with different types of c.1408G>A polymorphism mutations in the CFTR gene. The F c.1521_1523delCTT was not detected in any of the patients (Nam et al., 2005). Four other CF cases in Vietnamese have also been recorded in Canada, one of the cases was diagnosed at an advanced stage. The early age CF diagnosis of this patient was overlooked due the ethnicity misconception of CF occurrence in Asians, despite having chronic respiratory symptoms (Luu and Chilvers, 2011).
4. Prospect
The present surge in the CF cases in Africa and Asia is believed to be due to the evidence that CF occurs in patients of diverse ethnicity, based on reports from multi-ethnic countries like the USA, France, South America, Canada and the UK. This confirms that CF is rather a pan-ethnic disease condition than a Caucasian allied disease as earlier presumed (Banjar et al., 2021, Mayer Lacrosniere et al., 2021). This might have created awareness among physicians to further investigate CF in suspected patients with unconfirmed disease conditions with CF symptoms. Nevertheless, awareness is still inadequate in many countries where sweat screening and genetic testing tools are unavailable, especially in the identification of atypical manifestation and different variant spectrum (Cui et al., 2020). Furthermore, the existing mutational diagnostic (panel) kits are not suitable for the non-Caucasian populations, resulting in a false-negative test and difficulty in the detection of variants specific to these regions/countries (Mekki et al., 2021, Mayer Lacrosniere et al., 2021). This and the Caucasian allied misconception, might be some of the reasons behind the underdiagnosed or misdiagnosed CF cases in these concerned regions, leading to CF being diagnosed as another common phenocopy illness. The possibility of a false-negative result from panel kits and “the gold standard” sweat test in mild cases, would likely result in mortality due to gradually unchecked damaged organs (Stewart and Pepper, 2016). Therefore, there is a need for a thorough investigation of CF prevalence to identify unique and novel genetic variants of CF, so a specific diagnostic kit could be developed for use within these regions.
A high number of early childhood death in these regions are suspected to be undocumented CF-related, most of which were associated with malnutrition and infectious disease complications (Zampoli et al., 2021, Sharma Pandey et al., 2019). However, this is unlikely in many countries in the West due to the establishment and implementation of CF national newborn screening (NBS) program, some dated back to 4 decades ago (Scotet et al., 2020). The CF NBS standard practice guidelines developed by the West can be adopted by countries in these regions. A crucial step towards finalizing plans towards the implementation of the NBS programs across the globe would aid in the development of cheaper specific drugs through countries’ crowdfunding, research investment and collaboration as seen during the COVID-19 pandemic.
5. Conclusion
Initially thought to be a Caucasian disease, CF was earlier presumed non-existence or rarity of CF in the other parts of the world, particularly in Africa and Asia. This was predominantly due to the lack of CF data in the non-Caucasian population. However, with the recent surge in data and number of CFTR mutational variants reported from all parts of the world indicates an immediate need for an intervention to tackle the current challenges in the identification and management of CF in these regions. Therefore, we would like to recommend an intensive investigation and documentation of all genetic mutations and the implementation of CFTR (Clinical and Functional Translation of CFTR) database to analyse the heterogenous origin and distribution of CFTR mutations in these regions/countries. This will assist in the development of specific regional genetic screening and diagnostic tools for subsequent development of appropriate therapies and genetic counselling for families.
Authors Contributions
SA: Manuscript writing, funding, final approval of manuscript; KAB: Conception and design, manuscript writing, visualization; UA: visualization; CDM & NN manuscript reviewing and editing, and final approval of the manuscript. All authors have read and agreed to the final version of the manuscript.
Funding
This work was supported by Geran Putra (code no. GP/2018/9622200) from Universiti Putra Malaysia.
Declaration of Competing Interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Contributor Information
Khadijat Abubakar Bobbo, Email: khadijantii@gmail.com.
Umar Ahmad, Email: umarahmad@basug.edu.ng.
De-Ming Chau, Email: deming@upm.edu.my.
Norshariza Nordin, Email: shariza@upm.edu.my.
Syahril Abdullah, Email: syahril@upm.edu.my.
