Skip to main content
BMC Microbiology logoLink to BMC Microbiology
. 2002 Apr 8;2:6. doi: 10.1186/1471-2180-2-6

First isolation of the enterohaemorrhagic Escherichia coli O145:H- from cattle in feedlot in Argentina

Nora L Padola 1, Marcelo E Sanz 1, Paula MA Lucchesi 1, Jesús E Blanco 2, Jorge Blanco 2, Miguel Blanco 2, Analía I Etcheverría 1, Guillermo H Arroyo 1, Alberto E Parma 1,✉
PMCID: PMC102760  PMID: 11936956

Abstract

Background

Enterohaemorrhagic Escherichia coli (EHEC) is considered to be common cause of haemorrhagic colitis (HC), thrombotic thrombocytopenic purpura and haemolytic uraemic syndrome (HUS) in humans. In a previous paper, we have demonstrated that EHEC are commonly found in the intestines of livestock. Infections in humans are, in part, a consequence of consumption of undercooked meat or raw milk. Argentina has one of the highest records of HUS (300–400 cases/year; 22/100,000 children under 4 years of age). The aim of this work is to communicate the first isolation of O145:H-from cattle in this country and characterize the virulence cassette, providing useful information to evaluate the risk of foodborne transmission of this emergent non-O157:H7 serotype.

Results

EHEC O145:H- was isolated from cattle in an Argentinian feedlot. Pheno- and genotype of nine strains were characterized, corresponding to several virulence cassettes: VT2+eaeA+ Mp+ (n = 5), VT2+eaeA+ (n = 1), VT1+eaeA+ Mp+ (n = 2), and VT1+eaeA+ (n = 1). Strains isolated from the same animal were considered only when they showed a different virulence pattern. The clonal relationship was studied by RAPD. Strains were distributed in two RAPD profiles, which corresponded to the presence of either, VT1+ or VT2+ genotype. No difference was detected by RAPD analysis between Mp+ or Mp- strains.

Conclusions

This was the first isolation of EHEC O145:H- serotype in Argentina enlarging the list of non-O157:H7 serotypes isolated from cattle in this country by us. All O145:H-strains carried several virulence factors which allow us to predict their potential ability to develop haemolytic uraemic syndrome in humans.

Background

Enterohaemorrhagic Escherichia coli (EHEC) is considered to be common causes of haemorrhagic colitis (HC), thrombotic thrombocytopenic purpura, and haemolytic-uraemic syndrome (HUS) in humans [1,2]. In a previous paper, we have demonstrated that EHEC are commonly found in the intestines of livestock, specially young cattle; and infections in humans are, in part, a consequence of consumption of undercooked meat or raw milk [3-6]. Several outbreaks have occurred mainly in USA, Canada, United Kingdom and Japan during the last decade [7-10]. Argentina has one of the highest records of HUS (300–400 cases/year; 22/100.000 children under 4 years of age). This rate can be compared with the anual incidence of 2.6/100.000 in Oregon, 3.0 in King County-Washington, 3 to 5 in Canada, United Kingdom, Chile and Uruguay [11]. In spite of EHEC strain O157:H7 has been reported as a cause of HUS in this country [12], this strain does not seem to be so common in this country as in the USA [11]. We have recently published an extensive list of non-O157:H7 EHEC serotypes isolated from cattle and foods in Argentina [13], several of them involved as cause of HC and HUS in somewhere.

In Europe, eighty percent of the VTEC isolated from patients with diarrhoea corresponded to non-O157 serogroups such as O26, O91, O103, O111, O113, O128, O145 [14]. In 1984, Kudoh et al. [15] described the first outbreak of disease due to E. coli O145:H- in Japan, affecting to 100 children. Beutin et al. [16] have considered this serotype as a new emergen. Afterthere, several investigators notified the isolation of this serotype from cattle and humans in USA, Canada and Belgium [17-22]. Another serotype, O145:H25, was found associated to HUS cases in U.K. [19], meanwhile O145:H8 and O145:H28 were isolated from healthy cattle in Canada [22] and Germany [23], respectively.

