ABSTRACT
The development of resistance to cefiderocol among multidrug resistant Acinetobacter baumannii has been attributed to downregulation in iron transport systems and a variety of β-lactamases. However, the precise contribution of each in clinical isolates remains to be determined. Sixteen clinical isolates with varying degrees of cefiderocol resistance were investigated. Susceptibility testing was performed with and without the presence of iron and avibactam. Expression of 10 iron transport systems and blaADC and blaOXA-51-type were analyzed by real time RT-PCR. The acquisition of a variety of β-lactamases was also determined. In 2 isolates the impact of silencing the blaADC gene was achieved using a target specific group II intron. For most resistant isolates, MICS for cefiderocol were similar with or without the presence of iron, and there was an overall decrease in expression of receptors (including pirA and piuA) involved in ferric uptake. However, expression of the ferrous uptake system (faoA) persisted. The addition of avibactam (4 μg/mL) lowered most cefiderocol MICs to 2 to 4 μg/mL. Most isolates possessed ADC-25 or ADC-33. Cefiderocol resistance correlated with over-expression of blaADC; silencing of this β-lactamase resulted in a ≥ 8-fold decrease in cefiderocol MICs. Over-expression of specific blaADC subtypes, in a background of generalized repression of ferric uptake systems, were consistent features in clinical isolates of cefiderocol-resistant A. baumannii.
KEYWORDS: cefiderocol, siderophores
INTRODUCTION
The development of cefiderocol, with its novel catechol siderophore moiety, has been a welcomed addition to our therapeutic armamentarium against multidrug resistant bacteria. Cefiderocol has demonstrated promising activity against a wide range of Gram-negative bacteria, including those resistant to carbapenems (1–5).
While demonstrating consistent activity against multidrug resistant Enterobacterales, resistance to cefiderocol has been reported with non-fermenting Gram-negative pathogens. In Pseudomonas aeruginosa, the TonB-dependent siderophore receptors PiuA (and its orthologue PiuD) and PirA have been implicated in the uptake of cefiderocol (6). In laboratory-derived deletion mutants of PAO1, cefiderocol MICs increased 16-fold with deletion of piuA but were unchanged with deletion of pirA (6). However, this finding has not been evident in clinical strains of P. aeruginosa with reduced susceptibility to cefiderocol (7). Other TonB-dependent receptors have been identified that are involved in uptake of siderophore-drug conjugates (6). In addition, over-expression of other iron transport systems in P. aeruginosa may “outcompete” those involved in uptake of siderophore-antibiotic conjugates and confer resistance (8). Acquisition of β-lactamases, particularly NDM and PER, may contribute to, but are not essential for, reduced susceptibility (1, 3). Alterations in the chromosomal AmpC cephalosporinase have been noted in cefiderocol-resistant isolates (9).
Studies involving mechanisms of siderophore-conjugate resistance in Acinetobacter baumannii reflect a similar picture. Deletion of piuA or pirA in A. baumannii ATCC 19606 led to 4 to 8-fold increase in the MICs for 2 monobactam-siderophore conjugates (10). However, downregulation of these genes was not consistently seen in clinical isolates resistant to cefiderocol (11). The acquisition of β-lactamases, often belonging to the OXA, PER, NDM, or SHV classes of enzymes, can contribute to cefiderocol resistance (1–4, 12, 13). The development of overt cefiderocol resistance for A. baumannii may be multifactorial, involving specific β-lactamases with downregulation of iron transport systems (13).
In this report we searched for common themes in the expression of iron transport systems and presence of β-lactamases among a panel of A. baumannii clinical isolates with varying degrees of susceptibility to cefiderocol.
RESULTS
From surveillance studies conducted in New York City from 1999 to 2009, 39 cefiderocol-resistant A. baumannii isolates underwent sequence typing. Of the 39 isolates, 25 belonged to ST2 and 10 belonged to ST229. Fourteen representative isolates from these 2 sequence types, as well as 2 susceptible isolates (D1 and D13) from ST250 gathered from a 2013 surveillance study, were selected for further analysis.
Iron transport studies.