References
- Abdul-Qadir A.G., Al-Musawi B.M., Thejeal R.F., Al-Omar S. Molecular analysis of CFTR gene mutations among Iraqi cystic fibrosis patients. Egypt. J. Med. Hum. Genet. 2021;22(1):45. doi: 10.1186/s43042-021-00164-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- AbdulWahab A., AlNaimi A., Habra B., Janahi I. First report of the cystic fibrosis transmembrane conductance regulator mutation c.1521_1523delCTT (p. Phe508del) in two Qatari patients with cystic fibrosis. Qatar Med. J. 2021;2021(1):24. doi: 10.5339/qmj.2021.24. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ahn K.M., Park H.Y., Lee J.H., Lee M.G., Kim J.H., Kang I.J., Lee S.I. Cystic fibrosis in Korean children:a case report identified by a quantitative pilocarpine iontophoresis sweat test and genetic analysis. J. Korean Med. Sci. 2005;20(1):153–157. doi: 10.3346/jkms.2005.20.1.153. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Al Balushi S., Al Balushi Y., Al Busaidi M., Al Mutawa L. A Novel Cystic Fibrosis Gene Mutation C.4242+1G>C in an Omani Patient: A Case Report. Oman Med. J. 2021;36(2):e243. doi: 10.5001/omj.2021.28. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Al Sa’idi L., Al Busaidi N., Al Bimani M. Asp192Val, A Novel Mutation In 2 Omani Siblings With Cystic Fibrosis. A Case Report And Review Of Literature. J. Med. Case Rep. Case Ser. 2021;2(3) doi: 10.38207/Jmcrcs20210053. [DOI] [Google Scholar]
- Al-Baba R., Zetoune A.B. A retrospective study of cases diagnosed with cystic fibrosis at a single care center in Syria. Egypt J. Med. Hum. Genet. 2021;22:59. doi: 10.1186/s43042-021-00178-5. [DOI] [Google Scholar]
- Alibakhshi R., Kianishirazi R., Cassiman J.J., Zamani M., Cuppens H. Analysis of the CFTR gene in Iranian cystic fibrosis patients: identification of eight novel mutations. J. Cystic Fibrosis: Off. J. Eur. Cystic Fibrosis Soc. 2008;7(2):102–109. doi: 10.1016/j.jcf.2007.06.001. [DOI] [PubMed] [Google Scholar]
- Alibakhshi R., Mohammadi A., Khamooshian S., Kazeminia M., Moradi K. CFTR gene mutation spectrum among 735 Iranian patients with cystic fibrosis: A comprehensive systematic review. Pediatr. Pulmonol. 2021;56(12):3644–3656. doi: 10.1002/ppul.25647. [DOI] [PubMed] [Google Scholar]
- Ashavaid T.F., Raghavan R., Dhairyawan P., Bhawalkar S. Cystic fibrosis in India: a systematic review. J. Assoc. Physicians India. 2012;60:39–41. [PubMed] [Google Scholar]
- Aziz D.A., Billoo A.G., Qureshi A., Khalid M., Kirmani S. Clinical and laboratory profile of children with Cystic Fibrosis: Experience of a tertiary care center in Pakistan. Pakistan J. Med. Sci. 2017;33(3):554–559. doi: 10.12669/pjms.333.12188. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Banjar H., Angyalosi G. The road for survival improvement of cystic fibrosis patients in Arab countries. Int. J. Pediatr. Adolesc. Med. 2015;2(2):47–58. doi: 10.1016/j.ijpam.2015.05.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Banjar H., Al-Mogarri I., Nizami I., Al-Haider S., AlMaghamsi T., Alkaf S., Al-Enazi A., Moghrabi N. Geographic distribution of cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in Saudi Arabia. Int. J. Pediatr. Adolesc. Med. 2021;8(1):25–28. doi: 10.1016/j.ijpam.2019.12.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bosch B., Bilton D., Sosnay P., Raraigh K.S., Mak D., Ishiguro H., Gulmans V., Thomas M., Cuppens H., Amaral M., De Boeck K. Ethnicity impacts the cystic fibrosis diagnosis: A note of caution. J. Cystic Fibrosis: Off. J. Eur. Cystic Fibrosis Soc. 2017;16(4):488–491. doi: 10.1016/j.jcf.2017.01.016. [DOI] [PubMed] [Google Scholar]
- Boussetta K., Khalsi F., Bahri Y., Belhadj I., Tinsa F., Messaoud T.B., Hamouda S. Cystic fibrosis in Tunisian children: a review of 32 children. Afr. Health Sci. 2018;18(3):664–670. doi: 10.4314/ahs.v18i3.24. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cooney A.L., McCray P.B., Jr, Sinn P.L. Cystic Fibrosis Gene Therapy: Looking Back. Looking Forward. Genes. 2018;9(11):538. doi: 10.3390/genes9110538. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cui X., Wu X., Li Q., Jing X. Mutations of the cystic fibrosis transmembrane conductance regulator gene in males with congenital bilateral absence of the vas deferens: Reproductive implications and genetic counseling (Review) Mol. Med. Rep. 2020;22(5):3587–3596. doi: 10.3892/mmr.2020.11456. [DOI] [PMC free article] [PubMed] [Google Scholar]
