Skip to main content
Saudi Pharmaceutical Journal : SPJ logoLink to Saudi Pharmaceutical Journal : SPJ
. 2023 May 29;31(7):1327–1338. doi: 10.1016/j.jsps.2023.05.022

Effect of Apremilast on LPS-induced immunomodulation and inflammation via activation of Nrf2/HO-1 pathways in rat lungs

Naif O Al-Harbi a, Faisal Imam a,, Mohammad Matar Al-Harbi a, Wajhul Qamar a, Khaldoon Aljerian b, Md Khalid Anwer c, Mohammed Alharbi d, Sultan Almudimeegh a, Abdullah S Alhamed a, Ali A Alshamrani a
PMCID: PMC10267521  PMID: 37323920

Highlights

  • Lipopolysaccharides induces inflammation and immunomodulation.

  • Lipopolysaccharides decreases CD161+ T cells population while decreases CD31b/c+ Cells population during acute lung injury.

  • Apremilast ameliorates lipopolysaccharides-induced lung inflammation.

  • Apremilast treatment prevent lipopolysaccharides-induced lung inflammation and immunomodulation via Nrf2/HO-1 signaling.

Keywords: Apremilast, Lipopolysaccharides, Heme-oxygenase, Nitric oxide synthase-2, Western blot, Polymerase chain reaction

Abstract

Lipopolysaccharides (LPS), the lipid component of gram-negative bacterial cell wall, is recognized as the key factor in acute lung inflammation and is found to exhibit severe immunologic reactions. Phosphodiesterase-4 (PDE-4) inhibitor: “apremilast (AP)” is an immune suppressant and anti-inflammatory drug which introduced to treat psoriatic arthritis. The contemporary experiment designed to study the protective influences of AP against LPS induced lung injury in rodents. Twenty-four (24) male experimental Wistar rats selected, acclimatized, and administered with normal saline, LPS, or AP + LPS respectively from 1 to 4 groups. The lung tissues were evaluated for biochemical parameters (MPO), Enzyme Linked Immunosorbent Assay (ELISA), flowcytometry assay, gene expressions, proteins expression and histopathological examination. AP ameliorates the lung injuries by attenuating immunomodulation and inflammation. LPS exposure upregulated IL-6, TNF-α, and MPO while downregulating IL-4 which were restored in AP pretreated rats. The changes in immunomodulation markers by LPS were reduced by AP treatment. Furthermore, results from the qPCR analysis represented an upregulation in IL-1β, MPO, TNF-α, and p38 whereas downregulated in IL-10 and p53 gene expressions in disease control animals while AP pretreated rats exhibited significant reversal in these expressions. Western blot analysis suggested an upregulation of MCP-1, and NOS-2, whereas HO-1, and Nrf-2 expression were suppressed in LPS exposed animals, while pretreatment with AP showed down regulation in the expression MCP-1, NOS-2, and upregulation of HO-1, and Nrf-2 expression of the mentioned intracellular proteins. Histological studies further affirmed the toxic influences of LPS on the pulmonary tissues. It is concluded that, LPS exposure causes pulmonary toxicities via up regulation of oxidative stress, inflammatory cytokines and stimulation of IL-1β, MPO, TNF-α, p38, MCP-1, and NOS-2 while downregulation of IL-4, IL-10, p53, HO-1, and Nrf-2 at different expression level. Pretreatment with AP controlled the toxic influences of LPS by modulating these signaling pathways.

1. Introduction

Acute Lung Injury (ALI) has been reported main cause of respiratory failure leading to death. ALI can be attributed due to direct injury (because of inhaled toxic substance reactions, or pneumonia), or may be via indirect damage i.e. ischemic and reperfusion states, condition of sepsis, instillation of gastric contents into respiratory tract, trauma, or sudden onset pancreatitis which cause states of unstable oxidative stress and lead to damage nucleic material and cause protein and lipid peroxidation (Park et al., 2018).

Lipopolysaccharide (LPS), an integrated component of gram negative bacterial cell wall, is pro-inflammatory, as LPS generates self-replicatory cascade of reactions on post stimulation of immune cells (monocytes/macrophages), which results generation of oxygen free radicals, and elevation on pro-inflammatory cytokine [tumor necrosis factor (TNF-α), interleukin-1β (IL-1β) and IL-6], that further worse the inflammation (Takeda and Akira, 2005, Cavaillon, 2017).

Toll like receptor (TLR-4) activation and it’s signaling transduction cause the generation of inflammatory mediators, translocate NF-kB and activate mitogen activated proton kinases (MAPK), which triggers inflammation after LPS exposure (Lin et al., 2017, Huang et al., 2020). Phosphotidylionositol-3 kinase (PI3K), protein kinase B (AKT) and mammalian target of rapamycin (mTOR) has been extensively studied and found confirmed modifier of TLR-4 / NF-kB signaling (Yip, 2015). This can significantly inversely affect cellular proliferation, immune reaction, and hinder apoptosis, anti-inflammatory cytokines suppression and degeneration of extracellular matrix proteins (Kany et al., 2019). Reactive oxygen free radicals found to affect significantly lung function and architect (Aprioku, 2013). Free radical neutralizing enzymes CAT, SOD, GPx and Nrf2/HO-1 signaling keeps the oxidative radicals checked and balanced (Ashok et al., 2022). Nrf2 plays cytoprotective and free radical scavenging properties on activation. In normal circumstances, Nrf2 remains complexed with kelch-like ECH related protein molecules (Ali et al., 2018). During the oxidative stress conditions, free Nrf-2 from the complex translocates in the nucleus and binds to antioxidant response element on DNA and causes genes expression which detoxify the toxic free radicals (He et al., 2020). HO-1 signal transduction mechanism causes heme breakdown and thus prevent granulocyte, monocytes and lymphocytes governed inflammatory reactions (Wu et al., 2019). Reactive oxygen free moieties and pro-inflammatory cytokine burst stimulate Nrf2 signaling and HO-1 expression (Saha et al., 2020). HO-1 plays a distinguished role in cytoprotection via Keap1/Nrf2/HO-1 signaling mechanism and restrict cytotoxicity mediated by oxidative stress and inflammatory mediators (Chiang et al., 2021).

LPS is well documented to cause strong inflammatory response (Dickson and Lehmann, 2019). Chemokines are chemoattractant of specific leucocyte that play pivotal role in inflammation. Monocyte chemoattractant protein-1 (MCP-1) which is pro-inflammatory protein and one of the most important studied chemokine, is the chemoattractant for monocytes, natural killer cells and T-lymphocytes (Gschwandtner et al., 2019). This chemokine has been well established to play role in numerous inflammatory reactions. The FDA approved Apremilast in 2014 as an orally selective PDE4 inhibitor that offers a novel approach to treating moderate to severe plaque psoriasis and psoriatic arthritis. As a result of PDE4 inhibition, apremilast inhibits the generation of pro-inflammatory and stimulaes the release of anti-inflammatory mediators, including tumour necrosis factor (TNF)-a, interleukin 1 beta (IL-1β), interleukin (IL)-23, and IL-4, IL-10, thereby reducing immune cell infiltration and inflammation in the lungs (Gottlieb et al., 2008, Schafer et al., 2010, Schafer, 2012). It is reported in a study that apremilast suppresses the infiltration of T lymphocytes, natural killer cells, and myeloid dendritic cells in psoriatic skin and reduces the expression of various interleukines (Gottlieb et al., 2013). Based on this cellular profile of inflammation we selected CD161+ T Cells, CD11b/c+ Cells and, CD161+ T Cells with CD11b/c+ Cells, for our study and analyzed the same by flowcytometry. Consequently, these inflammatory cells are also release inflammatory cytokines and chemokines. However, the mechanisms and therapeutic effects of apremilast in regulating inflammation and immunomodulation in these cells and in the treatment of lung injury remain unknown. Therefore, the present study was designed to explore the role of AP on LPS-induced immunomodulation and inflammation via modulation of Nrf2/HO-1 pathways in rat lungs.

