Abstract
Prion diseases are fatal and malignant infectious encephalopathies induced by the pathogenic form of prion protein (PrPSc) originating from benign prion protein (PrPC). A previous study reported that the M132L single nucleotide polymorphism (SNP) of the prion protein gene (PRNP) is associated with susceptibility to chronic wasting disease (CWD) in elk. However, a recent meta-analysis integrated previous studies that did not find an association between the M132L SNP and susceptibility to CWD. Thus, there is controversy about the effect of M132L SNP on susceptibility to CWD. In the present study, we investigated novel risk factors for CWD in elk. We investigated genetic polymorphisms of the PRNP gene by amplicon sequencing and compared genotype, allele, and haplotype frequencies between CWD-positive and CWD-negative elk. In addition, we performed a linkage disequilibrium (LD) analysis by the Haploview version 4.2 program. Furthermore, we evaluated the 3D structure and electrostatic potential of elk prion protein (PrP) according to the S100G SNP using AlphaFold and the Swiss-PdbViewer 4.1 program. Finally, we analyzed the free energy change of elk PrP according to the S100G SNP using I-mutant 3.0 and CUPSAT. We identified 23 novel SNP of the elk PRNP gene in 248 elk. We found a strong association between PRNP SNP and susceptibility to CWD in elk. Among those SNP, S100G is the only non-synonymous SNP. We identified that S100G is predicted to change the electrostatic potential and free energy of elk PrP. To the best of our knowledge, this was the first report of a novel risk factor, the S100G SNP, for CWD.
Keywords: CWD, prion, elk, S100G, PRNP, SNP, risk factor
Introduction
Prion diseases are fatal and infectious neurodegenerative disorders caused by a highly aggregated and proteinase K-resistant form of prion protein (PrPSc) converted from normal prion protein (PrPC) encoded by the prion protein gene (PRNP) [1–3]. In the Cervidae family, prion disease is called chronic wasting disease (CWD) and has been reported in various Cervidae species, including elk, mule deer, red deer, and sika deer [4–6]. Notably, although certain individuals have been infected with CWD, certain individuals have shown resistance to CWD on the farms where CWD occurred [7]. As the cause of this phenomenon, several studies have suggested that genetic polymorphisms of the PRNP gene play a pivotal role in susceptibility/resistance to CWD [8–10].
According to Monello et al., there was a correlation between the frequency of the 132L allele and CWD prevalence in 1018 elk sampled from various populations in the USA [11]. In addition, Haley et al. demonstrated that the 132MM genotype was nearly 2 to 3.5 times more prevalent in CWD-positive elk compared to the 132ML and 132LL genotypes, respectively [12]. White et al. also found that the 132L allele was less observed among CWD cases in 559 captive and free-ranging elk from a different geographic region in the USA [13]. However, other studies did not find that the genotype and allele frequencies of the M132L single nucleotide polymorphism (SNP) were associated with susceptibility to CWD in the USA and Korea [14, 15]. In addition, a meta-analysis of the three previous studies also did not identify a relationship between the M132L SNP and susceptibility to CWD in all genetic models [15]. Furthermore, real-time quaking-induced conversion (RT-QuIC) shows that the conversion efficiency of PrPSc of a specific genotype was not high but that the conversion efficiency of PrPSc was high when the genotype of the codon was identical between the template and seed [16]. These discrepancies may be linked to the sample size or CWD strains.
In Korea, more than 12 000 elk are bred, and recently, intermittent CWD cases have been reported there [17–19]. The exact cause of CWD is unknown since elk have been banned from importation from Canada since 2000. Since CWD is an extremely infectious disease, investigation of the novel risk factor for CWD is needed for preemptive control of CWD, a national disaster-type disease.
In the present study, to identify novel risk factors for CWD in elk, we investigated genetic polymorphisms of the PRNP gene and compared genotype, allele, and haplotype frequencies between 52 CWD-positive and 196 CWD-negative elk. In addition, we performed a linkage disequilibrium (LD) analysis among PRNP polymorphisms to find the LD relationship among PRNP polymorphisms. Furthermore, we analyzed the 3D structure and electrostatic potential of elk prion protein (PrP) according to the S100G SNP using AlphaFold and the Swiss-PdbViewer 4.1 program [20, 21]. Finally, we investigated the free energy change of elk PrP according to the S100G SNP using I-mutant 3.0 and CUPSAT [22, 23].