- De Boeck K. (2020). Cystic fibrosis in the year 2020: A disease with a new face. Acta paediatrica (Oslo, Norway : 1992), 109(5), 893–899. 10.1111/apa.15155. [DOI] [PubMed]
- Des Georges M., Mégarbané A., Guittard C., Carles S., Loiselet J., Demaille J., Claustres M. Cystic fibrosis in Lebanon: distribution of CFTR mutations among Arab communities. Hum. Genet. 1997;100(2):279–283. doi: 10.1007/s004390050505. [DOI] [PubMed] [Google Scholar]
- Dogru D., Çakır E., Şişmanlar T., Çobanoğlu N., Pekcan S., Cinel G., Yalçın E., Kiper N., Şen V., Şen H.S., Ercan Ö., Keskin Ö., Eltan S.B., Al Shadfan L.M., Yazan H., Altıntaş D.U., Şaşihüseyinoğlu Ş., Sapan N., Çekiç Ş., Çokuğraş H., Özçelik U. Cystic fibrosis in Turkey: First data from the national registry. Pediatr. Pulmonol. 2020;55(2):541–548. doi: 10.1002/ppul.24561. [DOI] [PubMed] [Google Scholar]
- El-Seedy A.S., Shafiek H., Kitzis A., Ladevèze V. CFTR Gene Mutations in the Egyptian Population: Current and Future Insights for Genetic Screening Strategy. Front. Genet. 2017;8:37. doi: 10.3389/fgene.2017.00037. [DOI] [PMC free article] [PubMed] [Google Scholar]
- El-Shanti A. (2020) An Epidemiologic Study of Cystic Fibrosis in the Gaza Strip. J Community Med. 2020;3(1):1023. [Google Scholar]
- Eskandarani H.A. Cystic fibrosis transmembrane regulator gene mutations in Bahrain. J. Trop. Pediatr. 2002;48(6):348–350. doi: 10.1093/tropej/48.6.348. [DOI] [PubMed] [Google Scholar]
- Essawi O., Farraj M., De Leeneer K., Steyaert W., De Pauw K., De Paepe A., Claes K., Essawi T., Coucke P.J. Next generation sequencing to determine the cystic fibrosis mutation spectrum in Palestinian population. Dis. Markers. 2015;2015 doi: 10.1155/2015/458653. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Estivill X., Bancells C., Ramos C. Geographic distribution and regional origin of 272 cystic fibrosis mutations in European populations. The Biomed CF Mutation Analysis Consortium. Hum. Mutat. 1997;10(2):135–154. doi: 10.1002/(SICI)1098-1004(1997)10:2<135::AID-HUMU6>3.0.CO;2-J. [DOI] [PubMed] [Google Scholar]
- Farra C., Menassa R., Awwad J., Morel Y., Salameh P., Yazbeck N., Majdalani M., Wakim R., Yunis K., Mroueh S., Cabet F. Mutational spectrum of cystic fibrosis in the Lebanese population. J. Cystic Fibrosis: Off. J. Eur. Cystic Fibrosis Soc. 2010;9(6):406–410. doi: 10.1016/j.jcf.2010.08.001. [DOI] [PubMed] [Google Scholar]
- Fass U.W., Al-Salmani M., Bendahhou S., Shivalingam G., Norrish C., Hebal K., Clark F., Heming T., Al-Khusaiby S. Defining a mutational panel and predicting the prevalence of cystic fibrosis in oman. Sultan Qaboos Univ. Med. J. 2014;14(3):e323–e329. [PMC free article] [PubMed] [Google Scholar]
- Fathy M., Ramzy T., Elmonem M.A., Amer M., Zeidan A., Hassan F.A., Mehaney D.A. Molecular screening of CFTR gene in Egyptian patients with congenital bilateral absence of the vas deferens: a preliminary study. Andrologia. 2016;48(10):1307–1312. doi: 10.1111/and.12563. [DOI] [PubMed] [Google Scholar]
- Fernald G.W., Roberts M.W., Boat T.F. Cystic fibrosis: a current review. Pediatr. Dent. 1990;12(2):72–78. [PubMed] [Google Scholar]
- Fredj S.H., Fattoum S., Chabchoub A., Messaoud T. First report of cystic fibrosis mutations in Libyan cystic fibrosis patients. Ann. Hum. Biol. 2011;38(5):561–563. doi: 10.3109/03014460.2011.557090. [DOI] [PubMed] [Google Scholar]
- Frossard, P. M., Girodon, E., Dawson, K. P., Ghanem, N., Plassa, F., Lestringant, G. G., & Goossens, M. (1998). Identification of cystic fibrosis mutations in the United Arab Emirates. Mutations in brief no. 133. Online. Human mutation, 11(5), 412–413. 10.1002/(SICI)1098-1004(1998)11:5<412::AID-HUMU15>3.0.CO;2-O. [DOI] [PubMed]
- Gouyat L., Pascaud O., Munck A., Elion J., Denamur E. Novel mutation (A141D) in exon 4 of the CFTR gene identified in an Algerian patient. Hum. Mutat. 1997;10(1):86–87. doi: 10.1002/(SICI)1098-1004(1997)10:1<86::AID-HUMU15>3.0.CO;2-W. [DOI] [PubMed] [Google Scholar]
- Guo X., Liu K., Liu Y., Situ Y., Tian X., Xu K.F., Zhang X. Clinical and genetic characteristics of cystic fibrosis in CHINESE patients: a systemic review of reported cases. Orphanet J. Rare Dis. 2018;13(1):224. doi: 10.1186/s13023-018-0968-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hamouda S., Fredj S.H., Hilioui S., Khalsi F., Ameur S.B., Bouguila J., Boussoffara R., Besbes H., Ajmi H., Mattoussi N., Messaoud T., Mehrezi A., Hachicha M., Boughamoura L., Sfar M.T., Gueddiche N., Abroug S., Becheur S.B., Barsaoui S., Tebib N., Boussetta K. Preliminary national report on cystic fibrosis epidemiology in Tunisia: the actual state of affairs. Afr. Health Sci. 2020;20(1):444–452. doi: 10.4314/ahs.v20i1.51. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Harendra de Silva D.G., Lakkumar Fernando A.J., Senaka Gunatilleke M.D. Cystic fibrosis in Sri Lanka. Ceylon Med. J. 1994;39(1):50–52. [PubMed] [Google Scholar]