2. Methods

2.1. Chemicals and reagents

All the materials used in this research were procured from different sources. Beging Mesochem Ltd. (Beiging, China) provided the apremilast, while Sigma Aldrich provided the LPS to induce-lung injury, Broadford reagent for protein measurement, and hematoxylin and eosin (H&E) for histological staining (St Louis, USA). EMD Millipore (Massachusetts, USA) provided ELISA kits for the biochemical assay. RBC Lysis Buffer (10X) and antibody for flow were obtained from BioLegend® Inc (SanDiego, CA). The mRNA gene expression primer, PCR Master Mix, High-capacity cDNA reverse transcription kits, and SYBR® Green were procured from Applied Biosystems (Paisley, UK). Life Technologies (Grand Island, USA) provided the TRIzol®. Santa Cruz (Dallas, USA) provided the primary and secondary antibodies used in the western blot study. PVDF blot transfer membrane (Immobilon®-FL) purchased from Merck Millipore Ltd. (Oakville, Canada) and Chemiluminescent HRP Substrate for Western blot identification kits was purchased from Millipore Corporation (Billerica, USA). All of the other chemicals used were analytical grade and came from commercial sources.

2.2. Animals

Male Wistar rats aged 8–10 weeks (weighing 200 ± 20 g) were received from the King Saud University's Experimental Animal Care Center in Riyadh, Saudi Arabia. The animals were kept in a controlled experimental condition, including a light/dark (12/12 h) cycle, relative humidity (45–55%), and temperature (23 ± 2 °C), as well as a standard chow diet and water ad libitum. All procedures were carried out in accordance with the approved protocol and the standard guidelines of King Saud University's institutional ethical council, as well as the ARRIVE guidelines.

2.3. Experimental design

A total of 24 male Wistar rats were chosen, acclimatized for seven days, and then randomly dispersed into four (n = 6) groups. Group 1 was defined as normal and was kept on a normal diet for the length of the experiment, as well as being given normal saline. At day seven, LPS (20 μg/50 μL solution/rats Intranasal) was administered to group 2 animals as disease controls. Group 3 and 4 animals were given apremilast (doses of 10 mg/kg and 20 mg/kg orally once a day for 7 days) and then subjected to the identical LPS exposure technique as group 2 animals on the seventh day (Imam et al., 2018, Imam et al., 2019).

At the termination of the experiment, blood samples were taken from the retro-orbital plexuses 12 h after the last treatment, and the animals were executed using the decapitation method. The rats' lungs were incised and blood stains were removed with ice cold phosphate buffer before being separated into sections for oxidative stress marker analysis, flowcytometry, mRNA expression, protein expression, and histopathological imaging under a light microscope. Except for histopathology samples, which were kept at room temperature until analysis, these tissue samples were kept at −70 °C until analysis. Whole blood was used for flowcytometry and remaining blood were used to separate serum for biochemical examination, blood samples from rats were centrifuged at 3000g for 10 min.

2.4. Methodology

The intervention was terminated after 12 h of apremilast dosing on day 7. Animals were sacrificed by spinal cord dislocation after blood samples were taken from the tail vein. The lungs tissue was collected under freezing condition followed by storage at −80 °C until analysis. Before store, each tissue was divided into 4-different sections for different types of analysis such as biochemical analysis, gene expression analysis, western analysis, and histopathological examination. Separate Eppendorf tubes were used to store tissue sample for different set of analysis.

2.5. Biochemical and molecular assay

The Myeloperoxidase (MPO) Activity was evaluated in the lung tissues, and an enzyme linked immunosorbent assay (ELISA) was used to determine interleukins IL-6, interleukins IL-4, and tumor necrosis factor-alpha (TNF-α). The CD161 and CD11b/c populations of WBCs from various samples were identified by using a flow cytometer. Real-Time Polymerase chain reaction (RT-PCR) was used to measure the mRNA expression of IL-10, IL-1β, MPO, TNF-α, p38, and p53 genes. Intracellular protein expressions for Monocyte chemoattractant protein-1 (MCP-1), nitric oxide synthase-2 (NOS-2), Heme oxigenase-1 (HO-1), and nuclear factor erythroid-2-related factor −2 (Nrf-2) documented by western blot analysis. Histopathological examination of the lung tissues done to attest the injuries caused by LPS and the protection by AP treatments.

2.5.1. Myeloperoxidase (MPO) activity

The development of lung injury, which is brought on by neutrophil infiltration into the lung, is associated with Myeloperoxidase (MPO). The rate of change in degradation of peroxide per unit time is an index of MPO activity. For MPO activity, lung tissue was homogenized and then homogenates were centrifuged at 1000g for 10 min, followed by centrifugation at 10,000g for 20 min. Now the supernatant (tissue extract) were collected in fresh Eppendorf tube for storage until analysis. MPO activity of lung tissue was measured by A modified method of Suzuki et al., (1983) in 96-well microtitre plates using 3,3′,5,5′ tetramethylbenzidine (TMB, Sigma, USA) and H2O2 of Scharlau (Sentmenat, Spain). Briefly, 10 µL blank or sample were added to the 96-well microtitre plate followed by addition of 80 µL 0.75 mM H2O2, and 110 µL TMB solutions, then plate was incubated at 37 °C for 5 min. The reactions were stopped by adding 50 µL of 2 M H2SO4. The optical density (OD) was recorded at 460 nm. One unit of MPO activity is defined as the volume of the supernatant that can degrade 1 µmol peroxide per minute at 37 °C.

2.6. Cytokines ELISA assays

The cytokine levels of IL-6, TNF-α, and IL-4 in serum sample were determined by ELISA (Millipore). ELISA kits were used to determine IL-6, TNF-α, and IL-4 using a 96-well plate (antibody-coated strip). Merkmillipore provides kits that are reliable for quantification of inflammatory markers such as IL-6, TNF-α, and IL-4. They were created with the goal of detecting inflammatory indicators. It has been analytically confirmed with ready-to-use reagents. The reagents and sample were prepared according to the manufacturer's instructions.

For these assay Matrix-C and Assay buffer–A were added to the antibody-coated strip wells containing standard and sample respectively. Plate content was discarded and cleaned after 2 h of incubation, then detection antibody was added, the plate was sealed, followed by incubation at 37 °C for 1 h with shaking. Discarded the contents, rinsed the plate, and filled each well with Avidin-HRP-A solution. Keep at 37 °C for 30 min on shaker after sealing the plate. After discarding the contents followed by washing the plate, and adding substrate solution F to each well, incubate in the dark for 10 min. The hue of the wells changed from green to blue, with the intensity corresponding to the concentration. The color of the solution changed to yellow after the stop solution was added to each well. Within 30 min, measure the absorbance at 450 nm.

2.7. Flow cytometry analysis

2.7.1. Whole blood preparation for flowcytometry

The immune modulatory effects of apremilast on LPS-induced lung injury were examined in the whole blood collected at the end of the study. In 15 ml of RBC lysis buffer (contains NH4Cl 150 mM, NaHCO3 10 mM, disodium EDTA 0.1 mM), 1 ml blood was added and kept on a rocker for 15 min for removing RBC and other component of blood in order to obtained pure WBC cells, samples were centrifuged at 800g for 10 min. The supernatant was discarded and the white blood cell pellet was resuspended in PBS at 1 ml volume. After that, we added anti-rat antibodies, 5 µL, CD161-PE and CD11b/c-FITC, to each sample, and kept them in dark for 15 min before flowcytometry analysis (Bajaña et al., 2016).

2.7.2. Determination of CD161+ T cells and CD11b/c+ Cells by flow cytometry

The CD161 and CD11b/c populations of WBCs from different samples were determined using a flow cytometer (Cytomics FC 500 by Beckman Coulter, CA, USA). The forward scatter-side scatter dot-plot was used to gate lymphocytes, monocytes, and granulocytes. FL1 (CD11b/c-FITC) and FL2 (CD161-PE) are two of the detection filters used. Data collection and analysis were performed using CXP-cytometer and CXP-Analysis Software V 3.0. Aminimum 10,000 cells were read at a flowrate of 15 µL/min (Bedoret et al., 2009).

2.8. Real time polymerase chain reaction (RT-PCR)

2.8.1. RNA extraction and cDNA synthesis (Sample preparation & RNA Isolation)

All of the extractions were performed on crushed ice with ice cold reagents. Total cellular RNA was isolated from lung tissue homogenates using Trizol reagent (Invitrogen, California, USA) as per manufacturer's instructions, and quantification done by measuring absorbance at 260 nm wave length. The 260/280 ratio (>2.0) was utilized to determine the quality and purity of the RNA before extraction. According to the manufacturer's recommendations, high-capacity cDNA reverse transcription kit from applied Biosystem (Paisley, UK) was utilized for cDNA synthesis.