Materials and methods
Ethics statements
All experimental procedures were approved by the Institutional Animal Care and Use Committee of Jeonbuk National University (IACUC Number: JBNU-2019-0076). All experiments were carried out following the Korea Experimental Animal Protection Act.
Subjects
Brain tissues derived from 248 elk were obtained from 6 animal farms in the Republic of Korea including Chungnam (Geumsan, 61 animals; Hongsung, 19 animals), Gyeongnam (Namhae, 50 animals; Jinju, 77 animals), and Jeonnam (Hampyeong, 2 animals; Gokseong, 39 animals) provinces where CWD has occurred [12]. The breeding scale of each farm is as follows, Chungnam (Geumsan), 61 animals; Gyeongnam (Namhae), 56 animals; Jeonnam (Gokseong), 53 animals; Jeonnam (Hampyeong); 221 animals. The breeding scale of Chungnam (Hongsung) and Gyeongnam (Jinju) was not available. The owners of the farms in Chungnam (Geumsan) and Gyeongnam (Namhae) were the same, however, the epidemiological association (route and source of infection) between each farm was not observed. CWD tests were conducted on all brain samples by the Animal and Plant Quarantine Agency (APQA) in the Republic of Korea using the HerdChek BSE-Scrapie Antigen Kit (IDEXX, USA) and Western blot analysis. Out of the 248 elk, 52 elk (Gyeongnam, 19 animals; Jeonnam, 19 animals (Gokseong, 17 animals; Hampyeong, 2 animals); Chungnam, 14 animals) were diagnosed with CWD.
Genomic DNA
Genomic DNA was isolated from 20 mg of brain tissue using a QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol.
Genetic analysis of the elk PRNP gene
Polymerase chain reaction (PCR) was conducted to investigate the variations from amino acid 8 to 235 within the open reading frame (ORF) of elk PRNP gene (accession number: FJ590751.1) from the genomic DNA using the forward and reverse gene-specific primers PRNP-F (ATGGTGAAAAGCCACATAGGC) and PRNP-R (ACACTTGCCCCTCTTTGGTA). PCR was performed using DNA Polymerase (Biofact, Daejeon, Republic of Korea) and an S-1000 Thermal Cycler (Bio-Rad, Hercules, California, USA) according to the manufacturer’s protocol. The PCR conditions for the PRNP-F and PRNP-R primers were as follows: 95 °C for 2 min for denaturation; 35 cycles of 94 °C for 45 s, 59 °C for 45 s, and 72 °C for 1 min 30 s; and 1 cycle of 72 °C for 10 min for extension. Detailed information on PCR is described in a previous study [12]. The amplicons were eluted using a PCR Purification Kit (Thermo Fisher Scientific, Bridgewater, New Jersey, USA) and sequenced by an ABI 3730 automatic sequencer (ABI, Foster City, California, USA) on both strands. Sequencing results were visualized by Finch TV software (Geospiza Inc., Seattle, USA), and genotyping of each nucleotide (Q > 40) was performed.
Statistical analysis
Statistical analyses were conducted by SAS version 9.4 (SAS Institute Inc., USA). The differences in genotype and allele distributions of the PRNP gene between CWD-negative and CWD-positive elk were analyzed using the χ2 test and Fisher exact test. The Hardy-Weinberg equilibrium (HWE), haplotype analyses and LD tests were conducted by Haploview version 4.2 (Broad Institute, Cambridge, MA, USA) as previously described [8].
3D structure and electrostatic potential analyses of elk PrP
The 3D structure of elk PrP was predicted by AlphaFold based on machine learning. The confidence of modeling was evaluated by the predicted local distance difference test (pLDDT) score on a scale from 0–100. The predicted structure was visualized by the Swiss-PdbViewer 4.1 program.