- Herbert J.S., Retief A.E. The frequency of the delta F508 mutation in the cystic fibrosis genes of 71 unrelated South African cystic fibrosis patients. South African medical journal = Suid-Afrikaanse tydskrif vir geneeskunde. 1992;82(1):13–15. [PubMed] [Google Scholar]
- Indika N., Vidanapathirana D.M., Dilanthi H.W., Kularatnam G., Chandrasiri N., Jasinge E. Phenotypic spectrum and genetic heterogeneity of cystic fibrosis in Sri Lanka. BMC Med. Genet. 2019;20(1):89. doi: 10.1186/s12881-019-0815-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Iso M., Suzuki M., Yanagi K., Minowa K., Sakurai Y., Nakano S., Satou K., Shimizu T., Kaname T. The CFTR gene variants in Japanese children with idiopathic pancreatitis. Hum. Genome Var. 2019;6:17. doi: 10.1038/s41439-019-0049-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Iwasa S., Fujiwara M., Nagata M., Watanabe T. Three autopsied cases of cystic fibrosis in Japan. Pathol. Int. 2001;51(6):467–472. doi: 10.1046/j.1440-1827.2001.01219.x. [DOI] [PubMed] [Google Scholar]
- Izumikawa K., Tomiyama Y., Ishimoto H., Sakamoto N., Imamura Y., Seki M., Sawai T., Kakeya H., Yamamoto Y., Yanagihara K., Mukae H., Yoshimura K., Kohno S. Unique mutations of the cystic fibrosis transmembrane conductance regulator gene of three cases of cystic fibrosis in Nagasaki, Japan. Internal medicine (Tokyo, Japan) 2009;48(15):1327–1331. doi: 10.2169/internalmedicine.48.2078. [DOI] [PubMed] [Google Scholar]
- Jarjour R.A., Al-Berrawi S., Ammar S., Majdalawi R. Spectrum of cystic fibrosis mutations in Syrian patients. Minerva Pediatr. 2018;70(2):159–164. doi: 10.23736/S0026-4946.17.04280-3. [DOI] [PubMed] [Google Scholar]
- Jung H., Ki C.S., Koh W.J., Ahn K.M., Lee S.I., Kim J.H., Ko J.S., Seo J.K., Cha S.I., Lee E.S., Kim J.W. Heterogeneous spectrum of CFTR gene mutations in Korean patients with cystic fibrosis. Korean J. Lab. Med. 2011;31(3):219–224. doi: 10.3343/kjlm.2011.31.3.219. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kabir, A. L., Roy, S., Habib, R. B., Anwar, K. S., Mollah, M., Amin, R., Mridha, A. A., Majumder, J. U., Hossain, M. D., Haque, N., Ahmed, S., & Chisti, M. J. (2020). Cystic Fibrosis Diagnosed Using Indigenously Wrapped Sweating Technique: First Large-Scale Study Reporting Socio-Demographic, Clinical, and Laboratory Features among the Children in Bangladesh A Lower Middle Income Country. Global pediatric health, 7, 2333794X20967585. 10.1177/2333794X20967585. [DOI] [PMC free article] [PubMed]
- Katznelson D., Ben-Yishay M. Cystic fibrosis in Israel: clinical and genetic aspects. Isr. J. Med. Sci. 1978;14(2):204–211. [PubMed] [Google Scholar]
- Kawase M., Ogawa M., Hoshina T., Kojiro M., Nakakuki M., Naruse S., Ishiguro H., Kusuhara K. Case Report: Japanese Siblings of Cystic Fibrosis With a Novel Large Heterozygous Deletion in the CFTR Gene. Front. Pediatr. 2022;9 doi: 10.3389/fped.2021.800095. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Koh W.J., Ki C.S., Kim J.W., Kim J.H., Lim S.Y. Report of a Korean patient with cystic fibrosis, carrying Q98R and Q220X mutations in the CFTR gene. J. Korean Med. Sci. 2006;21(3):563–566. doi: 10.3346/jkms.2006.21.3.563. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kollberg H. Cystic fibrosis in Kuwait. J. Trop. Pediatr. 1986;32(6):293–294. doi: 10.1093/tropej/32.6.293. [DOI] [PubMed] [Google Scholar]
- Kularatnam, G. A. M., Warawita, D., Jayasena, S., Nadarajah, S., Jasinge, E., Mendis, D., Kennedy, H., Florkowski, C., & George, P. (2015) . Cystic fibrosis in a Sri Lankan infant, confirmed by genotyping: implications for future diagnosis and service provision. Journal of the Postgraduate Institute of Medicine 2015;2:E171-3doi: http://dx.doi.org/jpgim.10.4038/jpgim.8046.
- Kunitomo K., Komi N., Kawahito M., Miura M., Sasaki K. Cystic fibrosis in Japan. Tokushima J. Exp. Med. 1991;38(3–4):85–89. [PubMed] [Google Scholar]
- Lin, H. C., Huang, S. W., Lu, Y. C., Wang, C. C. (2019). Early diagnosis of a case of infantile cystic fibrosis and review of literature in Taiwan. J Med Sci (serial online) https://www.jmedscindmc.com/text.asp?2019/39/2/90/242736.