In a nutshell, 1.25 g of total RNA from each sample was mixed with 2.0 L of 10X reverse transcription buffer, 0.8 L (100 mM) of 25X dNTP mix, 2.0 L of 10X reverse transcriptase random primers, 1.0 L of Multi-scribe reverse transcriptase, and 3.2 L of nuclease-free water. Lastly, the resulting mixture was maintained at ambient temperature for 10 min before being heated at 37 °C for 120 min, then at 85 °C for 5 min, and finally cooled at 4 °C (Al-Harbi et al., 2020).

2.8.2. cDNA synthesis

We employed quantitative PCR (qPCR) to compare the gene mRNA expression of oxidative stress markers, apoptosis markers and inflammatory/pro-inflammatory cytokines in lung tissue samples. Reverse transcription of extracted RNA into double-stranded complementary DNA (cDNA) using standard commercially available kits (RT Master mix) for cDNA synthesis were done according to manufacturer's instructions (Thermo Scientific). Prior to cDNA synthesis, DNase I (Fermentase) was employed to remove any remaining genomic DNA or DNA contamination from RNA samples. Finally, the cDNA was diluted in DEPC-treated water before being stored at −20 °C for subsequent analysis.

2.8.3. Quantification of mRNA expression in lung tissue via qPCR

The foremost steps in gene expression are sample preparation. The process starts with addition of 2.0 µl cDNA, 0.8 L 5 M forward primer, 0.8 L 5 M reverse primer, 5 L SYBR Green mix (containing dNTPs, thermostable hot-start DNA polymerase, and SYBR Green dye), and 1.8 L DEPC-treated water make up the qPCR mixture. The mRNA expression of IL-10, IL-1β, MPO, TNF-a, p38, and p53 gene were carried out. The forward and reverse primers were acquired from Integrated DNA Technologies in the United States and were chosen from PubMed and other databases (Table 1). Housekeeping genes were used to produce a normalization factor, which was then used to analyze the relative expression of each gene of interest per animal using GeNorm. We pipetted this mixture into each sample, and qPCR was performed using the Applied Biosystems (Paisley, UK). User Bulletin No. 2 is the second in a series of user bulletins. The fold change in expression of genes with respect to a reference standard is reported, and the data is corrected to an internal reference gene (GAPDH) (Imam et al., 2016).

Table 1.

Forward and Reverse primer sequence.

Gene Forward (5′ → 3′) Reverse (3′ → 5′)
ERK GCTGACCCTGAGCACGACCA CTGGTTCATCTGTCGGATCA
GST GCTTTACTGTGCAAGGGAGACA GGAAGGAGGATTCAAGTCAGGA
p38 GAGCGTTACCAGAACCTGTCTC AGTAACCGCAGTTCTCTGTAGGT
Akt 1 TGGACTACCTGCACTCGGAGAA GTGCCGCAAAAGGTCTTCATGG
p53 ACAGCGTGGTGGTACCGTAT GGAGCTGTTGCACATGTACT
β-actin CCAGATCATGTTTGAGACCTTCAA GTGGTACGACCAGAGGCATACA

2.9. Western blot analysis

For protein extraction, homogenization of a piece of lung tissue sample was done using protein lysis buffer including a protease inhibitor cocktail, and the bicinchoninic acid protein assay technique was employed for quantitative analysis of the protein sample before running western blot analysis, as previously described Lowery (Lowry et al., 1951, Al-Harbi et al., 2020). Simply put, 25–50 g samples from each group were loaded into a well of 10% SDS-polyacrylamide gel electrophoresis (10% SDS-PAGE) and segregated by electrophoresis, followed by electrophoresis to transfer the blot from the gel to a PVDF/nitrocellulose membrane (Bio-Rad, USA). After transfer, the membrane was submerged in blocking solution and rocked at 4 °C overnight before being incubated with mouse monoclonal primary antibodies against MCP-1, NOS-2 and HO-1, Nrf2 (Santa Cruz, USA). After blotting the membrane, it was washed three times with TBST before incubation with anti-mouse secondary peroxidase-conjugated antibodies at room temperature with rocking. The enhanced Chemiluminescence method was used to visualize bands using Immobilon Western Chemiluminescent HRP substrate purchased from Merck Millipore Ltd (Oakville, Canada), and the band was measured comparable to housekeeping protein standard (B-actin) bands using the ImageJ® image processing program (National Institute of Health, Bethesda, USA).

2.10. Histopathological evaluation

Lung tissue were excised and fixed in 10% formal saline (formalin) solution, decalcified with ethylenediamine tetraacetic acid in 5% formic acid, embedded in paraffin, and sectioned (3–4 μm). Staining of the cut section were done with 1% hematoxylin for 3 min, rinsed with distilled water then treated with 1% eosin in 90% alcohol for 1 min. Finally, slides were dried for histopathological examination by light microscopy. Alveolar destruction, vascular proliferation, and inflammatory cell infiltration were assessed.

2.11. Statistical analysis

All of the data in this study is presented as a mean S.E.M., with six animals in each group. One-way ANOVA was used for statistical analysis, accompanied by the Tukey’s multiple comparison post-hoc test. The significance of p < 0.05 was regarded statistically significant. *p < 0.05 when compared to the NC group; #p < 0.05 when compared to the LPS group. Graph Pad PRISM was used for statistical analysis (version 5.0; GraphPad software, La Jolla, CA, USA). At p < 0.05, substantial differences between the groups were evaluated.

3. Results

Inflammatory responses to lipopolysaccharides can result in infections, inflammation, tissue damage, and metabolic abnormalities. It has been demonstrated in the literature that exposing LPS to mammalian cells/tissue causes the release of pro-inflammatory cytokines, which can promote the formation of a variety of other inflammatory cascades, including tumor necrosis factor (TNF-α), interlukin-1 (IL-1β), reactive oxygen species (ROS), inducible NOS, and cyclooxygenase-2 (COX-2) (Tsukamoto et al., 2018). LPS-induced activation of many inflammatory responses has recently been linked to chronic obstructive pulmonary diseases (COPD), diabetes, neurological disorders, and osteoporosis, according to mounting evidence (Kim et al., 2016, Gomes et al., 2017). As a result, the goal of this study was to test whether AP has a protective effect against LPS-induced acute lung injury.

3.1. Changes in inflammatory biomarkers as a result of AP and LPS

Induction of inflammatory cascades by cellular responses to oxidative stress, whether in the cytosol or nucleoplasm, may contribute to therapeutic intervention. Because there was an evidence of airway inflammation, we looked at how AP affected the levels of pro-inflammatory (IL-6 and TNF-α) markers and anti-inflammation (IL-4) marker. To confirm the influence of AP on LPS-caused lung injury via improved pro-inflammatory/anti-inflammation cytokines levels were measured. As shown in Fig. 1, LPS exposure significantly increased production of cytokines IL-6 (Fig. 1A), TNF-α (Fig. 1B), and MPO activity (Fig. 1C), while decreased IL-4 levels (Fig. 1D) as compared to control group. However, AP treatment significantly inhibited production of pro-inflammatory cytokines, and stimulated release of anti-inflammatory compared with LPS treated group (p < 0.01). This suggests that’s, AP play an important role in inhibiting inflammation-mediated acute lung injury. The administration of LPS activated the release of IL-6, TNF-α, and enhanced MPO activity and suppressed IL-4 levels, resulting in neutrophil, lymphocyte, macrophage, and eosinophil infiltration, as confirmed by histological analysis.

Fig. 1.

Fig. 1

Effects of Apremilast (10, and 20 mg/kg) treatment on LPS-induced changes in pro-inflammatory cytokines such as (A) IL-6, (B) TNF-α, (C) MPO and anti-inflammatory like (D) IL-4, in acute lung injury model. MPO was analyzed biochemically but cytokine production (IL-6, TNF-α, and IL-4) was analyzed by ELISA to assess in all treated groups against LPS-induced ALI. LPS administration markedly increased the production of inflammatory cytokines in the LPS treated group, whereas Apremilast treatment markedly reduced inflammatory cytokines. All data are expressed as the mean ± standard error of the mean (n = 6). One-way Analysis of Variance (ANOVA) was performed followed by Tukey-Kramer's multiple comparison test to compare group means. The levels of significance were determined by *p < 0.05 compared to control group; #p < 0.05 as compared to LPS-treated group.