To examine the effect of iron-limiting conditions on the MICs of cefiderocol, susceptibility studies were performed in standard cation-supplemented (MHB) and iron-deficient Mueller-Hinton broth (IDB) (Table 1). The MICs of cefiderocol were generally within 1 dilution when performed in MHB and IDB. In general, reduced expression of pirA and piuA correlated with cefiderocol MICs ≥8 μg/mL. For most isolates with elevated MICs to cefiderocol, there was a general repression in receptors for ferric substrates; however, expression of gene265 (faoA), involved in the uptake of ferrous iron, remained present in nearly all isolates. Compared to A. baumannii ATCC19606, none of the isolates had alterations in ExbD3 and all possessed a Thr226Ser substitution in TonB3.
TABLE 1.
Cefiderocol susceptibility results and levels of expression of iron transport genes among isolates of A. baumannii
| Isolate |
ST |
MICs (μg/mL) |
Relative expression |
||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| IDBa | MHBb | pirA | piuA | gene2581 (bauA) | gene1679 | gene1633 | gene120 | gene1761 | gene3537 | gene3521 | gene265 (faoA) | ||
| ATCC 19606 | ≤ 0.03 | NDc | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | |
| D13 | 250 | 0.25 | 0.25 | ↔ | ↔ | ↓ | ↔ | ↔ | ↓ | ↓ | ↔ | ↓ | ↔ |
| D1 | 250 | 1 | 2 | ↔ | ↔ | ↓ | ↓ | ↓ | ↓ | ↑ | ↓ | ↓ | ↔ |
| S15 | 229 | 4 | 32 | ↔ | ↔ | ↓ | ↔ | ↔ | ↔ | ↑ | ↓ | ↓ | ↔ |
| K47 | 229 | 16 | 32 | ↓ | ↓ | ↓ | ↓ | ↓ | ↓ | ↓ | ↔ | ↓ | ↔ |
| S6 | 229 | 16 | 16 | ↓ | ↓ | ↓ | ↓ | ↓ | ↓ | ↓ | ↓ | ↓ | ↔ |
| W7 | 229 | 16 | 16 | ↓ | ↓ | ↓ | ↔ | ↓ | ↔ | ↓ | ↔ | ↓ | ↔ |
| W315 | 229 | 64 | 32 | ↔ | ↓ | ↓ | ↓ | ↓ | ↔ | ↓ | ↓ | ↓ | ↔ |
| D103 | 229 | > 64 | 64 | ↔ | ↓ | ↓ | ↓ | ↓ | ↓ | ↓ | ↓ | ↓ | ↔ |
| E27 | 2 | 2 | 2 | ↓ | ↑ | ↓ | ↓ | ↔ | ↓ | ↔ | ↓ | ↓ | ↓ |
| A53 | 2 | 4 | 4 | ↔ | ↔ | ↓ | ↑ | ↑ | ↔ | ↔ | ↔ | ↔ | ↔ |
| L301 | 2 | 16 | 32 | ↔ | ↔ | ↓ | ↓ | ↓ | ↓ | ↔ | ↓ | ↓ | ↔ |
| U20 | 2 | 16 | 16 | ↓ | ↔ | ↓ | ↔ | ↔ | ↔ | ↔ | ↓ | ↓ | ↔ |
| D501 | 2 | 32 | 16 | ↔ | ↔ | ↓ | ↑ | ↔ | ↔ | ↔ | ↓ | ↓ | ↔ |
| C120 | 2 | 32 | 32 | ↔ | ↓ | ↓ | ↓ | ↓ | ↔ | ↔ | ↓ | ↓ | ↔ |
| H13 | 2 | 64 | 64 | ↓ | ↓ | ↓ | ↔ | ↔ | ↓ | ↔ | ↓ | ↓ | ↔ |
| A8 | 2 | > 64 | > 64 | ↓ | ↓ | ↓ | ↔ | ↔ | ↓ | ↔ | ↓ | ↓ | ↔ |
Iron deficient Mueller-Hinton broth.
Mueller-Hinton broth.
Not determined.
β-lactamase studies.
The characterization of the β-lactamases in the isolates, and the effect on cefiderocol MICs by the addition of 4 μg/mL of avibactam are noted in Table 2. While most highly resistant isolates possessed an SHV or OXA-type β-lactamase, a susceptible isolate (D1) possessed both SHV and OXA enzymes, and 1 resistant isolate (U20) possessed neither, suggesting they are not essential contributors to cefiderocol resistance. Similarly, increased expression of blaOXA-51-type was evident in most isolates including an isolate (D13) fully susceptible to cefiderocol.
TABLE 2.