Aside from known differences among the pathogenicity of VT1, VT2 and its variants, factors that may affect the virulence of EHEC are the ability to cause attaching and effacing lesions (eae gene) in the intestinal mucosa and possession of a 60 MDa megaplasmid (Mp) [1]. The aim of this work is to communicate the first isolation of O145:H- from cattle in this country and characterize the virulence cassette of several strains, providing useful information to evaluate the risk of foodborne transmission of this non-O157:H7 serotype.

Results and discussion

Nine Shiga toxin-producing Escherichia coli serogroups and eleven non-typable strains were identified from a feedlot in Argentina (data no shown). One of them (O145) corresponded to a serogroup never described before in this country. All O145 strains were characterized as H-. This non-O157:H7 serotype (O145:H-) had been previously involved in haemolytic uraemic syndrome outbreaks in Japan [15]. The genotype of those strains were characterized, corresponding to several virulence cassettes: VT2+eaeA+ Mp+ (n = 5), VT2+eaeA+ (n = 1), VT1+eaeA+ Mp+ (n = 2), and VT1+eaeA+ (n = 1). All these strains were able to ferment sorbitol within 18 h of incubation at 37°C. Strains isolated from the same animal were considered only when showed a different virulence pattern.

O145:H- strains were distributed in two RAPD profiles, which corresponded to the presence of either, VT1+ or VT2+ genotype (RAPD profiles 2 and 1, respectively). No difference was detected by RAPD analysis between Mp+ or Mp- strains (Fig. 1). This fact suggests that would be necessary to carry on RAPD studies by using new primers or to apply pulse field electrophoresis technique in the study of clonal relationships.

Figure 1.

Figure 1

RAPD profiles generated using primer M13. Lane MW contains DNA molecular size marker (100 bp ladder, Promega, Madison, WI).

The presence of the virulence genes codifying for verotoxin (1 or 2), the ability to develop attaching and effacing phenomenon on enterocyte surface (eaeA gene) and the expression of an EHEC haemolysin (HlyEHEC), afford the potential of O145:H- as foodborne emergent human pathogen. This EHEC non-O157:H7 serotype, isolated from cattle in feedlot, was never found by us from grazing cattle in Argentina [13]. Our finding, and the high incidence rate of HUS in this country, put local health service authorities on guard.

Conclusions

This was the first isolation of EHEC O145:H- serotype from Argentinian cattle which enlarges the list of non-O157:H7 serotypes isolated from bovine and ground beef in this country by us. All O145:H- strains carried several virulence factors which allow to predict their potential ability to develop haemolytic uraemic syndrome in humans. The strains, which had been isolated from different animal in the same feedlot, conformed two RAPD profiles based upon their verotoxin subtype, without clonal differences.

Materials and methods

Sample collection from cattle

Samples were collected from an Argentinian farm. following the method described previously [6]. Briefly, 59 beef cattle, belonging to a feedlot of Pampeana region, were sampled fortnightly during six months by a single rectal swab from each animal. The swabs were placed in transport medium and processed immediately at the laboratory.

Bacterial colonies were grown on MacConkey agar incubating for 24 hs at 37°C. An aliquots of confluent growth, aproximately 100 colonies, was inoculated into Luria-Bertani broth for 3 h at 37°C and processed for DNA extraction [6,24]. One ml from each culture was frozen at -70°C with the addition of glycerol for further isolation of individual VT+ colonies (50 to 100 colonies/sample) on a MacConkey agar plate. Microorganisms were confirmed as E. coli by means of biochemical test such as citrate, indole, urease and TSI profile.