3.2. Changes in CD161+ T Cells, CD11b/c+ Cells and immune cells population

The lung exchanges gases during respiration, thereby increased the risk of exposure to pathogens or/and toxicants, which may cause inflammation and lung tissue damage. Several subsets of DCs that perform various tasks make up the lung's DC population. Lung DCs can be generally split into three main categories: plasmacytoid DCs (pDCs), conventional DCs, and other subsets (cDCs). cDC1s and cDC2s, respectively, are other names for DCs and CD11b+ DCs (Izumi et al., 2021). Our results showed that administration of LPS resulted a significantly decreased in CD161+ T Cells population while increased in CD11b/c+ Cells and Immune Cells (Dendritic Cells, natural killer cell moncyte/macrophage) population as compared to control group. Treatment with AP resulted increased in CD161+ T Cells population whereas significantly decrease in CD11b/c+ Cells and immune cells population (Fig. 2).

Fig. 2.

Fig. 2

Fig. 2

Effects of Apremilast (10, and 20 mg/kg) treatments on LPS-induced changes in (A) CD161+ T Cells, (B) CD11b/c+ Cells and, (C) CD161+ T Cells with CD11b/c+ Cells in acute lung injury model analyzed by flow cytometry. The administration of LPS significantly enhanced the release of CD11b/c+ Cells and decreased CD 161+ T-Cells in the toxic group, however, treatment with AP treatment resulted dramatic reversal in theses markers. All data are expressed as the mean ± standard error of the mean (n = 4). One-way Analysis of Variance (ANOVA) was performed followed by Tukey-Kramer's multiple comparison test to compare group means. The levels of significance were determined by *p < 0.05 compared to control group; #p < 0.05 as compared to LPS-treated group.

3.3. Changes in mRNA expression of IL-10, IL-1β, MPO, TNF-a, p38, and p53 gene

Damage to the lung tissue caused by LPS generates changes in oxidative stress parameters and the release of inflammatory mediators. Based on the data above, AP suppressed oxidant levels as well as pro-inflammatory cytokines, resulting in increased anti-oxidant levels and enhanced pro-inflammatory responses. Thus, here we investigated the possible molecular signaling involved in ROS production and inflammation. The ROS production level as well as pro-inflammatory cytokines were elevated in the LPS-treated group, which were reversed by the AP treatment. Therefore, in order to determine whether AP reduces acute lung injury caused by LPS, we performed RT-PCR to evaluate mRNA expression of IL-10, IL-1β, MPO, TNF-a, p38, and p53 gene.

In this work, we discovered that administering LPS causes a rise in IL-1β (Fig. 3B), MPO (Fig. 3C), TNF-α (Fig. 3D), and p38 (Fig. 3E) whereas, a marked decrease in IL-10 (Fig. 3A), and p53 (Fig. 3F) gene expression were reported as compared to control group. IL-1β, MPO, TNF-a, and p38 mRNA expression were supressed by AP treatment in response to LPS whereas IL-10, and p53 expression were enhanced. Downstream effectors were not measured. As a result, additional research is required to confirm our findings. Treatment with AP dramatically decreased IL-1β, MPO, TNF-a, and p38 while considerably increased IL-10, and p53 mRNA expression (Fig. 3).

Fig. 3.

Fig. 3

Effects of Apremilast (10, and 20 mg/kg) treatment on LPS-induced changes in mRNA expression of genes such as (A) IL-10, (B) IL-1β, (C) MPO, (D) TNF-α, (E) p38, and (F) p53 in acute lung injury model. To evaluate changes in cytokines production and molecular signaling pathways against LPS-induced ALI, gene expression studies were carried out in all treated groups. LPS administration markedly increased the production of inflammatory cytokines in the negative control group, but Apremilast treatment ameliorated these inflammatory cytokines dramatically. All data are expressed as the mean ± standard error of the mean (n = 6). One-way Analysis of Variance (ANOVA) was performed followed by Tukey-Kramer's multiple comparison test to compare group means. The levels of significance were determined by *p < 0.05 compared to control group; #p < 0.05 as compared to LPS-treated group.

3.4. Changes in protein expression of HO-1, MCP-1, NOS 2, and Nrf-2 in lung tissue

LPS causes lung tissue damage, which has been linked to oxidative stress and pro-inflammatory changes. Gene expression for molecular signaling pathways has also validated these findings. The inflammatory response and the production of reactive oxygen species (ROS) were found to be activated and substantially increased by LPS. As a result, we performed western blot analysis to further investigate the role of oxidative stress and pro-inflammatory cytokines mediated by HO-1/Nrf2 signaling pathways to corroborate the effect of AP in reducing LPS-induced acute lung injury at the protein expression level. In this study, we discovered that LPS injection increases MCP-1, and NOS 2 protein expression while significantly decreased HO-1, and Nrf-2 protein expression as compared to control group. AP treatment suppressed LPS-induced activation of MCP-1, and NOS 2 whereas suppressed LPS-activated HO-1, and Nrf-2 protein expression (Fig. 4). A mouse monoclonal anti-mouse β-actin antibody was used to confirm equal loading between samples on immunoblots.

Fig. 4.

Fig. 4

Fig. 4

Effects of Apremilast (10, and 20 mg/kg) treatment on LPS-induced changes in protein expression of (A), MCP-1, (B) NOS 2, (C) HO-1, and (D) Nrf2, analyzed in acute lung injury model. Western blot analysis was performed to determine protein expression with LPS-induced ALI in all treatment groups. LPS administration resulted change in protein expression between the groups. Apremilast treatment showed improvement in the protein expression of these marker. All data are expressed as the mean ± standard error of the mean (n = 6). One-way Analysis of Variance (ANOVA) was performed followed by Tukey-Kramer's multiple comparison test to compare group means. The levels of significance were determined by *p < 0.05 compared to control group; #p < 0.05 as compared to LPS-treated group.

3.5. Changes in lungs histopathological as a result of AP and LPS

LPS-induced acute lung injury causes stimulation of monocytes to produce both proinflammatory mediators and proteins that counteract inflammation and oxidative stress. In our study it has been demonstrated that LPS administration causes damages lung tissue structurally and histologically due to relaese of pro-inflammatory mediators and oxidative stresss. To explore if AP could protect against LPS-induced lung injury by reducing airway inflammation. As a result, we used H&E staining for histological studies to confirm. In comparison to the control group (Fig. 5A), LPS administration resulted in acute inflammatory changes, including plasma cells in neutrophils, lymphocytes, and macrophages, thickened septa caused by inflammation, alveolus, alveolar septae (thickened, inflammation, fibrosis), and inflammatory cells in pulmonary vessels (Fig. 5B). In comparison to the control, lymphoid follicles containing the germinal center, histiocytes, and macrophages were also visible.

Fig. 5.

Fig. 5

Effects of Apremilast (10, and 20 mg/kg) treatment on LPS-induced oxidative stress and inflammatory changes in lungs architecture or histology of different experimental groups. (A) Control; (B–C) LPS (50 µg/20 µL); (D) LPS (50 µg/20 µL) + AP (10 mg/kg); and (E) LPS (50 µg/20 µL) + AP (20 mg/kg) mg/kg. The processing of the thin section of lung tissues was done by microtome using hematoxylin and eosin staining. (Magnification: 40X; n = 6 per group). (Arrow (Inline graphic) = Alveolar septae; Empty pentagon (Inline graphic) = Alveolus; Filled pentagon (Inline graphic) = Bronchiole; Circle: (Inline graphic)  = Pulmonary vessel)

The normal lung histological can no longer be observed due to extensive inflammation caused primarily by macrophages. AP pretreatment was used to normalize these alterations. The alveolar septae in the AP treated group were normal, with no signs of inflammation or fibrosis. Bronchiole and pulmonary vesicles were found to be normal in the AP groups (Fig. 5C and D). The inflammatory response was found to be greatly reduced after AP treatment. As a result, the above findings suggest that AP protects against LPS-induced acute lung injury.

4. Discussion

Lipopolysaccharides (LPS) has been an experimental toxicant used since long to induce Acute lung injury (ALI) in various experimental models and extensively evaluated for its mechanism to induce ALIs (Chung and Mueller, 2011). ALI is a serious respiratory condition characterized by leukocyte infiltration in the bilateral lungs, hypoxia and noncardiac pulmonary edema and is linked to high morbidity and mortality (Kooy et al., 1994). Results of the experiment conducted supports the protective influences of AP in LPS-induced ALI.