Susceptibility testing and β-lactamase characterization in clinical isolates of A. baumannii
| MICs (μg/mL) |
Acquired β-lactamases | ADC type | Relative expression |
||||||
|---|---|---|---|---|---|---|---|---|---|
| Isolate | ST | Ceftazidime | Meropenem | Cefiderocol | Cefiderocol + avibactam (4 μg/mL) | bla ADC | bla oxa-51-type | ||
| ATCC 19606 | 8 | 1 | ≤ 0.03 | ≤ 0.03 | 1 | 1 | |||
| D13 | 250 | 8 | > 16 | 0.25 | 0.25 | TEM-1 | NAa | ↓ | ↑ |
| D1 | 250 | > 32 | > 16 | 1 | 1 | SHV-12, OXA-23 | ADC25 | ↔ | ↔ |
| S15 | 229 | > 32 | > 16 | 4 | 2 | OXA-24 | ADC33 | ↑ | ↑ |
| K47 | 229 | > 32 | > 16 | 16 | 8 | SHV-5 | ADC25 | ↑ | ↑ |
| S6 | 229 | > 32 | > 16 | 16 | 2 | SHV-5 | ADC25 | ↑ | ↑ |
| W7 | 229 | > 32 | > 16 | 16 | 4 | SHV-5 | ADC25 | ↑ | ↑ |
| W315 | 229 | > 32 | 8 | 64 | 2 | SHV-5 | ADC25 | ↑ | ↑ |
| D103 | 229 | > 32 | 16 | > 64 | 4 | SHV-5 | NA | ↑ | ↑ |
| E27 | 2 | > 32 | > 16 | 2 | 0.25 | TEM-1, SHV-12 | ADC30 | ↑ | ↑ |
| A53 | 2 | > 32 | > 16 | 8 | 4 | OXA-24 | ADC33 | ↑ | ↑ |
| L301 | 2 | > 32 | 16 | 16 | 2 | TEM-1, SHV-5 | ADC25 | ↑ | ↑ |
| U20 | 2 | > 32 | 16 | 16 | 4 | None | ADC33 | ↑ | ↑ |
| D501 | 2 | > 32 | 8 | 32 | 4 | TEM-1, SHV-5 | ADC33 | ↑ | ↑ |
| C120 | 2 | > 32 | > 16 | 32 | 4 | TEM-1, SHV-5 | ADC25 | ↑ | ↑ |
| H13 | 2 | > 32 | > 16 | 64 | 1 | SHV-5 | ADC25 | ↑ | ↑ |
| A8 | 2 | > 32 | > 16 | > 64 | 4 | OXA-23 | ADC33 | ↑ | ↑ |
No amplification.
blaADC studies.
In contrast, a consistent finding was elevated expression of blaADC in cefiderocol-resistant isolates (but not in the 2 susceptible isolates D13 and D1). Most isolates possessed ADC-25 or ADC-33. Two cefiderocol-resistant, kanamycin susceptible isolates were selected for blaADC gene silencing using a site-specific intron (Table 3). Both isolates belonged to ST2 and possessed ADC-25. For 1 isolate (D501), which also possessed SHV-5 and TEM-1, silencing of blaADC resulted in a decrease in cefiderocol MIC from 32 to 4 μg/mL. For the second isolate (KH111), which did not possess any identified acquired β-lactamase, gene silencing led to a decrease in the MIC of cefiderocol from 24 to 0.25 μg/mL. For both isolates with the disrupted blaADC gene, the addition of avibactam did not appreciably affect the MICs for cefiderocol or meropenem. For isolate KH111, the ceftazidime MIC fell from > 32 to 16 μg/mL. For isolate D510, which possessed blaSHV-5, there was no change in ceftazidime MICs with gene silencing. Lastly, silencing of the blaADC gene in A. baumannii ATCC 19606, which had a cefiderocol MIC of ≤0.03 μg/mL, had no effect on the MICs to ceftazidime and meropenem (data not shown).
TABLE 3.
Effect of silencing blaADC on MICs of cefiderocol, ceftazidime, and meropenem
| Cefiderocol | Cefiderocol + avibactam 4 μg/mL | Ceftazidime | Meropenem | |
|---|---|---|---|---|
| Isolate | MICs (μg/mL) | |||
| D501 | 32 | 4 | > 32 | 8 |
| D501 Δ blaADC | 4 | 4 | > 32 | 8 |
| KH111 | 24 | 0.25 | > 32 | > 32 |
| KH111 Δ blaADC | 0.25 | 0.094 | 16 | > 32 |
DISCUSSION
With its siderophore side chain, cefiderocol can circumvent most mechanisms associated with antimicrobial resistance. Cefiderocol has retained activity against a wide range of pathogens, including those with a variety of cephalosporinases and carbapenemases. While the overall clinical experience with this agent has been promising, higher mortality and microbiological failure rates have been observed in treated patients harboring infections with A. baumannii (14, 15). Understanding the mechanisms leading to cefiderocol resistance in A. baumannii will be important in strategizing effective therapeutic regimens.