- Liu Y., Wang L., Tian X., Xu K.F., Xu W., Li X., Yue C., Zhang P., Xiao Y., Zhang X. Characterization of gene mutations and phenotypes of cystic fibrosis in Chinese patients. Respirology (Carlton. 2015;Vic.), 20(2):312–318. doi: 10.1111/resp.12452. [DOI] [PubMed] [Google Scholar]
- Liu K., Xu W., Xiao M., Zhao X., Bian C., Zhang Q., Song J., Chen K., Tian X., Liu Y., Xu K.F., Zhang X. Characterization of clinical and genetic spectrum of Chinese patients with cystic fibrosis. Orphanet J. Rare Dis. 2020;15(1):150. doi: 10.1186/s13023-020-01393-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lopes-Pacheco M. CFTR Modulators: The Changing Face of Cystic Fibrosis in the Era of Precision Medicine. Front. Pharmacol. 2020;10:1662. doi: 10.3389/fphar.2019.01662. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Loumi O., Ferec C., Mercier B., Creff J., Fercot B., Denine R., Grangaud J.P. CFTR mutations in the Algerian population. J. Cystic Fibrosis: Off. J. Eur. Cystic Fibrosis Soc. 2008;7(1):54–59. doi: 10.1016/j.jcf.2007.04.004. [DOI] [PubMed] [Google Scholar]
- Lumpaopong A., Thirakhupt P., Srisuwan K., Chulamokha Y. Rare F311L CFTR gene mutation in a child presented with recurrent electrolyte abnormalities and metabolic alkalosis: case report. Journal of the Medical Association of Thailand = Chotmaihet thangphaet. 2009;92(5):694–698. [PubMed] [Google Scholar]
- Luu K., Chilvers M. Case 1: Chronic cough in a Vietnamese adolescent: Should we be sweating? Paediatr. Child Health. 2011;16(8):465–466. doi: 10.1093/pch/16.8.465a. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Macek M., Jr, Mackova A., Hamosh A., Hilman B.C., Selden R.F., Lucotte G., Friedman K.J., Knowles M.R., Rosenstein B.J., Cutting G.R. Identification of common cystic fibrosis mutations in African-Americans with cystic fibrosis increases the detection rate to 75% Am. J. Hum. Genet. 1997;60(5):1122–1127. [PMC free article] [PubMed] [Google Scholar]
- Maiuri L., Raia V., Kroemer G. Strategies for the etiological therapy of cystic fibrosis. Cell Death Differ. 2017;24(11):1825–1844. doi: 10.1038/cdd.2017.126. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Marson F., Bertuzzo C.S., Ribeiro J.D. Classification of CFTR mutation classes. Lancet Respir. Med. 2016;4(8):e37–e38. doi: 10.1016/S2213-2600(16)30188-6. [DOI] [PubMed] [Google Scholar]
- Masekela R., Zampoli M., Westwood A.T., White D.A., Green R.J., Olorunju S., Kwofie-Mensah M. Phenotypic expression of the 3120+1G>A mutation in non-Caucasian children with cystic fibrosis in South Africa. J. Cystic Fibrosis: Off. J. Eur. Cystic Fibrosis Soc. 2013;12(4):363–366. doi: 10.1016/j.jcf.2012.11.003. [DOI] [PubMed] [Google Scholar]
- Mathew A., Dirawi M., Abou Tayoun A., Popatia R. A Rare Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Mutation Associated With Typical Cystic Fibrosis in an Arab Child. Cureus. 2021;13(2):e13526. doi: 10.7759/cureus.13526. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mayer Lacrosniere S., Gerardin M., Clainche-Viala L.L., Houdouin V. Phenotypic Presentations of Cystic Fibrosis in Children of African Descent. Genes. 2021;12(3):458. doi: 10.3390/genes12030458. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mehta G., Macek M., Jr, Mehta A., European Registry Working Group Cystic fibrosis across Europe: EuroCareCF analysis of demographic data from 35 countries. J. Cystic Fibrosis: Off. J. Eur. Cystic Fibrosis Soc. 2010;9(Suppl 2):S5–S21. doi: 10.1016/j.jcf.2010.08.002. [DOI] [PubMed] [Google Scholar]
- Mei-Zahav M., Durie P., Zielenski J., Solomon M., Tullis E., Tsui L.C., Corey M. The prevalence and clinical characteristics of cystic fibrosis in South Asian Canadian immigrants. Arch. Dis. Child. 2005;90(7):675–679. doi: 10.1136/adc.2003.042614. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mei-Zahav M., Stafler P., Senderowitz H., Bentur L., Livnat G., Shteinberg M., Orenstein N., Bazak L., Prais D., Levine H., Gur M., Khazanov N., Simhaev L., Eliyahu H., Cohen M., Wilschanski M., Blau H., Mussaffi H. The Q359K/T360K mutation causes cystic fibrosis in Georgian Jews. J. Cystic Fibrosis: Off. J. Eur. Cystic Fibrosis Soc. 2018;17(5):e41–e45. doi: 10.1016/j.jcf.2018.06.008. [DOI] [PubMed] [Google Scholar]