Neutrophil infiltration in inflamed lung is a hallmark of ALI. There are numerous pathogenic factors that damage lung tissue directly by activating neutrophils. Activated neutrophils trigger oxidative stress, release proteases, and form neutrophil extracellular traps (NETs), resulting in lung damage (Abraham, 2003). In this study, administration of LPS resulted in significantly increased release of pro-inflammatory markers and considerably reduced anti-inflammatory markers release. Conversely, AP treatment significantly downregulated pro-inflammatory markers, and MPO activity, whereas IL-4 was significantly enhanced. ALI is caused by neutrophil activation and the release of reactive oxygen species (ROS) as part of an inflammatory response as signified by increased MPO activity (Hecker et al., 2012). Our findings showed that AP suppressed the release of inflammatory cytokines, implying that AP reduced LPS-induced lung inflammation by decreasing the production of pro-inflammatory mediators. ALI causes damage to the lung airway barrier, increases the permeability of alveolar epithelial cells and endothelial cells, aggregates PMNs, and adversely affects oxygen delivery (Jansson et al., 2004). Consequently, neutrophil activation in the lungs contributes to the release of pro-inflammatory mediators and cytokines, which interact to form an intricate cytokine network, lead to an excessive inflammatory response in the lungs and an imbalanced inflammatory response throughout the body (Puneet et al., 2005). The study of ALI has become increasingly concerned about restoring the balance between pro-inflammatory and anti-inflammatory cytokines, regulating their release, and blocking the release of inflammatory markers (Hocaoglu et al., 2012). The release of TNF-α in the lungs is associated with neutrophil migration, pulmonary endothelial cell activation, capillary permeability, and granulocyte degranulation and interact to form an intricate cytokine network. An essential lymphokine called IL-6 plays a role in the immune response by stimulating and controlling immune cells (Triantafyllou et al., 2018). According to Triantafyllou et al. (2018), when IL-6 is overexpressed, it facilitates the chemotaxis of inflammatory components, exacerbates the waterfall-like inflammatory response, and eventually causes lung tissue damage. Anti-inflammatory cytokines have antagonistic effects that might reduce the inflammatory response (Wang et al., 2015). The results from this study showed that a significantly increased in IL-6, TNF-α levels, and increased MPO activity after LPS administration refers to acute inflammatory changes in the lungs which were significantly reversed by treatment with AP. Studies have shown that pro-inflammatory cytokines including IL-6, TNF-α, and MPO activity are enhanced in the injured lungs (DiStasi and Ley, 2009). The inflammatory response to acute tissue injury is mostly mediated by IL-1β, IL-6, TNF-α, and other inflammatory factors (Chalasani et al., 2008). Researchers postulated that LPS upregulate lymphocytes, neutrophils, and macrophages, leading to the production and release of pro-inflammatory cytokines, which are the main contributors to inflammation, and their activation is a key to accelerate disease progression (Noack and Miossec, 2014, Dong and Yuan, 2018, Li et al., 2019, Tsai et al., 2022). Thus, occurrence and development of acute lung injury are strongly influenced by inflammation. Finding of our study suggest that LPS induced higher expression of these pro-inflammatory cytokines, this is in line to previous research outcomes in ALI caused by LPS (Pasarica et al., 2009, Xu et al., 2010).

ALI triggers a number of immunological reactions since the liver can't eliminate endotoxin efficiently. Kupffer cells, which have the most macrophages in the body, generate a lot of inflammatory cytokines like TNF-α, IL-1β, and IL-6, which have a role in lung injury. The result of the TNF-α cascade reaction, IL- 1β is the most potent inflammatory factor in the body. It is also a key facilitator of the immunological and inflammatory response, encouraging the synthesis of pro-inflammatory cytokines and inducing cellular immune responses. We have observed that the transcripts of IL1β, MPO, TNFα, and p38 were increased while IL-10, and p53 were decreased after LPS treatment; however, the addition of AP significantly restores the expression of these genes and in accordance with other studies (Dong and Xue, 2010, Luedde and Schwabe, 2011, Zhao et al., 2017). The above-mentioned outcomes highlight the significant contribution of AP in the modulation of the inflammatory response. The p38 and p53 signaling pathways were further studied in lung tissue samples treated with LPS to determine if they were involved in ROS production. As reported earlier, the production of ROS is greatly influenced by p38 (Lan et al., 2011). Similarly, in our study, we found that phosphorylated p38 was markedly enhanced by LPS treatment, which was reduced by AP administration. The data above indicated that AP could reduce ROS production, which was related to p38 mediated signaling pathway inactivation. Additionally, the p38 pathway plays an important role in ROS production (Sun et al., 2012, Chouchani et al., 2014)]. Interestingly, AP inhibited ROS production significantly. In summary, our data demonstrated that AP suppressed p38 signaling during LPS-induced acute lung injury.

Monocyte chemoattractant protein 1 (MCP-1), is reported to plays a critical role in leukocyte migration to the site of infection and inflammation. Several studies have published about the role of MCP-1 in regulating lung inflammation, and concluding that MCP-1 is a pro-inflammatory mediator during lung inflammation induced by LPS administration. In addition, MCP-1 may help to reduce inflammation by attenuate release of pro-inflammatory cytokines (Moncada et al., 1991). IL-6 and TNF-α can stimulate the release of other cytokines, MCP-1, macrophage chemotactic protein, and neutrophil chemoattractants (Gosain and Gamelli, 2005). The enzyme nitric oxide synthase (NOS) present on the cell surface of varied tissues is used to synthesize nitric oxide (NO), a bioactive molecule in immunocompetent cells such as macrophages. It has numerous physiological and pathological functions (Geller et al., 1993, Nathan and Xie, 1994). NOS-2 activation is triggered by inflammatory stimuli such as bacterial lipopolysaccharide (LPS) and pro-inflammatory cytokines such as tumor necrosis factor alpha (TNF-α), interleukin-1 (IL-1β), and interferon (IFN-γ) following bacterial infection (Li et al., 2014). In murine hepatocytes and transformed cells, Nrf2 is a key transcription factor that regulates cytoprotective genes (Kusunoki et al., 2013). It binds to the ARE and nuclear translocation is an important mechanism for activating Nrf2.

There is considerable evidence that oxidative stress induced inflammation contributes to the progression of many diseases (Kah et al., 2014). Furthermore, phase II detoxifying enzymes, such as HO-1, are also effective antioxidant enzymes (Staitieh et al., 2017). It has been reported that LPS stimulates HO-1 expression in monocytes and macrophages (Immenschuh et al., 1999, van Zoelen et al., 2011). It is encoded by the HMOX1 gene and it is responsible for converting haeme into the prooxidant biliverdin, which is subsequently transformed into bilirubin, a potent antioxidant (Valavanidis et al., 2013). It is reported that LPS downregulates the production of HO-1. It contains antioxidant-response elements (AREs) that bind to the transcription factor Nrf2 in its 5′-untranslated region. NRF2, a key regulator of the antioxidant defense system, protects cells from oxidative damage (Inoue, 2011). HO-1 and Nrf2 were found to be downregulated in LPS-treated groups, which was reversed by AP treatment. It is also reported that antioxidant enzyme levels increased in the group treated with apremilast. Consequently, ROS generation decreased due to decreased NOS-2 levels after AP treatment, leading to an increase in antioxidant expression via Nrf-2/HO-1 signaling pathways. In this study, similar results were observed, displaying a correlation between anti-oxidant, and ROS levels (Staitieh et al., 2017).

ALI is characterized by a dysregulated inflammatory response induced by LPS. T-cells in the lung play a crucial role in triggering inflammatory cascades and stimulate T-cells differentiation under the control of dendritic cells (DCs). There are various types of DCs in the lung that perform various tasks. Because typical CD11b+ DCs (cDC2) are diverse, it is still unclear how dendritic cells (DC) in the lung stimulate T cells differentiation. Here, we present data on a population of cDCs that quickly builds up in the lungs following LPS inhalation. In the present study results indicate that administration of LPS resulted a significantly decreased in CD161+ T Cells population and increased in CD11b/c+ Cells (Dendritic Cells, natural killer cell and moncyte/macrophage population) as compared to control group which were reversed by AP treatment. Findings of our study are in aggreement with erlier reports which suggest that AP significantly decreased superoxide anion production, reactive oxygen species generation, cluster of differentiation CD 11b expression and neutrophils adhesion (Schwartz et al., 2010). Another reports suggesting that LPS-induced acute lung inflammation and injury was modulated by pulmonary immune cells through neutrophil infiltration and Th1/Th2 balance (Koinzer et al., 2015).