Detection of VT1, VT2, eae and 60 MDa plasmid by PCR

Escherichia coli growth and DNA preparation were performed as described previously [6,24]. Primers eae-1 and eae-2 were designed to amplify a portion of the eae gene which is conserved between enteropathogenic and enterohaemorrhagic E. coli strains. Primer sequences for VT1, VT2 and eae were indicated in a previous paper [6]. Mp primer sequences were: MFS1F 5' ACGATGTGGTTTATTCTGGA 3' and MFS1R 5' CTTCACGTCACCATACATAT 3' (166 bp amplimer) [25]. Tm were calculated for each primer using Oligo 4.0 (Primer Analysis Software, National BioSciences). Amplification of bacterial DNA was performed in a total volume of 50 μl. A negative control (reagent blank) was included without addition of sample. Another control was designed by adding DNA from the strain lacking VT1, VT2, eae and Mp. Two reference strains O157:H7 were used as positive controls. The conditions for the PCR amplification of VT1, VT2, eae and Mp were as described previously [6,24,25]. Amplified products were analyzed by submarine gel electrophoresis and UV-transillumination (300 nm).

Fermentation of sorbitol

Sorbitol MacConkey agar was used to test the VT+ strains for this condition.

Serotyping

O and H antigens were determined by means of a microagglutination technique in tubes and plates described by Guinée et al.[26] and modified by Blanco et. al.[27] using all available O (O1 – O175) plus six putative new O antigens (OX176-through OX181) [28] and H (H1 – H56) antisera [29]. Non-specific agglutinins were removed by absorption with the corresponding cross-reacting antigens. All VTEC were processed for O serogroup determination. H serotyping was performed only on those strains which, having been isolated from the same sample, differed in either one virulence factor or the O serogroup.

Random amplified polymorphic DNA (RAPD) analysis

Bacteria were grown overnight at 37°C in LB broth with shaking. An aliquot of the culture was diluted 1/10 in water to determine the optical density at 600 nm [39]. For an optical density value of 0.5, a 500 μl aliquot of the stationary-phase culture was centrifuged (2 min at 12,000 × g) and suspended in 500 μl of bidestilled water. The suspension was then boiled for 10 min, centrifuged (2 min at 12,000 × g) and the supernatant was stored at -70°C. Five microliters were used as the template for PCR amplification. RAPD was performed in a final volume of 50 μl containing 20 mM (NH4)2SO4, 75 mM Tris-HCl pH 9.0, 0.1% (w/v) Tween 20, 2.5 mM MgCl2, 200 μM each dNTP, 1 μM primer, 2.5 U Taq DNA polymerase. Three different primers were evaluated: 1281 [31], 970–11 and M13 [32], but primers 1281 and 970–11 were not discriminatory.

Amplification was done in a Genius thermal cycler [Techne (Cambridge) Ltd.] as follows: initial denaturation at 94°C for 5 min (heating rate 60°C/min), followed by 40 cycles of denaturation at 94°C for 1 min (heating rate 29°C/min), annealing at 50°C for 1 ½ min (cooling rate 26°C/min) and extension at 72°C for 1 ½ min (heating rate 29°C/min). Reaction products (10 μl) were analysed in a 1.8% agarose gel stained with ethidium bromide.

Table 1.

Feno-genotypic characteristics of O145:H- strains isolated from cattle.

Serotype Animal & Sample Virulence cassette Virulence profile Lane

VT1 VT2 eaeA Mp
O145:H- 52(1) - + + + 1 1
O145:H- 18(1) - + + + 1 2
O145:H- 27(3) - + + + 1 3
O145:H- 46(3) - + + + 1 4
O145:H- 38(4) - + + + 1 5
O145:H- 27(3) - + + - 2 6
O145:H- 1(1) + - + + 3 7
O145:H- 17(11) + - + + 3 8
O145:H- 1(1) + - + - 4 9
n 3 6 9 7

Lane column indicates positions of RAPD study for each strain in Fig. 1.

Acknowledgments

Acknowledgements

Authors thank Nutrition and Metabolism Unit (INTA-Balcarce) for its collaboration and María R. Ortiz for her technical assistance. This work was supported by the Scientific Research Commission Prov. Buenos Aires (CIC), SECYT-UNCPBA, FONCYT and Univ. Santiago de Compostela. A.E. Parma and A. I. Etcheverría are members of CIC and G.H. Arroyo is member of CONICET.