Cellular uptake of cefiderocol has been linked to specific iron transport systems (16). For example, in laboratory-derived strains of P. aeruginosa, disruption of the TonB-dependent siderophore receptors PiuA or its orthologue PiuD increased cefiderocol MICs from 0.5 to 8 and from 0.06 to 2 μg/mL, respectively (6). In our investigation of 2 endemic strains of A. baumannii, a reduction in piuA expression was evident in most highly resistant isolates. Our resistant isolates also tended to have reduced expression of other ferric ion transport systems, including those involving acinetobactin (bauA) and heme. In contrast, there was continued expression of the ferrous ion uptake complex. Taken together, it appears in cefiderocol-resistant isolates, there is reliance of ferrous uptake and an overall downregulation of ferric transport systems. Finally, these findings were not explained by mutations involving the TonB3-ExbB3-ExbD3 complex that were observed in laboratory-derived isolates resistant to monobactam siderophore agents (10).
While downregulation of iron transport systems appears to provide a level of baseline resistance, β-lactamase activity appears to be the driving force for high-level cefiderocol resistance. A variety of β-lactamases have been associated with cefiderocol-resistant A. baumannii (1–4, 12). In our collection, the serine SHV and OXA-type β-lactamases were common in cefiderocol-resistant isolates. However, they were present in a susceptible isolate, and absent in a resistant isolate, suggesting they are not essential for cefiderocol resistance. Similarly, elevated expression of blaOXA-51-type was observed in a susceptible isolate.
In 1 report involving cefiderocol-resistant A. baumannii belonging to a variety of sequence types (ST455, ST473, and ST787), the addition of avibactam lowered cefiderocol MICs approximately 4 to 8-fold (17). In that report, most isolates harbored TEM-1, OXA-23, ADC-30, and OXA-66 β-lactamases (17). In our report, involving isolates belonging to ST229 and the international clone ST2, the presence of avibactam also lowered the cefiderocol MICs ~ 4 to 8-fold. The only common theme among our resistant isolates was increased expression of the AmpC β-lactamase ADC. All the ADC β-lactamases were ADC-25, -30, or -33. For 2 resistant isolates, gene silencing of blaADC resulted in a ≥ 8-fold reduction in cefiderocol MICs, highlighting the importance of this β-lactamase.
The ADC-25, -30, or -33 β-lactamases share Gly242Asp and Arg342Gly alterations. The Gly242Asp change is located in the Ω loop and the Arg342Gly change is near the active site and conserved KTG motif; these alterations have been shown to increase the MICs of both ceftazidime and cefotaxime (18). Mutations affecting other AmpC β-lactamases have correlated with reduced susceptibility to cefiderocol. In P. aeruginosa, a Glu247Lys substitution in the Ω loop resulted in reduced susceptibility to cefiderocol, ceftazidime-avibactam, and ceftolozane-avibactam (9). In Enterobacter cloacae, an Ala-Pro deletion in the R2 loop provided structural changes allowing increased hydrolysis of cefiderocol (19).
For the clinical isolates examined in this investigation, the driving force for cefiderocol resistance was over-expression of particular blaADC subtypes in a background of globally reduced ferric iron uptake. Restoring cefiderocol susceptibility will require effective inhibition of these ADC β-lactamases.
MATERIALS AND METHODS
Isolates of A. baumannii, gathered from surveillance studies conducted from 1999 to 2009 in medical centers in New York City, were screened for resistance to cefiderocol. Isolates with previously known cefiderocol MICs from a study conducted in 2013 were also considered. Susceptibility testing was performed according to CLSI standards (20). Iron-deficient Mueller-Hinton broth was prepared using Chelex (Sigma-Aldrich) as previously described (6). Multilocus sequence typing (MLST) was performed using the Pasteur scheme (http://pubmlst.org/abaumannii/).
Real time RT-PCR studies.