Lung deterioration, fractured parenchyma, and protoplasmic vacuoles are confirmed by histological investigation reports of alveolar tissue in the LPS group. Hypochromatic cell clusters, pyknotic nuclei, and immune cell infiltrates were found throughout the lung tissues. Earlier studies found nearly identical histology findings in LPS-related lung damage (Soromou et al., 2012). The morphological and structural alterations in lung tissue caused by LPS exposure were restored in a promising way by AP therapy. The animal treated with AP had its lung parenchymal structural alterations repaired.

5. Conclusion

From the above finding, it can be concluded that immunomodulation and inflammatory play a critical role in LPS-induced acute pulmonary injuries, and AP can reverse these injuries by preventing immunomodulation and inflammation via Nrf-2/HO-1 signaling.

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgements

The present work was funded by King Saud University, Deanship of Scientific Research, College of Pharmacy (Project No. RGP-VPP-305). The authors acknowledge the Department of Pharmacology and Toxicology, College of Pharmacy, King Saud University for its facilities.

References

  1. Abraham E. Neutrophils and acute lung injury. Crit. Care Med. 2003;31(4 Suppl):S195–S199. doi: 10.1097/01.CCM.0000057843.47705.E8. PMID: 12682440. [DOI] [PubMed] [Google Scholar]
  2. Al-Harbi N.O., Imam F., Alharbi M.M., Khan M.R., Qamar W., Afzal M., Algahtani M., Alobaid S., Alfardan A.S., Alshammari A., Albekairi T.H., Alharbi K.S. Role of rivaroxaban in sunitinib-induced renal injuries via inhibition of oxidative stress-induced apoptosis and inflammation through the tissue nacrosis factor-α induced nuclear factor-κappa B signaling pathway in rats. J. Thromb. Thrombolysis. 2020;50(2):361–370. doi: 10.1007/s11239-020-02123-6. PMID: 32358665. [DOI] [PubMed] [Google Scholar]
  3. Ali S.S.Z., Deming Z., Tariq H., Naveed S., Hussain M.M., Lifeng Y. p62-Keap1-NRF2-ARE pathway: A contentious player for selective targeting of autophagy, oxidative stress and mitochondrial dysfunction in prion diseases. Front. Mol. Neurosci. 2018;11 doi: 10.3389/fnmol.2018.00310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Aprioku J.S. Pharmacology of free radicals and the impact of reactive oxygen species on the testis. J. Reprod. Infertil. 2013;14(4):158–172. [PMC free article] [PubMed] [Google Scholar]
  5. Ashok A., Andrabi S.S., Mansoor S., Kuang Y., Kwon B.K., Labhasetwar V. Antioxidant therapy in oxidative stress-induced neurodegenerative diseases: Role of nanoparticle-based drug delivery systems in clinical translation. Antioxidants. 2022;11:408. doi: 10.3390/antiox11020408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bajaña S., Turner S., Paul J., Ainsua-Enrich E., Kovats S. IRF4 and IRF8 act in CD11c+ cells to regulate terminal differentiation of lung tissue dendritic cells. J. Immunol. 2016;196(4):1666–1677. doi: 10.4049/jimmunol.1501870. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bedoret D., Wallemacq H., Marichal T., Desmet C., Quesada Calvo F., Henry E., Closset R., Dewals B., Thielen C., Gustin P., de Leval L., Van Rooijen N., Le Moine A., Vanderplasschen A., Cataldo D., Drion P.V., Moser M., Lekeux P., Bureau F. Lung interstitial macrophages alter dendritic cell functions to prevent airway allergy in mice. J. Clin. Invest. 2009;119(12):3723–3738. doi: 10.1172/JCI39717. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cavaillon J.M. Exotoxins and endotoxins: Inducers of inflammatory cytokines. Toxicon. 2017;149:45–53. doi: 10.1016/j.toxicon.2017.10.016. [DOI] [PubMed] [Google Scholar]
  9. Chalasani N., Fontana R.J., Bonkovsky H.L., Watkins P.B., Davern T., Serrano J., Yang H., Rochon J. Drug Induced Liver Injury Network (DILIN). Causes, clinical features, and outcomes from a prospective study of drug-induced liver injury in the United States. Gastroenterology. 2008;135(6):1924–1934. doi: 10.1053/j.gastro.2008.09.011. Epub 2008 Sep 17. PMID: 18955056; PMCID: PMC3654244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chiang Shih-Kai, et al. The role of HO-1 and its crosstalk with oxidative stress in cancer cell survival. Cells. 2021;10(9):2401. doi: 10.3390/cells10092401. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chouchani E.T., Pell V.R., Gaude E., Aksentijević D., Sundier S.Y., Robb E.L., Logan A., Nadtochiy S.M., Ord E.N., Smith A.C., et al. Ischaemic accumulation of succinate controls reperfusion injury through mitochondrial ROS. Nature. 2014;515:431–435. doi: 10.1038/nature13909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Chung F., Mueller D. Physical therapy management of ventilated patients with acute respiratory distress syndrome or severe acute lung injury. Physiother. Can. 2011;63:191–198. doi: 10.3138/ptc.2010-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Dickson K., Lehmann C. Inflammatory response to different toxins in experimental sepsis models. Int. J. Mol. Sci. 2019;20(18):4341. doi: 10.3390/ijms20184341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. DiStasi M.R., Ley K. Opening the flood-gates: how neutrophil-endothelial interactions regulate permeability. Trends Immunol. 2009;30:547–556. doi: 10.1016/j.it.2009.07.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Dong L.Y., Xue C.R. Expression of Hepatic IKK-β in chronic pancreatitis rat model and intervening effect of medicine. Chin. J. Surg. Integr. Tradit. West. Med. 2010;16:337–340. doi: 10.3969/j.issn.1007-6948.2010.03.029. [DOI] [Google Scholar]
  16. Dong Z., Yuan Y. Accelerated inflammation and oxidative stress induced by LPS in acute lung injury: Ιnhibition by ST1926. Int. J. Mol. Med. 2018;41(6):3405–3421. doi: 10.3892/ijmm.2018.3574. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Geller D.A., Nussler A.K., Di Silvio M., Lowenstein C.J., Shapiro R.A., Wang S.C., Simmons R.L., Billiar T.R. Cytokines, endotoxin, and glucocorticoids regulate the expression of inducible nitric oxide synthase in hepatocytes. Proc. Natl. Acad. Sci. U. S. A. 1993;90(2):522–526. doi: 10.1073/pnas.90.2.522. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Gomes J.M.G., Costa J.A., Alfenas R.C.G. Metabolic endotoxemia and diabetes mellitus: A systematic review. Metabolism. 2017;68:133–144. doi: 10.1016/j.metabol.2016.12.009. Epub 2016 Dec 18 PMID: 28183445. [DOI] [PubMed] [Google Scholar]
  19. Gosain A., Gamelli R.L. A primer in cytokines. J. Burn Care Rehabil. 2005;26:7–12. doi: 10.1097/01.bcr.0000150214.72984.44. [DOI] [PubMed] [Google Scholar]
  20. Gottlieb A.B., Strober B., Krueger J.G., Rohane P., Zeldis J.B., Hu C.C., et al. An open-label, single-arm pilot study in patients with severe plaque-type psoriasis treated with an oral anti-inflammatory agent, apremilast. Curr. Med. Res. Opin. 2008;24:1529e38. doi: 10.1185/030079908x301866. [DOI] [PubMed] [Google Scholar]
  21. Gottlieb A.B., Matheson R.T., Menter A., Leonardi C.L., Day R.M., Hu C., et al. Efficacy, tolerability, and pharmacodynamics of apremilast in recalcitrant plaque psoriasis: a phase II openlabel study. J. Drugs Dermatol. 2013;12:888e97. [PubMed] [Google Scholar]