Contributor Information

Nora L Padola, Email: nlpadola@vet.unicen.edu.ar.

Marcelo E Sanz, Email: msanz@vet.unicen.edu.ar.

Paula MA Lucchesi, Email: paulaluc@vet.unicen.edu.ar.

Jesús E Blanco, Email: jeba@lugo.usc.es.

Jorge Blanco, Email: jba@lugo.usc.es.

Miguel Blanco, Email: mba@lugo.usc.es.

Analía I Etcheverría, Email: analiain@vet.unicen.edu.ar.

Guillermo H Arroyo, Email: gharroyo@vet.unicen.edu.ar.

Alberto E Parma, Email: aparma@vet.unicen.edu.ar.

References

  1. Nataro JP, Kaper JB. Diarrheagenic Escherichia coli. Clin Microbiol Rev. 1998;11:142–201. doi: 10.1128/cmr.11.1.142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Paton JC, Paton AW. Pathogenesis and diagnosis of Shiga toxin-producing Escherichia coli infections. Clin Microbiol Rev. 1998;11:450–479. doi: 10.1128/cmr.11.3.450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Blanco M, Blanco JE, Blanco J, et al. Distribution and characterization of faecal verotoxin-producing Escherichia coli (VTEC) isolated from healthy cattle. Vet Microbiol. 1997;54:309–319. doi: 10.1016/S0378-1135(96)01292-8. [DOI] [PubMed] [Google Scholar]
  4. Johnson RP, Clarke RC, Wilson JB, et al. Growing concerns and recent outbreaks involving non-O157:H7 serotypes of verotoxigenic Escherichia coll. J Food Protection. 1996;59:1112–1122. doi: 10.4315/0362-028X-59.10.1112. [DOI] [PubMed] [Google Scholar]
  5. Montenegro MA, Bulte M, Trumpf T, et al. Detection and characterization of fecal verotoxin-producing Escherichia coli from healthy cattle. J Clin Microbiol. 1990;28:1417–1421. doi: 10.1128/jcm.28.6.1417-1421.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Sanz ME, Viñas MR, Parma AE. Prevalence of bovine verotoxin-producing Escherichia coli in Argentina. Eur J Epidemiol. 1998;14:399–403. doi: 10.1023/A:1007427925583. [DOI] [PubMed] [Google Scholar]
  7. Barret TJ, Lior H, Green JH, et al. A laboratory investigation of a multistate food-borne outbreak of Escherichia coli O157:H7 by used pulsed-field gel electrophoresis and phage typing. J Clin Microbiol. 1994;32:3013–3017. doi: 10.1128/jcm.32.12.3013-3017.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Griffin PM, Bell BP, Cieslak PR, et al. Large outbreak of Escherichia coli O157:H7 infections in the western United States: the big picture. In: MA Karmali, AG Goglio, editor. Recent advences in verocytotoxin-producing Escherichia coli infections. New York: Elsevier; 1994. pp. 7–12. [Google Scholar]
  9. Michino H, Araki K, Minami S, et al. Recent outbreaks of infections caused by Escherichia coli O157:H7 in Japan. In: JB Kaper, AD O'Brien, editor. Escherichia coli O157:H7 and other Shiga toxin-producing E. coli strains. Washington DC, ASM Press; 1998. pp. 73–81. [Google Scholar]
  10. Rowe PC, Orrbine E, Lior H, et al. A prospective study of exposure to verotoxin-producing Escherichia coli among Canadian children with haemolytic uraemic syndrome. Epidemiol Infect. 1993;110:1–7. doi: 10.1017/s0950268800050615. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. López EL, Contrini MM, De Rosa MF. Epidemiology of Shiga toxin-producing Escherichia coli in South America. In: JB Kaper, AD O'Brien, editor. In; Escherichia coli O157:H7 and other Shiga toxin-producing E coli strains. Washington DC, ASM Press; 1998. pp. 30–37. [Google Scholar]