RNA was extracted (RNeasy, Qiagen, Inc.) from cultures, grown in iron-deficient Mueller-Hinton broth, in the early log phase of growth and treated with DNase. Primers and probes were selected based on conserved regions of the genes. (Table 4). Primer and probe concentrations were adjusted to give replicative efficiencies of 90 to 110%, and ~ 25ng of RNA was used as the template. All studies were performed in triplicate. Expressions of target genes were normalized to that of a housekeeping ribosomal gene and calibrated to A. baumannii ATCC 19606. Relative expression values of <0.2 were considered decreased, values of 0.2 to 1.5 as baseline, and >1.5 as increased for the iron transport genes. Isolates were considered to have increased expression of blaADC or blaOXA-51-like if relative expression levels were > 10.
TABLE 4.
Primers and probes used in the real time RT-PCR and PCR studies
| Primers and probes for the real-time RT-PCR studies (5′–3′)a | DNA sequence |
|---|---|
| RTAbRibofor | GTAGCGGTGAAATGCGTAG |
| RTAbRiborev | CTTTCGTACCTCAGCGTCAG |
| RTAbRiboprobe | [DFAM] CGAAGGCAGCCATCTGGCCT [DTAM] |
| RTAbAmpCfor | TGCTATTTCAAAGGAACCTTCA |
| RTAbAmpCrev | TTAATGCGCTCTTCATTTGG |
| RTAbAmpCprobe | [DFAM] TGGCTCAACTAACGGTTTCGGAAC [DTAM] |
| RTAbOxa51for | GGAAGTGAAGCGTGTTGGTT |
| RTAbOxa51rev | TAAAGGACCCACCAGCCAAA |
| RTAbOxa51probe | [DFAM] ACTTGGGTACCGATATCTGCATTGCCA [DTAM] |
| RTPirAfor | AAGCCACTTCGCGTTTAGAA |
| RTPirArev | CGCCATAACCTGAACCACTG |
| RTPirAprobe | [DFAM] ACTCTTCGCTTTAACGGCGAGGC [DTAM] |
| RTPiuAfor | TGTTTGCTGTACTCTGCTCCT |
| RTPiuArev | TGTCTGGACAAACCCAGATGA |
| RTPiuAprobe | [DFAM] TGCCAAACAAGACCTTTGCCGACA [DTAM] |
| RTGene2581for (bauA) | TTGCAGCAACTGATCCATCG |
| RTGene2581rev | TAACAAAGCGGAGGGACCTT |
| RTGene2581probe | [DFAM] TCAACACCTCAACGCGGCCA [DTAM] |
| RTGene265for (faoA) | GCGACCATCACCAAAGTGAA |
| RTGene265rev | TTCCAAACGAATTGCGACCA |
| RTGene265probe | [DFAM] TGCTGCTCGGACTCTACTTCTATCCGA [DTAM] |
| RTGene1679for | AGACGTGGCGAATAAATGGC |
| RTGene1679rev | GCAAATGCGGCTAATTCACG |
| RTGene1679probe | [DFAM] ACGGTTGCTCCAGTGAAAGGAACCC [DTAM] |
| RTGene1633for (heme uptake) | GAGCCTTGGGTGCCAATAAG |
| RTGene1633rev | CGGTCTAACATTGCGAGTGG |
| RTGene1633probe | [DFAM] TGCATTTGCAGCTAATCGACGGCCA [DTAM] |
| RTGene120for | ACCTACGTGCCAATACCCAA |
| RTGene120rev | GCGTTCACTGCTGACATGAT |
| RTGene120probe | [DFAM] AGTCTGGAGCATACCGCGCCT [DTAM] |
| RTGene1761for | CGGTCGACTACAGTCCTTCA |
| RTGene1761rev | AATCGGTATCACGGCTTTGC |
| RTGene1761probe | [DFAM] ACGATCGCCAGGGCTTTCCGA [DTAM] |
| RTGene3537for | TGGGACTCCGCTACGATTAC |
| RTGene3537rev | CCATTTGTCCACCAAACGGT |
| RTGene3537probe | [DFAM] TGCCATACCAAGCCAACATTTGGGC [DTAM] |
| RTGene3521for | CAAGATTGGGCACAAACCCA |
| RTGene3521rev | AGCTCACATAAGGTGCCACA |
| RTGene3521probe | [DFAM] TGACAGAAGCACTGCCCGTAAATGCA [DTAM] |
| Primers used for the blaADC-specific intron | |
| IBS | AAAAAAGCTTATAATTATCCTTAGGTATCGCTGTGGTGCGCCCAGATAGGGTG |
| EBS1d | CAGATTGTACAAATGTGGTGATAACAGATAAGTCGCTGTGGGTAACTTACCTTTCTTTGT |
| EBS2 | TGAACGCAAGTTTCTAATTTCGATTATACCTCGATAGAGGAAAGTGTC |
| Universal intron template | CGAAATTAGAAACTTGCGTTCAGTAAAC |
| Primers for amplification of the iron transporter regulatory genes | |
| exbD3for | CACCATGTTGCAGCAAGACTC |
| exbD3rev | TACTGCAACTTTGCAATTCCACC |
| tonB3for | TCGCGATAATGCGGAATGTT |
| tonB3rev | AAGGTTAGCCGTTGGGACTC |
DFAM, 6-carboxyfluorescein; DTAM, 6-carboxytetramethylrhodamine.