  22. Gschwandtner M., Derler R., Midwood K.S. More than just attractive: How CCL2 influences myeloid cell behavior beyond chemotaxis. Front. Immunol. 2019;13(10):2759. doi: 10.3389/fimmu.2019.02759. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. He F., Ru X., Wen T. NRF2, a transcription factor for stress response and beyond. Int. J. Mol. Sci. 2020;21:4777. doi: 10.3390/ijms21134777. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Hecker M., Weigand M.A., Mayer K. Acute respiratory distress syndrome. Internist (Berl) 2012;53:557–566. doi: 10.1007/s00108-012-3018-5. [DOI] [PubMed] [Google Scholar]
  25. Hocaoglu C., Kural B., Aliyazıcıoglu R., Deger O., Cengiz S. IL-1β, IL-6, IL-8, IL-10, IFN-γ, TNF-α and its relationship with lipid parameters in patients with major depression. Metab. Brain Dis. 2012;27:425–430. doi: 10.1007/s11011-012-9323-9. [DOI] [PubMed] [Google Scholar]
  26. Huang C.Y., Deng J.S., Huang W.C., Jiang W.P., Huang G.J. Attenuation of lipopolysaccharide-induced acute lung injury by hispolon in mice, through regulating the TLR4/PI3K/Akt/mTOR and Keap1/Nrf2/HO-1 pathways, and suppressing oxidative stress-mediated ER stress-induced apoptosis and autophagy. Nutrients. 2020;12:1742. doi: 10.3390/nu12061742. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Imam F., Al-Harbi N.O., Al-Harbi M.M., Ansari M.A., Almutairi M.M., Alshammari M., Almukhlafi T.S., Ansari M.N., Aljerian K., Ahmad S.F. Apremilast reversed carfilzomib-induced cardiotoxicity through inhibition of oxidative stress, NF-κB and MAPK signaling in rats. Toxicol. Mech. Methods. 2016;26(9):700–708. doi: 10.1080/15376516.2016.1236425. [DOI] [PubMed] [Google Scholar]
  28. Imam F., Al-Harbi N.O., Al-Harbi M.M., Ansari M.A., Al-Asmari A.F., Ansari M.N., Al-Anazi W.A., Bahashwan S., Almutairi M.M., Alshammari M., Khan M.R., Alsaad A.M., Alotaibi M.R. Apremilast prevent doxorubicin-induced apoptosis and inflammation in heart through inhibition of oxidative stress mediated activation of NF-κB signaling pathways. Pharmacol. Rep. 2018;70(5):993–1000. doi: 10.1016/j.pharep.2018.03.009. Epub 2018 Mar 29. Erratum in: Pharmacol Rep. 2019 Dec;71(6):1227. PMID: 30118964. [DOI] [PubMed] [Google Scholar]
  29. Imam F., Al-Harbi N.O., Al-Harbi M.M., Qamar W., Aljerian K., Belali O.M., Alsanea S., Alanazi A.Z., Alhazzani K. Apremilast ameliorates carfilzomib-induced pulmonary inflammation and vascular injuries. Int. Immunopharmacol. 2019;66:260–266. doi: 10.1016/j.intimp.2018.11.023. Epub 2018 Nov 28 PMID: 30500623. [DOI] [PubMed] [Google Scholar]
  30. Immenschuh S., Stritzke J., Iwahara S., Ramadori G. Up-regulation of heme-binding protein 23 (HBP23) gene expression by lipopolysaccharide is mediated via a nitric oxide-dependent signaling pathway in rat Kupffer cells. Hepatology. 1999;30(1):118–127. doi: 10.1002/hep.510300142. [DOI] [PubMed] [Google Scholar]
  31. Inoue M. Raven Press; New York: 2011. Protective mechanisms against reactive oxygen species., in The liver: biology and pathobiology. [Google Scholar]
  32. Izumi G., Nakano H., Nakano K., Whitehead G.S., Grimm S.A., Fessler M.B., Karmaus P.W., Cook D.N. CD11b+ lung dendritic cells at different stages of maturation induce Th17 or Th2 differentiation. Nat. Commun. 2021;12:5029. doi: 10.1038/s41467-021-25307-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Jansson A.H., Eriksson C., Wang X. Lung inflammatory responses and hyperinflation induced by an intratracheal exposure to lipopolysaccharide in rats. Lung. 2004;182(3):163–171. doi: 10.1007/s00408-004-1803-1. PMID: 15526755. [DOI] [PubMed] [Google Scholar]
  34. Kah J., Volz T., Lütgehetmann M., Dandri M. Hemoxygenase-1 and its downstream product Biliverdin suppress HCV replication and provides hepatoprotective effects in humanized uPA/SCID mice. Z. Gastroenterol. 2014;52:5–17. [Google Scholar]
  35. Kany S., Vollrath J.T., Relja B. Cytokines in Inflammatory Disease. Int. J. Mol. Sci. 2019;20(23):6008. doi: 10.3390/ijms20236008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Kim Y.K., Na K.S., Myint A.M., Leonard B.E. The role of pro-inflammatory cytokines in neuroinflammation, neurogenesis and the neuroendocrine system in major depression. Prog. Neuropsychopharmacol. Biol. Psychiatry. 2016;4(64):277–284. doi: 10.1016/j.pnpbp.2015.06.008. [DOI] [PubMed] [Google Scholar]
  37. Koinzer S., Reinecke K., Herdegen T., Roider J., Klettner A. Oxidative stress induces biphasic ERK1/2 activation in the RPE with distinct effects on cell survival at early and late activation. Curr. Eye Res. 2015;40:853–857. doi: 10.3109/02713683.2014.961613. [DOI] [PubMed] [Google Scholar]
  38. Kooy N.W., Royall J.A., Ischiropoulos H., Beckman J.S. Peroxynitrite-mediated oxidation of dihydrorhodamine 123. Free Radic. Biol. Med. 1994;16(2):149–156. doi: 10.1016/0891-5849(94)90138-4. PMID: 8005510. [DOI] [PubMed] [Google Scholar]
  39. Kusunoki C., Yang L., Yoshizaki T., Nakagawa F., Ishikado A., Kondo M., Morino K., Se Kine O., Ugi S., Nishio Y., et al. Omega-3 polyunsaturated fatty acid has an anti-oxidant effect via the Nrf-2/HO-1 pathway in 3T3-L1 adipocytes. Biochem. Biophys. Res. Commun. 2013;430:225–230. doi: 10.1016/j.bbrc.2012.10.115. [DOI] [PubMed] [Google Scholar]
  40. Lan A., Liao X., Mo L., Yang C., Yang Z., Wang X., Hu F., Chen P., Feng J., Zheng D., Xiao L. Hydrogen sulfide protects against chemical hypoxia-induced injury by inhibiting ROS-activated ERK1/2 and p38MAPK signaling pathways in PC12 cells. PLoS One. 2011;6(10):e25921. doi: 10.1371/journal.pone.0025921.x. Epub 2018 Mar 29. Erratum in: Pharmacol Rep. 2019 Dec;71(6):1227. PMID: 30118964. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Li L., Dong L., Zhao D., Gao F., Yan J. Classical dendritic cells regulate acute lung inflammation and injury in mice with lipopolysaccharide-induced acute respiratory distress syndrome. Int. J. Mol. Med. 2019;44(2):617–629. doi: 10.3892/ijmm.2019.4208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Li Y.W., Zhang Y., Zhang L., Li X., Yu J.B., Zhang H.T., Tan B.B., Jiang L.H., Wang Y.X., Liang Y., et al. Protective effect of tea polyphenols on renal ischemia/reperfusion injury via suppressing the activation of TLR4/NF-κB p65 signal pathway. Gene. 2014;542:46–51. doi: 10.1016/j.gene.2014.03.021. [DOI] [PubMed] [Google Scholar]
  43. Lin W.C., Deng J.S., Huang S.S., Wu S.H., Chen C.C., Lin W.R., Lin H.Y., Huang G.J. Anti-Inflammatory Activity of Sanghuangporus Sanghuang Mycelium. Int. J. Mol. Sci. 2017;18:347. doi: 10.3390/ijms18020347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Lowry O.H., Rosebrough N.J., Farr A.L., Randall R.J. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 1951;193(1):265–275. PMID: 14907713. [PubMed] [Google Scholar]
  45. Luedde T., Schwabe R.F. NF-κB in the liver–linking injury, fibrosis and hepatocellular carcinoma. Nat. Rev. Gastroenterol. Hepatol. 2011;8(2):108–118. doi: 10.1038/nrgastro.2010.213. PMID: 21293511; PMCID: PMC3295539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Moncada S., Palmer R.M., Higgs E.A. Nitric oxide: physiology, pathophysiology, and pharmacology. Pharmacol. Rev. 1991;43(2):109–142. PMID: 1852778. [PubMed] [Google Scholar]