- Mekki C., Aissat A., Mirlesse V., Mayer Lacrosniere S., Eche E., Le Floch A., Whalen S., Prud’Homme C., Remus C., Funalot B., Castaigne V., Fanen P., de Becdelièvre A. Prenatal Ultrasound Suspicion of Cystic Fibrosis in a Multiethnic Population: Is Extensive CFTR Genotyping Needed? Genes. 2021;12(5):670 doi: 10.3390/genes12050670. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Messaoud T., Bel Haj Fredj S., Bibi A., Elion J., Férec C., Fattoum S. Epidémiologie moléculaire de la mucoviscidose en Tunisie [Molecular epidemiology of cystic fibrosis in Tunisia] Ann. Biol. Clin. 2005;63(6):627–630. [PubMed] [Google Scholar]
- Mutesa L., Azad A.K., Verhaeghe C., Segers K., Vanbellinghen J.F., Ngendahayo L., Rusingiza E.K., Mutwa P.R., Rulisa S., Koulischer L., Cassiman J.J., Cuppens H., Bours V. Genetic analysis of Rwandan patients with cystic fibrosis-like symptoms: identification of novel cystic fibrosis transmembrane conductance regulator and epithelial sodium channel gene variants. Chest. 2009;135(5):1233–1242. doi: 10.1378/chest.08-2246. [DOI] [PubMed] [Google Scholar]
- Nam M.H., Hijikata M., Tuan L.A., Lien L.T., Shojima J., Horie T., Nakata K., Matsushita I., Ohashi J., Tokunaga K., Keicho N. Variations of the CFTR gene in the Hanoi-Vietnamese. Am. J. Med. Genet. A. 2005;136(3):249–253. doi: 10.1002/ajmg.a.30826. [DOI] [PubMed] [Google Scholar]
- Ngiam N.S., Chong S.S., Shek L.P., Goh D.L., Ong K.C., Chng S.Y., Yeo G.H., Goh D.Y. Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in Asians with chronic pulmonary disease: a pilot study. J. Cystic Fibrosis: Off. J. Eur. Cystic Fibrosis Soc. 2006;5(3):159–164. doi: 10.1016/j.jcf.2006.02.002. [DOI] [PubMed] [Google Scholar]
- Ngukam A., Jacquemont M.L., Souville I., Viel M., Beldjord C., Hubert D., Hughes J.N., Bienvenu T. A novel missense mutation A1081P in the cystic fibrosis transmembrane conductance regulator (CFTR) gene identified in a Laotian patient with congenital bilateral absence of the vas deferens. J. Trop. Pediatr. 2004;50(4):239–240. doi: 10.1093/tropej/50.4.239. [DOI] [PubMed] [Google Scholar]
- Norzila M.Z., Norrashidah A.W., Rusanida A., Chan P.W., Azizi B.H. Cystic fibrosis in Malaysian children. Med. J. Malaysia. 2005;60(1):54–61. [PubMed] [Google Scholar]
- Oguonu T., Adaeze Ayuk C., Edelu B.O., et al. Pattern of respiratory diseases in children presenting to the paediatric emergency unit of the University of Nigeria Teaching Hospital, Enugu: a case series report. BMC Pulm. Med. 2014;14:101. doi: 10.1186/1471-2466-14-101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Orgad S., Neumann S., Loewenthal R., Netanelov-Shapira I., Gazit E. Prevalence of cystic fibrosis mutations in Israeli Jews. Genet. Test. 2001;5(1):47–52. doi: 10.1089/109065701750168725. [DOI] [PubMed] [Google Scholar]
- Owusu S.K., Morrow B.M., White D., Klugman S., Vanker A., Gray D., Zampoli M. Cystic fibrosis in black African children in South Africa: a case control study. J. Cystic Fibrosis: Off. J. Eur. Cystic Fibrosis Soc. 2020;19(4):540–545. doi: 10.1016/j.jcf.2019.09.007. [DOI] [PubMed] [Google Scholar]
- Owusu S.K., Obeng-Koranteng G., Odai S.L., Kilba M.C.F., Abbeyguaye P., Onwona-Agyeman K., Asamoah-Okyere S., Oduah-Odoom P.M., Adjetey N.D., Bonus K., Lawerteh S.E., Afidemnyo A., Zampoli M. Cystic fibrosis in two Ghanaian Children. J. Pan Afr. Thoracic Soc. 2021;2(3):167–170. doi: 10.25259/JPATS_10_2021. [DOI] [Google Scholar]
- Padilla C.D., Therrell B.L., Jr, Alcausin M., Chiong M., Abacan M., Reyes M., Jomento C.M., Dizon-Escoreal M., Canlas M., Abadingo M.E., Posecion J., Abarquez C.G., Andal A.P., Elizaga A., Halili-Mendoza B.C., Otayza M., Millington D.S. Successful Implementation of Expanded Newborn Screening in the Philippines Using Tandem Mass Spectrometry. Int. J. Neonatal Screen. 2022;8(1):8. doi: 10.3390/ijns8010008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Paodoa C., Goldman A., Jenkins T., Ramsay M. Cystic fibrosis carrier frequencies in populations of African origin. J. Med. Genet. 1999;36(1):41–44. [PMC free article] [PubMed] [Google Scholar]