Iron transport studies.
Expression of the siderophore uptake receptor genes pirA and piuA were examined as previously described (11). To determine if upregulation of competing iron transport genes may be involved in cefiderocol-resistant strains, additional iron transport complexes were analyzed (21). Gene numbers are based on the A. baumannii ACICU genome (https://www.ncbi.nlm.nih.gov/nucleotide/CP000863.1). Three TonB-dependent receptor genes prevalent in most strains of A. baumannii were studied: gene 2581 (bauA, involved in acinetobactin transport), gene 1633 (involved in heme uptake), and gene 1679 (involved in hydroxamate siderophore transport). In addition, 4 other genes involved in iron transport were included: genes 120, 1761, 3521, and 3537. Finally, gene 265 (faoA, involved in ferrous uptake) was also included. All 8 genes were identified in the A. baumannii 19606 genome and in 2 representative isolates of the sequence types included in this study (ST2 and ST250). To search for previously described frameshift mutations (10), the regulatory genes exbD3 and tonB3 were amplified and sequenced using the PCR primers noted in Table 4.
β-lactamase studies.
Isolates were screened by PCR for the following β-lactamases, using previously reported primers and conditions: TEM, SHV, KPC, OXA-type, CTX-M, metallo- β-lactamases (IMP, VIM, SIM, GIM, SPM, and NDM), VEB, and PER (22–26). Identification of the chromosomal cephalosporinase blaADC was performed using previously described primers (27). Expression of blaADC and blaOXA-51-type was performed as previously described (11).
blaADC studies.
Disruption of the blaADC gene was achieved by insertion of group II intron (Targetron Gene Knockout System, Sigma-Aldrich). The gene-specific intron was created using proofreading DNA polymerase and the primers listed in Table 4. The intron was inserted into a Zero Blunt TOPO plasmid (Invitrogen) and introduced into chemically competent isolates of A. baumannii ATCC 19606 and 2 cefiderocol-resistant, kanamycin-susceptible isolates of A. baumannii. Transformants were selected on LB agar with 50 μg/mL of kanamycin. The presence of the intron was confirmed by sequencing using M13 primers in the transformed isolates. Cefiderocol MICs of the parent and transformed isolates were performed using antibiotic test strips (Liofilchem).
ACKNOWLEDGMENTS
This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors.