  47. Nathan C., Xie Q.W. Nitric oxide synthases: roles, tolls, and controls. Cell. 1994;78(6):915–918. doi: 10.1016/0092-8674(94)90266-6. PMID: 7522969. [DOI] [PubMed] [Google Scholar]
  48. Noack M., Miossec P. Th17 and regulatory T cell balance in autoimmune and inflammatory diseases. Autoimmun. Rev. 2014;13:668–677. doi: 10.1016/j.autrev.2013.12.004. [DOI] [PubMed] [Google Scholar]
  49. Park J., Chen Y., Zheng M., Ryu J., Cho G.J., Surh Y.J., Sato D., Hamada H., Ryter S.W., Kim U.H., Joe Y., Chung H.T. Pterostilbene 4'-β-Glucoside Attenuates LPS-Induced Acute Lung Injury via Induction of Heme Oxygenase-1. Oxid. Med. Cell. Longev. 2018;23(2018):2747018. doi: 10.1155/2018/2747018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Pasarica M., Sereda O.R., Redman L.M., Albarado D.C., Hymel D.T., Roan L.E., Rood J.C., Burk D.H., Smith S.R. Reduced adipose tissue oxygenation in human obesity: Evidence for rarefaction, macrophage chemotaxis, and inflammation without an angiogenic response. Diabetes. 2009;58:718–725. doi: 10.2337/db08-1098. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Puneet P., Moochhala S., Bhatia M. Chemokines in acute respiratory distress syndrome. Am. J. Physiol. Lung Cell. Mol. Physiol. 2005;288:L3–L15. doi: 10.1152/ajplung.00405.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Saha S., et al. An Overview of Nrf2 Signaling Pathway and Its Role in Inflammation. Molecules (Basel, Switzerland) 2020;25(22):5474. doi: 10.3390/molecules25225474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Schafer P. Apremilast mechanism of action and application to psoriasis and psoriatic arthritis. Biochem. Pharmacol. 2012;83:1583e90. doi: 10.1016/j.bcp.2012.01.001. [DOI] [PubMed] [Google Scholar]
  54. Schafer P.H., Parton A., Gandhi A.K., Capone L., Adams M., Wu L., et al. Apremilast, a cAMP phosphodiesterase-4 inhibitor, demonstrates anti-inflammatory activity in vitro and in a model of psoriasis. Br. J. Pharmacol. 2010;159:842e55. doi: 10.1111/j.1476-5381.2009.00559.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Schwartz E.A., Zhang W.Y., Karnik S.K., Borwege S., Anand V.R., Laine P.S., Su Y., Reaven P.D. Nutrient modification of the innate immune response: A novel mechanism by which saturated fatty acids greatly amplify monocyte inflammation. Arterioscler. Thromb. Vasc. Biol. 2010;30:802–808. doi: 10.1161/ATVBAHA.109.201681. [DOI] [PubMed] [Google Scholar]
  56. Soromou L.W., et al. In vitro and in vivo protection provided by pinocembrin against lipopolysaccharide-induced inflammatory responses. Int. Immunopharmacol. 2012;14(1):66–74. doi: 10.1016/j.intimp.2012.06.009. [DOI] [PubMed] [Google Scholar]
  57. Staitieh B.S., Ding L., Neveu W.A., Spearman P., Guidot D.M., Fan X. HIV-1 decreases Nrf2/ARE activity and phagocytic function in alveolar macrophages. J. Leukoc. Biol. 2017;102(2):517–525. doi: 10.1189/jlb.4A0616-282RR. Epub 2017 May 26. PMID: 28550120; PMCID: PMC5505750. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Sun W.H., Liu F., Chen Y., Zhu Y.C. Hydrogen sulfide decreases the levels of ROS by inhibiting mitochondrial complex IV and increasing SOD activities in cardiomyocytes under ischemia/reperfusion. Biochem. Biophys. Res. Commun. 2012;421:164–169. doi: 10.1016/j.bbrc.2012.03.121. [DOI] [PubMed] [Google Scholar]
  59. Suzuki K., Ota H., Sasagawa S., Sakatani T., Fujikura T. Assay method for myeloperoxidase in human polymorphonuclear leukocytes. Anal. Biochem. 1983;132(2):345–352. doi: 10.1016/0003-2697(83)90019-2. http://www.ncbi.nlm.nih.gov/pubmed/6312841 [DOI] [PubMed] [Google Scholar]
  60. Takeda K., Akira S. Toll-like receptors in innate immunity. Int. Immunol. 2005;17:1–14. doi: 10.1093/intimm/dxh186. [DOI] [PubMed] [Google Scholar]
  61. Triantafyllou E., Woollard K.J., McPhail M.J.W., Antoniades C.G., Possamai L.A. The role of monocytes and macrophages in acute and acute-on-chronic liver failure. Front. Immunol. 2018;9:2948. doi: 10.3389/fimmu.2018.02948. PMID: 30619308; PMCID: PMC6302023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Tsai Y.F., Chen C.Y., Yang S.C., Syu Y.T., Hwang T.L. Apremilast ameliorates acute respiratory distress syndrome by inhibiting neutrophil-induced oxidative stress. Biomed J. 2022;S2319–4170(22):135–1134. doi: 10.1016/j.bj.2022.09.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Tsukamoto H., Takeuchi S., Kubota K., Kobayashi Y., Kozakai S., Ukai I., Shichiku A., Okubo M., Numasaki M., Kanemitsu Y., Matsumoto Y., Nochi T., Watanabe K., Aso H., Tomioka Y. Lipopolysaccharide (LPS)-binding protein stimulates CD14-dependent Toll-like receptor 4 internalization and LPS-induced TBK1-IKK∊-IRF3 axis activation. J. Biol. Chem. 2018;293(26):10186–10201. doi: 10.1074/jbc.M117.796631. Epub 2018 May 14. PMID: 29760187; PMCID: PMC6028956. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Valavanidis A., et al. Pulmonary oxidative stress, inflammation and cancer: respirable particulate matter, fibrous dusts and ozone as major causes of lung carcinogenesis through reactive oxygen species mechanisms. Int. J. Environ. Res. Public Health. 2013;10(9):3886–3907. doi: 10.3390/ijerph10093886. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. van Zoelen M.A., Verstege M.I., Draing C., de Beer R., van't Veer C., Florquin S., Bresser P., van der Zee J.S., te Velde A.A., von Aulock S., van der Poll T. Endogenous MCP-1 promotes lung inflammation induced by LPS and LTA. Mol. Immunol. 2011;48(12–13):1468–1476. doi: 10.1016/j.molimm.2011.04.001. Epub 2011 May 6. PMID: 21529952. [DOI] [PubMed] [Google Scholar]
  66. Wang W., Xia T., Yu X. Wogonin suppresses inflammatory response and maintains intestinal barrier function via TLR4-MyD88-TAK1-mediated NF-κB pathway in vitro. Inflamm. Res. 2015;64:423–431. doi: 10.1007/s00011-015-0822-0. View Article: Google Scholar PubMed/NCBI. [DOI] [PubMed] [Google Scholar]
  67. Wu B., Wu Y., Tang W. Heme catabolic pathway in inflammation and immune disorders. Front. Pharmacol. 2019;10:825. doi: 10.3389/fphar.2019.00825. Published 2019 Jul 24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Xu C.Q., Liu B.J., Wu J.F., Xu Y.C., Duan X.H., Cao Y.X., Dong J.C. Icariin attenuates LPS-induced acute inflammatory responses: Involvement of PI3K/Akt and NF-kappaB signaling pathway. Eur. J. Pharmacol. 2010;642:146–153. doi: 10.1016/j.ejphar.2010.05.012. [DOI] [PubMed] [Google Scholar]
  69. Yip P.Y. Phosphatidylinositol 3-kinase-AKT-mammalian target of rapamycin (PI3K-Akt-mTOR) signaling pathway in non-small cell lung cancer. Transl. Lung Cancer Res. 2015;4(2):165–176. doi: 10.3978/j.issn.2218-6751.2015.01.04. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Zhao H., Xu C.N., Huang C., Jiang J., Li L. Notch1 signaling participates in the release of inflammatory mediators in mouse RAW264.7 cells via activating NF-κB pathway. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 2017;33(10):1310–1315. Chinese. PMID: 29169413. [PubMed] [Google Scholar]

Articles from Saudi Pharmaceutical Journal : SPJ are provided here courtesy of Springer

RESOURCES