  12. Rivas M, Voyer L, Tous M, et al. Hemolytic uremic syndrome: co-infection with two different serotypes of Shiga-like toxin producing. Escherichia coli Medicina (Buenos Aires) 1993;53:487–490. [PubMed] [Google Scholar]
  13. Parma AE, Sanz ME, Blanco JE, Blanco J, Viñas MR, Blanco M, Padola NL, Etcheverría AI. Virulence genotypes and serotypes of verotoxigenic Escherichia coli isolated from cattle and foods in Argentina. Importance in public health. Eur J of Epidemiol. 2000;16:757–762. doi: 10.1023/A:1026746016896. [DOI] [PubMed] [Google Scholar]
  14. Caprioli A, Tozzi AE. Epidemiology of Shiga toxin-producing Escherichia coli infections in continental Europe. In: JB Kaper, AD O'Brien, editor. Escherichia coli O15 7: H7 and other Shiga toxin-producing E. coli strains. Washington DC, ASM Press; 1998. pp. 38–48. [Google Scholar]
  15. Kudoh Y, Kai A, Obata H, Kusonoki J, Monma C, Shingaki M, Yanagawa Y, Yamada S, Matsushita S, Itoh T, Ohta K. Epidemiological surveys on verocytotoxin-producing Escherichia coli infections in Japan. In: MA Karmali, AG Goglio, editor. In Recent advances in verocytotoxin-producing Escherichia coli infections. Elsevier Sciences BV, Amsterdam; 1994. pp. 53–56. [Google Scholar]
  16. Beutin L, Zimmermann S, Gleier K. Association between serotypes, virulence markers and disease in a group of 679 verocytotoxin-producing Escherichia coli (VTEC) strains isolated from human patients in Germany (1997–1999). Conference on Epidemiology of VTEC and Workshop on "Typing methods for VTEC strains ", Malahide, Ireland. 2001.
  17. Johnson RP, Clarke RC, Wilson JB, Read SC, Rahn K, Renwick SA, Sandhu KA, Alves D, Karmali MA, Lior H, Mcewen SA, Spika JS, Gyles CL. Growing concerns and recent outbreaks involving non-O157:H7 serotypes of verotoxigenic Escherichia coli. J of Food Protection. 1996;59:1112–1122. doi: 10.4315/0362-028X-59.10.1112. [DOI] [PubMed] [Google Scholar]
  18. Wells JG, Shipman LD, Greene KD, Sowers EG, Green JH, Cameron DN, Downes FP, Martin ML, Griffin PM, Ostroff SM, Potter ME, Tauxe RV, Wachsmuth IK. Isolation of Escherichia coli O157:H7 and other Shiga-like-toxin-producing E. coli from dairy cattle. Journal of Clinical Microbiolology. 1991;29:985–989. doi: 10.1128/jcm.29.5.985-989.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Willshaw GA, Scotland SM, Smith HR, Rowe B. Properties of Verocytotoxin-producing Escherichia coli of human origin of O groups other than O157. Journal of Infectious Diseases. 1992;166:797–802. doi: 10.1093/infdis/166.4.797. [DOI] [PubMed] [Google Scholar]
  20. Clarke RC, Wilson JB, Read SC, Renwick S, Rahn K, Johnson RP, Alves D, Karmali MA, Lior H, McEwen SA, Spika J, Gyles CL. Verocytotoxin-producing Escherichia coli (VTEC) in the food chain: preharvest and processing perspectives. In: MA Karmali, AG Goglio, editor. Recent advances in Verocytotoxin-producing Escherichia coli infections. Elsevier Sciences B. V., Amsterdam; 1994. pp. 17–24. [Google Scholar]
  21. Piérard D, Stevens D, Moriau L, Lior H, Lauwers S. Three years PCR screening for VTEC in human stools in Brussels. In: MA Karmali, Goglio, editor. Recent advances in verocytotoxin-producing Escherichia coli infections. Elsevier Sciences BV, Amsterdam; 1994. pp. 33–36. [Google Scholar]