Prediction of protein stability changes
Protein stability changes according to S100G were predicted by I-mutant 3.0 and CUPSAT. I-mutant 3.0 estimated protein stability changes based on a support vector machine (SVM) and evaluated the free energy change (DDG) value with positive (increase) and negative (decrease) signs. CUPSAT calculated protein stability changes based on protein environment-specific mean force potentials and evaluated the DDG value with positive (increase) and negative (decrease) signs.
Results
Identification of 23 novel PRNP polymorphisms in elk
To identify polymorphisms of the elk PRNP gene, we performed amplicon sequencing analysis targeting the ORF of the elk PRNP gene. We identified a total of 26 SNP, including 10 synonymous SNP and 16 non-synonymous SNP. Among 26 SNP, 23 SNP were novel SNP, including 8 synonymous SNP and 15 non-synonymous SNP (Figures 1 and 2). We also found c.63C > T, G (V21V), c.312G > A (K104K) and c.394A > T (M132L) SNP reported in elk in previous studies [12].
Figure 1.
Schematic map of the prion protein (PrP) with single-nucleotide polymorphisms (SNP) of the prion protein gene (PRNP) in elk. * indicates non-synonymous SNP. # indicates previously reported non-synonymous SNP. SP: signal peptide; OPR: octapeptide repeat region.
Figure 2.
Electropherograms of 23 novel SNP of the PRNP gene found in 248 elk. The colors of the peaks designate each base of the DNA sequence (green: adenine; red: thymine; blue: cytosine; black: guanine). The red arrows designate the location of the SNP found in the present study. *indicates non-synonymous SNP. M/M: major homozygote; M/m: heterozygote; m/m: minor homozygote.
Identification of a strong association between PRNP SNP and susceptibility to CWD in elk
To investigate the relationship of PRNP SNP with susceptibility to CWD, we compared the genotype, allele and haplotype distributions between 196 CWD-negative and 52 CWD-positive elk. Detailed information on the genotype, allele and haplotype distributions is described in Tables 1 and 2. Notably, the genotype and allele distributions of the c.63C > T, G (V21V), c.298A > G (S100G) and c.408C > T (A136A) SNP were significantly different between CWD-negative and CWD-positive elk. In addition, allele distributions of c.312G > A (K104K), c.384C > T (L128L) and c.501G > A (R167R) were significantly different between CWD-negative and CWD-positive elk. As shown in a previous study, we did not find an association of c.394A > T (M132L SNP) with susceptibility to CWD in elk [12].
Table 1.
Comparison of genotype and allele distributions of the prion protein gene (PRNP) between chronic wasting disease (CWD)-negative and CWD-positive elks
| Polymorphisms | Genotype frequencies, n | Allele frequencies, n | HWE | P-valuea | P-valueb | |||||
|---|---|---|---|---|---|---|---|---|---|---|
| MM | Mm | mm | M | m | ||||||
| c.56G > A | S19N | CWD-neg | 188 | 8 | 0 | 384 | 8 | 0.7705 | 1 | 1 |
| CWD-pos | 50 | 2 | 0 | 102 | 2 | 0.8875 | ||||
| c.63C > T, G | V21V | CWD-neg | 88 | 84 | 24 | 260 | 132 | 0.5701 | 0.0322 | 0.0024 |