REFERENCES
- 1.Mushtaq S, Sadouki Z, Vickers A, Livermore DM, Woodford N. 2020. In vitro activity of cefiderocol, a siderophore cephalosporin, against multidrug-resistant Gram-negative bacteria. Antimicrob Agents Chemother 64:e01582-20. doi: 10.1128/AAC.01582-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Delgado-Valverde M, del Carmen Conejo M, Serrano L, Fernandez-Cuenca F, Pascual A. 2020. Activity of cefiderocol against high-risk clones of multidrug-resistant Enterobacterales, Acinetobacter baumannii, Pseudomonas aeruginosa, and Stenotrophomonas maltophilia. J Antimicrob Chemother 75:1840–1849. doi: 10.1093/jac/dkaa117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Kazmierczak KM, Tsuji M, Wise MG, Hackel M, Yamano Y, Echols R, Sahm DF. 2019. In vitro activity of cefiderocol, a siderophore cephalosporin, against a recent collection of clinically relevant carbapenem-non-susceptible Gram-negative bacilli, including serine carbapenemase- and metallo-β-lactamase-producing isolates (SIDERO-WT-2014 Study). Int J Antimicrob Agents 53:177–184. doi: 10.1016/j.ijantimicag.2018.10.007. [DOI] [PubMed] [Google Scholar]
- 4.Iregui A, Khan Z, Landman D, Quale J. 2020. Activity of cefiderocol against Enterobacterales, Pseudomonas aeruginosa, and Acinetobacter baumannii endemic to medical centers in New York City. Microb Drug Resist 26:722–726. doi: 10.1089/mdr.2019.0298. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Yamano Y. 2019. In vitro activity of cefiderocol against a broad range of clinically important Gram-negative bacteria. Clin Infect Dis 69:S544–S551. doi: 10.1093/cid/ciz827. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Luscher A, Moynié L, Auguste PS, Bumann D, Mazza L, Pletzer D, Naismith JH, Köhler T. 2018. TonB-dependent receptor repertoire of Pseudomonas aeruginosa for uptake of siderophore-drug conjugates. Antimicrob Agents Chemother 62:e00097-18. doi: 10.1128/AAC.00097-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Gupta A, Landman D, Quale J. 2022. Relationship of TonB-dependent receptors with susceptibility to cefiderocol in clinical isolates of Pseudomonas aeruginosa. J Antimicrob Chemother 77:1282–1285. doi: 10.1093/jac/dkac022. [DOI] [PubMed] [Google Scholar]
- 8.Van Delden C, Page MGP, Kohler T. 2013. Involvement of Fe uptake systems and Amp C β-lactamase in susceptibility to the siderophore monosulfactam BAL30072 in Pseudomonas aeruginosa. Antimicrob Agents Chemother 57:2095–2102. doi: 10.1128/AAC.02474-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Simner PJ, Beisken S, Bergman Y, Posch AE, Cosgrove SE, Tamma PD. 2021. Cefiderocol activity against clinical Pseudomonas aeruginosa isolates exhibiting ceftolozane-tazobactam resistance. Open Forum Infect Dis 8:ofab311. doi: 10.1093/ofid/ofab311. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Moynie L, Luscher A, Rolo D, Pletzer D, Tortajada A, Weingart H, Braun Y, Page MGP, Naismith JH, Kohler T. 2017. Structure and function of the PiuA and PirA siderophore-drug receptors from Pseudomonas aeruginosa and Acinetobacter baumannii. Antimicrob Agents Chemother 61:e02531-16. doi: 10.1128/AAC.02531-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Malik S, Kaminski M, Landman D, Quale J. 2020. Cefiderocol resistance in Acinetobacter baumannii: Roles of β-lactamases, siderophore receptors, and penicillin binding protein 3. Antimicrob Agents Chemother 64:e01221-20. doi: 10.1128/AAC.01221-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Poirel L, Sadek M, Nordmann P. 2021. Contribution of PER-type and NDM-type β-lactamases to cefiderocol resistance in Acinetobacter baumannii. Antimicrob Agents Chemother 65:e00877-21. doi: 10.1128/AAC.00877-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.He Y, Wang Y, Ma X, Zhao L, Guan J, Zhao J, Yu W, Li Y, Ni W, Gao Z. 2022. Resistance to cefiderocol involved expression of PER-1 β-lactamase and downregulation of iron transporter system in carbpenem-resistant Acinetobacter baumannii. Infect Drug Resist 15:7177–7187. doi: 10.2147/IDR.S392241. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Bassetti M, Echols R, Matsunaga Y, Ariyasu M, Doi Y, Ferrer R, Lodise TP, Naas T, Niki Y, Paterson DL, Portsmouth S, Torre-Cisneros J, Toyoizumi K, Wunderink RG, Nagata TD. 2021. Efficacy and safety of cefiderocol or best available therapy for the treatment of serious infections caused by carbapenem-resistant Gram-negative bacteria (CREDIBLE-CR): a randomised, open-label, multicentre pathogen-focused, descriptive, phase 3 trial. Lancet Infect Dis 21:226–240. doi: 10.1016/S1473-3099(20)30796-9. [DOI] [PubMed] [Google Scholar]