- Prasad R., Sharma H., Kaur G. Molecular basis of cystic fibrosis disease: an Indian perspective. Indian J. Clin. Biochem.: IJCB. 2010;25(4):335–341. doi: 10.1007/s12291-010-0091-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Quint A., Lerer I., Sagi M., Abeliovich D. Mutation spectrum in Jewish cystic fibrosis patients in Israel: implication to carrier screening. Am. J. Med. Genet. A. 2005;136(3):246–248. doi: 10.1002/ajmg.a.30823. [DOI] [PubMed] [Google Scholar]
- Ratbi I., Génin E., Legendre M., Le Floch A., Costa C., Cherkaoui-Deqqaqi S., Goossens M., Sefiani A., Girodon E. Cystic fibrosis carrier frequency and estimated prevalence of the disease in Morocco. J. Cystic Fibrosis: Off. J. Eur. Cystic Fibrosis Soc. 2008;7(5):440–443. doi: 10.1016/j.jcf.2007.12.006. [DOI] [PubMed] [Google Scholar]
- Rawashdeh M., Manal H. Cystic fibrosis in Arabs: a prototype from Jordan. Ann. Trop. Paediatr. 2000;20(4):283–286. doi: 10.1080/02724936.2000.11748148. [DOI] [PubMed] [Google Scholar]
- Sahami A., Alibakhshi R., Ghadiri K., Sadeghi H. Mutation Analysis of Exons 10 and 17a of CFTR Gene in Patients with Cystic Fibrosis in Kermanshah Province, Western Iran. J. Reprod. Infertility. 2014;15(1):49. [PMC free article] [PubMed] [Google Scholar]
- Scotet V., Gutierrez H., Farrell P.M. Newborn Screening for CF across the Globe-Where Is It Worthwhile? Int. J. Neonatal Screen. 2020;6(1):18. doi: 10.3390/ijns6010018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sediki F.Z., Radoui A., Boudjema A., Abdi M., Zemani-Fodil F., et al. Spectrum of CFTR Mutations in the Algerian Population: Molecular and Computational Analysis. J. Genet. Disor. Genet. Rep. 2016;5:1. doi: 10.4172/2327-5790.1000130. [DOI] [Google Scholar]
- Sharma Pandey A., Joshi S., Rajbhandari R., Kansakar P., Dhakal S., Fingerhut R. Newborn Screening for Selected Disorders in Nepal: A Pilot Study. Int. J. Neonatal Screen. 2019;5(2):18. doi: 10.3390/ijns5020018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Siddique M.A., Khan K., Bera A., Ghorai S., Mallik J., Sarkar S. Cystic fibrosis with Severe Anaemia and Hypoproteinaemia. J. Nepal Paediatr. Soc. 2018;38(2):118–121. doi: 10.3126/jnps.v38i2.19196. [DOI] [Google Scholar]
- Singh M., Rebordosa C., Bernholz J., Sharma N. Epidemiology and genetics of cystic fibrosis in Asia: In preparation for the next-generation treatments. Respirology (Carlton, Vic) 2015;20(8):1172–1181. doi: 10.1111/resp.12656. [DOI] [PubMed] [Google Scholar]
- Siryani I., Jama M., Rumman N., Marzouqa H., Kannan M., Lyon E., Hindiyeh M. Distribution of Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Mutations in a Cohort of Patients Residing in Palestine. PLoS One. 2015;10(7):e0133890. doi: 10.1371/journal.pone.0133890. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sohn Y.B., Ko J.M., Jang J.Y., Seong M.W., Park S.S., Suh D.I., Ko J.S., Shin C.H. Deletion of exons 16–17b of CFTR is frequently identified in Korean patients with cystic fibrosis. Eur. J. Med. Genet. 2019;62(8) doi: 10.1016/j.ejmg.2019.103681. [DOI] [PubMed] [Google Scholar]
- Stafler P., Mei-Zahav M., Wilschanski M., Mussaffi H., Efrati O., Lavie M., Shoseyov D., Cohen-Cymberknoh M., Gur M., Bentur L., Livnat G., Aviram M., Alkrinawi S., Picard E., Prais D., Steuer G., Inbar O., Kerem E., Blau H. The impact of a national population carrier screening program on cystic fibrosis birth rate and age at diagnosis: Implications for newborn screening. J. Cystic Fibrosis: Off. J. Eur. Cystic Fibrosis Soc. 2016;15(4):460–466. doi: 10.1016/j.jcf.2015.08.007. [DOI] [PubMed] [Google Scholar]
- Stewart C., Pepper M. Cystic fibrosis on the African continent. Genet Med. 2016;18:653–662. doi: 10.1038/gim.2015.157. [DOI] [PubMed] [Google Scholar]
- Super M. Cystic fibrosis in the South West African Afrikaner. An example of population drift, possibly with heterozygote advantage. S. Afr. Med. J. = Suid-Afrikaanse tydskrif vir geneeskunde. 1975;49(20):818–820. [PubMed] [Google Scholar]
- Suwanjutha S., Huang N.N., Wattanasirichaigoon D., Sura T., Harris A., Macek M., Jr Case report of a Thai male cystic fibrosis patinet with the 1898+ 1G -->T splicing mutation in the CFTR gene: a review of East Asian cases. Mutations in brief no. 196. Online. Hum. Mutation. 1998;12(5):361. [PubMed] [Google Scholar]