| CWD-pos | 34 | 17 | 1 | 85 | 19 | 0.4945 | ||||
| c.93A > C | G31G | CWD-neg | 192 | 3 | 1 | 387 | 5 | 0 | 1 | 0.589 |
| CWD-pos | 52 | 0 | 0 | 104 | 0 | N.A | ||||
| c.95G > A | G32E | CWD-neg | 195 | 1 | 0 | 391 | 1 | 0.9714 | 1 | 1 |
| CWD-pos | 52 | 0 | 0 | 104 | 0 | N.A | ||||
| c.135A > C | G45G | CWD-neg | 191 | 4 | 1 | 386 | 6 | 0 | 0.6696 | 0.3516 |
| CWD-pos | 52 | 0 | 0 | 104 | 0 | N.A | ||||
| c.292A > G | T98A | CWD-neg | 177 | 19 | 0 | 373 | 19 | 0.4757 | 0.0851 | 0.0918 |
| CWD-pos | 51 | 1 | 0 | 103 | 1 | 0.9441 | ||||
| c.293C > G | T98S | CWD-neg | 192 | 3 | 1 | 387 | 5 | 0 | 1 | 0.589 |
| CWD-pos | 52 | 0 | 0 | 104 | 0 | N.A | ||||
| c.298A > G | S100G | CWD-neg | 196 | 0 | 0 | 392 | 0 | N.A | < 0.0001 | < 0.0001 |
| CWD-pos | 46 | 6 | 0 | 98 | 6 | 0.6588 | ||||
| c.310A > G | K104E | CWD-neg | 195 | 0 | 1 | 390 | 2 | 0 | 1 | 1 |
| CWD-pos | 52 | 0 | 0 | 104 | 0 | N.A | ||||
| c.312G > A | K104K | CWD-neg | 139 | 53 | 4 | 331 | 61 | 0.685 | 0.0748 | 0.0199 |
| CWD-pos | 45 | 7 | 0 | 97 | 7 | 0.6027 | ||||
| c.384C > T | L128L | CWD-neg | 183 | 12 | 1 | 378 | 14 | 0.1198 | 0.1585 | 0.0491 |
| CWD-pos | 52 | 0 | 0 | 104 | 0 | N.A | ||||
| c.394A > T | M132L | CWD-neg | 135 | 50 | 11 | 320 | 72 | 0.0365 | 0.8542 | 0.479 |
| CWD-pos | 38 | 12 | 2 | 88 | 16 | 0.4125 | ||||
| c.408C > T | A136A | CWD-neg | 173 | 22 | 1 | 368 | 24 | 0.7416 | 0.0058 | 0.0052 |
| CWD-pos | 37 | 15 | 0 | 89 | 15 | 0.2242 | ||||
| c.414C > T | S138S | CWD-neg | 188 | 7 | 1 | 383 | 9 | 0.0043 | 0.4868 | 0.215 |
| CWD-pos | 52 | 0 | 0 | 104 | 0 | N.A | ||||
| c.424A > G | I142V | CWD-neg | 195 | 1 | 0 | 391 | 1 | 0.9714 | 1 | 1 |
| CWD-pos | 52 | 0 | 0 | 104 | 0 | N.A | ||||
| c.428A > G | H143R | CWD-neg | 193 | 3 | 0 | 389 | 3 | 0.914 | 1 | 1 |
| CWD-pos | 51 | 1 | 0 | 103 | 1 | 0.9441 | ||||
| c.436A > T | N146Y | CWD-neg | 195 | 1 | 0 | 391 | 1 | 0.9714 | 1 | 1 |
| CWD-pos | 52 | 0 | 0 | 104 | 0 | N.A | ||||
| c.441C > T | D147D | CWD-neg | 195 | 0 | 1 | 390 | 2 | 0 | 1 | 1 |
| CWD-pos | 52 | 0 | 0 | 104 | 0 | N.A | ||||
| c.478 T > C | Y160H | CWD-neg | 195 | 1 | 0 | 391 | 1 | 0.9714 | 1 | 1 |
| CWD-pos | 52 | 0 | 0 | 104 | 0 | N.A | ||||
| c.501G > A | R167R | CWD-neg | 183 | 12 | 1 | 378 | 14 | 0.1198 | 0.1585 | 0.0491 |
| CWD-pos | 52 | 0 | 0 | 104 | 0 | N.A | ||||
| c.518A > G | N173S | CWD-neg | 192 | 3 | 1 | 387 | 5 | 0 | 1 | 0.589 |
| CWD-pos | 52 | 0 | 0 | 104 | 0 | N.A | ||||
| c.530C > A | T177N | CWD-neg | 186 | 9 | 1 | 381 | 11 | 0.2677 | 0.3762 | 0.1312 |
| CWD-pos | 52 | 0 | 0 | 104 | 0 | N.A | ||||
| c.550A > G | N184D | CWD-neg | 195 | 1 | 0 | 391 | 1 | 0.9714 | 1 | 1 |
| CWD-pos | 52 | 0 | 0 | 104 | 0 | N.A | ||||
| c.624G > A | M208I | CWD-neg | 190 | 4 | 2 | 384 | 8 | 0 | 0.7389 | 0.2139 |
| CWD-pos | 52 | 0 | 0 | 104 | 0 | N.A | ||||
| c.636 T > G | V212V | CWD-neg | 187 | 7 | 2 | 381 | 11 | 0 | 0.4741 | 0.1312 |
| CWD-pos | 52 | 0 | 0 | 104 | 0 | N.A | ||||
| c.676C > G | Q226E | CWD-neg | 165 | 28 | 3 | 358 | 34 | 0.1689 | 0.5108 | 0.7639 |
| CWD-pos | 42 | 10 | 0 | 94 | 10 | 0.4429 | ||||
Bold texts indicate P < 0.05.