- 15.Falcone M, Tiseo G, Leonildi A, Della Sala L, Vecchione A, Barnini S, Farcomeni A, Menichetti F. 2022. Cefiderocol- compared to colistin-based regimens for the treatment of severe infections caused by carbapenem-resistant Acinetobacter baumannii. Antimicrob Agents Chemother 66:e0214221. doi: 10.1128/aac.02142-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Ito A, Nishikawa T, Matsumoto S, Yoshizawa H, Sato T, Nakamura R, Tsuji M, Yamano Y. 2016. Siderophore cephalosporin cefiderocol utilizes ferric iron transporter systems for antibacterial activity against Pseudomonas aeruginosa. Antimicrob Agents Chemother 60:7396–7401. doi: 10.1128/AAC.01405-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Yamano Y, Ishibashi N, Kuroiwa M, Takemura M, Sheng W-H, Hsueh P-R. 2022. Characterization of cefiderocol-non-susceptible Acinetobacter baumannii isolates from Taiwan. J Glob Antimicrob Resist 28:120–124. doi: 10.1016/j.jgar.2021.12.017. [DOI] [PubMed] [Google Scholar]
- 18.Perez A, Perez-Llarena FJ, Garcia P, Kerff F, Beceiro A, Galleni M, Bou G. 2014. New mutations in ADC-type β-lactamases from Acinetobacter spp. affect cefoxitin and ceftazidime hydrolysis. J Antimicrob Chemother 69:2407–2411. doi: 10.1093/jac/dku163. [DOI] [PubMed] [Google Scholar]
- 19.Kawai A, McElheny CL, Iovleva A, Kline EG, Sluis-Cremer N, Shields RK, Doi Y. 2020. Structural basis of reduced susceptibility to ceftazidime-avibactam and cefiderocol in Enterobacter cloacae due to AmpC R2 loop deletion. Antimicrob Agents Chemother 64:e00198-20. doi: 10.1128/AAC.00198-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Clinical and Laboratory Standards Institute. 2018. Performance standards for antimicrobial susceptibility testing; 28th informational supplement, M100-S28. CLSI, Wayne, PA. [Google Scholar]
- 21.Antunes LCS, Imperi F, Towner KJ, Visca P. 2011. Genome-assisted identification of putative iron-utilization genes in Acinetobacter baumannii and their distribution among a genotypically diverse collection of clinical isolates. Res Microbiol 162:279–284. doi: 10.1016/j.resmic.2010.10.010. [DOI] [PubMed] [Google Scholar]
- 22.Bradford PA, Bratu S, Urban C, Visalli M, Mariano N, Landman D, Rahal JJ, Brooks S, Cebular S, Quale J. 2004. Emergence of carbapenem-resistant Klebsiella species possessing the class A carbepenem-hydrolyzing KPC-2 and inhibitor-resistant TEM-30 β-lactamases in New York City. Clin Infect Dis 39:55–60. doi: 10.1086/421495. [DOI] [PubMed] [Google Scholar]
- 23.Woodford N, Fagan EJ, Ellington MJ. 2006. Multiplex PCR for rapid detection of genes encoding CTX-M extended-spectrum β-lactamases. J Antimicrob Chemother 57:154–155. doi: 10.1093/jac/dki412. [DOI] [PubMed] [Google Scholar]
- 24.Woodford N, Ellington MJ, Coelho JM, Turton JF, Ward ME, Brown S, Amyes SGB, Livermore DM. 2006. Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int J Antimicrob Agents 27:351–353. doi: 10.1016/j.ijantimicag.2006.01.004. [DOI] [PubMed] [Google Scholar]
- 25.Ellington MJ, Kistler J, Livermore DM, Woodford N. 2007. Multiplex PCR for rapid detection of genes encoding acquired metallo-β-lactamases. J Antimicrob Chemother 59:321–322. doi: 10.1093/jac/dkl481. [DOI] [PubMed] [Google Scholar]
- 26.Salloum NA, Kissoyan KAB, Fadlallah S, Cheaito K, Araj GF, Wakim R, Kanj S, Kanafani Z, Dbaibo G, Matar GM. 2015. Assessment of combination therapy in BALB/c mice injected with carbapenem-resistant Enterobacteriaceae strains. Front Microbiol 6:999. doi: 10.3389/fmicb.2015.00999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Hujer KM, Hujer AM, Hulten EA, Bajaksouzian S, Adams JM, Donskey CJ, Ecker DJ, Massire C, Eshoo MW, Sampath R, Thomson JM, Rather PN, Craft DW, Fishbain JT, Ewell AJ, Jacobs MR, Paterson DL, Bonomo RA. 2006. Analysis of antibiotic resistance genes in multidrug-resistant Acinetobacter sp. isolates from military and civilian patients treated at the Walter Reed Army Medical Center. Antimicrob Agents Chemother 50:4114–4123. doi: 10.1128/AAC.00778-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