- Teeratakulpisarn J., Kosuwon P., Srinakarin J., Panthongviriyakul C., Sutra S. Cystic fibrosis in three northeast Thai infants is CF really a rare disease in the Thai population? J. Med. Assoc. Thailand = Chotmaihet thangphaet. 2006;89(10):1756–1761. [PubMed] [Google Scholar]
- Tian X., Liu Y., Yang J., Wang H., Liu T., Xu W., Li X., Zhu Y., Xu K.F., Zhang X. p. G970D is the most frequent CFTR mutation in Chinese patients with cystic fibrosis. Hum. Genome Variat. 2016;3:15063–15071. doi: 10.1038/hgv.2015.63. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tomoda Y., Arai S., Kawaguchi K., Nabeshima S., Orihashi T., Kihara Y., Kouzuma R., Tanaka K. Diagnosis of cystic fibrosis in an adult Japanese male. J. Gen. Fam. Med. 2018;19(2):57–58. doi: 10.1002/jgf2.151. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Van de Vosse E., de Visser A.W., Al-Attar S., Vossen R., Ali S., van Dissel J.T. Distribution of CFTR variations in an Indonesian enteric fever cohort. Clin. Infect. Dis. 2010;50(9):1231–1237. doi: 10.1086/651598. [DOI] [PubMed] [Google Scholar]
- Van Rensburg J., Alessandrini M., Stewart C., Pepper M.S. Cystic fibrosis in South Africa: A changing diagnostic paradigm. S. Afr. Med. J. = Suid-Afrikaanse tydskrif vir geneeskunde. 2018;108(8):624–628. doi: 10.7196/SAMJ.2018.v108i8.13225. [DOI] [PubMed] [Google Scholar]
- Wakabayashi-Nakao K., Yu Y., Nakakuki M., Hwang T.C., Ishiguro H., Sohma Y. Characterization of Δ(G970–T1122)-CFTR, the most frequent CFTR mutant identified in Japanese cystic fibrosis patients. J. Physiol. Sci.: JPS. 2019;69(1):103–112. doi: 10.1007/s12576-018-0626-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang Y.Q., Hao C.L., Jiang W.J., Lu Y.H., Sun H.Q., Gao C.Y., Wu M. c.753_754delAG, a novel CFTR mutation found in a Chinese patient with cystic fibrosis: A case report and review of the literature. World J. Clin. Cases. 2019;7(15):2110–2119. doi: 10.12998/wjcc.v7.i15.2110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wei T., Sui H., Su Y., Cheng W., Liu Y., He Z., Ji Q., Xu C. Research advances in molecular mechanisms underlying the pathogenesis of cystic fibrosis: From technical improvement to clinical applications (Review) Mol. Med. Rep. 2020;22(6):4992–5002. doi: 10.3892/mmr.2020.11607. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yamashiro Y., Shimizu T., Oguchi S., Shioya T., Nagata S., Ohtsuka Y. The estimated incidence of cystic fibrosis in Japan. J. Pediatr. Gastroenterol. Nutr. 1997;24(5):544–547. doi: 10.1097/00005176-199705000-00010. [DOI] [PubMed] [Google Scholar]
- Yang S.Y., Lee K.S., Cha M.J., Kim T.J., Kim T.S., Yoon H.J. Chest CT Features of Cystic Fibrosis in Korea: Comparison with Non-Cystic Fibrosis Diseases. Korean J. Radiol. 2017;18(1):260–267. doi: 10.3348/kjr.2017.18.1.260. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yiallouros P.K., Matthaiou A.Μ., Anagnostopoulou P., Kouis P., Libik M., Adamidi T., Eleftheriou A., Demetriou A., Ioannou P., Tanteles G.A., Costi C., Fanis P., Macek M., Neocleous V., Phylactou L.A. Demographic characteristics, clinical and laboratory features, and the distribution of pathogenic variants in the CFTR gene in the Cypriot cystic fibrosis (CF) population demonstrate the utility of a national CF patient registry. Orphanet J. Rare Dis. 2021;16(1):409. doi: 10.1186/s13023-021-02049-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zaidan A., Salman J., Arif H. The spectrum of mutations analysis of exons 10 and 17a of CFTR gene in Iraqi patients with cystic fibrosis disease. Biochem Cell Arch. 2020;20(2):6177–6181. [Google Scholar]
- Zampoli M., Verstraete J., Frauendorf M., Kassanjee R., Workman L., Morrow B.M., Zar H.J. Cystic fibrosis in South Africa: spectrum of disease and determinants of outcome. ERJ Open Res. 2021;7(3):00856–02020. doi: 10.1183/23120541.00856-2020. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zheng B., Cao L. Differences in gene mutations between Chinese and Caucasian cystic fibrosis patients. Pediatr. Pulmonol. 2017;52(3):E11–E14. doi: 10.1002/ppul.23539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zilfalil B.A., Sarina S., Liza-Sharmini A.T., Oldfield N.J., Stenhouse S.A. Detection of F508del mutation in cystic fibrosis transmembrane conductance regulator gene mutation among Malays. Singapore Med. J. 2006;47(2):129–133. [PubMed] [Google Scholar]