acompared genotype distributions between CWD-negative and CWD-positive elks.
bcompared allele distributions between CWD-negative and CWD-positive elks.
CWD-neg: CWD-negative elks, CWD-pos: CWD-positive elks, HWE: Hardy–Weinberg equilibrium, M: major allele, m: minor allele, MM: major homozygote, Mm: heterozygote, mm: minor homozygote, N.A: not applicable.
Table 2.
Comparison of haplotype distributions of the prion protein gene (PRNP) between chronic wasting disease (CWD)-negative and CWD-positive elks
| Haplotype | c.56G > A | c.95G > A | c.292A > G | c.293C > G | c.298A > G | c.310A > G | c.394A > T | c.424A > G | c.428A > G | c.436A > T | c.478 T > C | c.518A > G | c.530C > A | c.550A > G | c.624G > A | c.676C > G | CWD Negative (n = 392) | CWD Positive (n = 104) | P-value |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Ht1 | G | G | A | C | A | A | A | A | A | A | T | A | C | A | G | G | 280 (0.715) | 73 (0.704) | 0.8046 |
| Ht2 | G | G | A | C | A | A | T | A | A | A | T | A | C | A | G | G | 63 (0.161) | 14 (0.130) | 0.3542 |
| Ht3 | G | G | G | C | A | A | A | A | A | A | T | A | C | A | G | C | 17 (0.042) | 0 (0) | 0.0300 |
| Ht4 | A | G | A | C | A | A | A | A | A | A | T | A | C | A | G | C | 6 (0.015) | 2 (0.019) | 0.6760 |
| Ht5 | G | G | A | C | A | A | A | A | A | A | T | A | C | A | G | C | 4 (0.011) | 7 (0.070) | 0.0023 |
| Others | 22 (0.056) | 8 (0.077) |
Bold texts indicate statistical significance (P < 0.05).
The most frequently observed haplotype was GGACAAAAAATACAGG (CWD-negative elk: 71.5%; CWD-positive elk: 70.4%), followed by GGACAATAAATACAGG (CWD-negative elk: 16.1%; CWD-positive elk: 13%) and GGGCAAAAAATACAGC (CWD-negative elk: 4.2%; CWD-positive elk: 0%). Notably, the GGGCAAAAAATACAGC and GGACAAAAAATACAGC haplotype distributions were significantly different between CWD-negative and CWD-positive elk (Table 2).
We investigated the LD among the 16 non-synonymous SNP of the elk PRNP gene with r2 values. The detailed LD values are described in Table 3. In the CWD-positive elk, all of the SNP showed a weak LD (r2 < 0.333). In the CWD-negative elk, 11 strong LD were found among 16 non-synonymous SNP. LD distributions were significantly different between CWD-negative and CWD-positive elk.
Table 3.