  22. Sandhu KS, Clarke RC, McFadden K, Brouwer A, Loouie M, Wilson J, Lior H, Gyles CL. Prevalence of the eaeA gene in verotoxigenic Escherichia coli strains from dairy cattle in Southwest Ontario. Epidemiology and Infection. 1996;116:1–7. doi: 10.1017/s095026880005888x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Wieler LH, Vieler E, Erpenstein C, Schlapp T, Steinriick H, Bauerfeind R, Byomi A, Baljer G. Shiga toxin-producing Escherichia coli strains from bovines: association of adhesion with carriage of eae and other genes. Journal of Clinical Microbiolology. 1996;34:2980–2984. doi: 10.1128/jcm.34.12.2980-2984.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Parma AE, Viñas MR, Sanz ME. Improvement of the polymerase chain reaction to detect Escherichia coli Shiga-like toxin II gene from clinical isolates. J Microbiol Methods. 1996;26:81–85. doi: 10.1016/0167-7012(96)00846-9. [DOI] [Google Scholar]
  25. Fratamico PM, Sackitey SK, Wiedmann M, et al. Detection of Escherichia coli O157:H7 by multiplex PCR. J Clin Microbiol. 1995;33:2188–2191. doi: 10.1128/jcm.33.8.2188-2191.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Guinée PAM, Jansen HW, Wasdtrom T, et al. E. coli associated with neonatal diarrhoea in piglets and calves. In: PW Leeww, PAM Guinée PAM, editor. The Laboratory diagnosis in neonatal calf and pig diarrhoea. Current topics in veterinary and animal science. Vol. 13. The Netherlands, Martinus Nijhoff Publishers; 1981. pp. 126–162. [Google Scholar]
  27. Blanco J, Blanco M, Alonso MP, et al. Serogroups of Escherichia coli strains producing cytotoxic necrotizing factors CNF1 and CNF2. FEMS Microbiology Letters. 1992;75:155–159. doi: 10.1016/0378-1097(92)90396-6. [DOI] [PubMed] [Google Scholar]
  28. Pradel N, Livrelli V, De Champs C, Palcoux JB, Reynaud A, Scheutz F, Sirot J, Joly B, Forestier C. Prevalence and characterization of Shiga toxin-producing Escherichia coli isolated from cattle, food and children during one-year prospective study in France. J Clin Microbiol. 2000;38:1023–1031. doi: 10.1128/jcm.38.3.1023-1031.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Orskov F, Orskov Y. Serotyping of Escherichia coli. In: T Bergan, editor. Methods in Microbiology. Vol. 14. 1984. pp. 43–112. [Google Scholar]
  30. Pacheco ABF, Guth BEC, Soares KCC, Nishimura L, de Almeida DF, Ferreira LCS. Random Amplification of Polymorphic DNA Reveals Serotype-Specific Clonal Clusters among Enterotoxigenic Escherichia coli Strains Isolated from Humans. J Clin Microbiol. 1997;35:1521–1525. doi: 10.1128/jcm.35.6.1521-1525.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Madico G, Akopyants NS, Berg DE. Arbitrarily Primed PCR DNA Fingerprinting of Escherichia coli O157:H7 Strains by Using Templates from Boiled Cultures. J Clin Microbiol. 1995;33:1534–1536. doi: 10.1128/jcm.33.6.1534-1536.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Birch M, Denning DW, Law D. Rapid Genotyping of Escherichia coli O157 Isolates by Random Amplification of Polymorphic DNA. Eur J Clin Microbiol Infect Dis. 1996;15:297–302. doi: 10.1007/BF01695661. [DOI] [PubMed] [Google Scholar]

Articles from BMC Microbiology are provided here courtesy of BMC

RESOURCES