Linkage disequilibrium (LD) among non-synonymous single nucleotide polymorphisms (SNP) of the cervid prion protein gene (PRNP) in elks
| r2 | c.56G > A | c.95G > A | c.292A > G | c.293C > G | c.298A > G | c.310A > G | c.394A > T | c.424A > G | c.428A > G | c.436A > T | c.478 T > C | c.518A > G | c.530C > A | c.550A > G | c.624G > A | c.676C > G |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| c.56G > A | − | − | 0 | − | 0.001 | − | 0.004 | − | 0 | − | − | − | − | − | − | 0.002 |
| c.95G > A | 0 | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − |
| c.292A > G | 0 | 0 | − | − | 0.001 | .002 | − | 0 | − | − | − | − | − | − | 0.091 | |
| c.293C > G | 0 | 0 | 0.001 | − | − | − | − | − | − | − | − | − | − | − | − | − |
| c.298A > G | − | − | − | − | − | − | 0.029 | − | 0.001 | − | − | − | − | − | − | 0.001 |
| c.310A > G | 0 | 0 | 0 | 0 | − | − | − | − | − | − | − | − | − | − | − | − |
| c.394A > T | 0.003 | 0.011 | 0.011 | 0.003 | − | 0.023 | − | 0.002 | − | − | − | − | − | − | 0.019 | |
| c.424A > G | 0 | 0 | 0 | 0 | − | 0 | 0.011 | − | − | − | − | − | − | − | − | − |
| c.428A > G | 0 | 0 | 0 | 0.597 | − | 0 | 0.002 | 0 | − | − | − | − | − | − | − | 0.091 |
| c.436A > T | 0 | 0 | 0 | 0 | − | 0 | 0.001 | 0 | 0 | − | − | − | − | − | − | − |
| c.478 T > C | 0 | 0 | 0 | 0 | − | 0 | 0.011 | 1.0 | 0 | 0 | − | − | − | − | − | − |
| c.518A > G | 0 | 0 | 0.001 | 1.0 | − | 0 | 0.003 | 0 | 0.597 | 0 | 0 | − | − | − | − | − |
| c.530C > A | 0.001 | 0 | 0.001 | 0.447 | − | 0 | 0.006 | 0 | 0.267 | 0 | 0 | 0.447 | − | − | − | − |
| c.550A > G | 0 | 1.0 | 0 | 0 | − | 0 | 0.011 | 0 | 0 | 0 | 0 | 0 | 0 | − | − | − |
| c.624G > A | 0 | 0 | 0.001 | 0.62 | − | 0 | 0.001 | 0 | 0.37 | 0 | 0 | 0.62 | 0.547 | 0 | − | − |
| c.676C > G | 0.002 | 0 | 0.414 | 0.136 | − | 0 | 0.008 | 0 | 0.081 | 0 | 0 | 0.136 | 0.244 | 0 | 0.219 | − |
The above diagonal indicates the LD value in CWD-positive elks. Below the diagonal indicates the LD value in CWD-negative elks. Bold texts indicate strong LD (r2 > 0.333).
In silico evaluation of the S100G SNP on elk PrP
First, the 3D structures of wild-type (S100) and mutant (G100) elk PrP were predicted by AlphaFold. Then, the predicted structure was visualized with Swiss-PdbViewer, and the electrostatic potential was analyzed (Figure 3A). Notably, the positive potential of elk PrP with the G100 allele was shrank compared to that of wild-type elk PrP.
Figure 3.
In silico analyses of elk PrP according to S100G. A Electrostatic potential and 3D structure analysis of elk PrP. The left panel indicates wild-type elk PrP. The right panel indicates elk PrP with the G100 allele. Positive potentials are noted in blue. Negative potentials are drawn in red. B Prediction of protein stability changes using I-mutant 3.0 and CUPSAT. The DDG value indicates the free energy change according to S100G.
We estimated the protein stability changes according to S100G by I-mutant 3.0 and CUPSAT (Figure 3B). Notably, S100G was predicted to induce a decrease in the free energy of elk PrP (I-mutant 3.0: − 0.46 kcal/mol; CUPSAT: − 0.32 kcal/mol).
Discussion
In the present study, we found 23 novel SNP of the elk PRNP gene and a high level of genetic diversity (Table 1, Figures 1, 2). However, a previous study using microsatellite analysis has reported that elk have low genetic diversity [24]. Previous studies have reported that genetic diversity of the PRNP gene is correlated to prion resistance and susceptibility. A small number of SNP have been reported in dogs and horses, which are prion-resistant animals [25–27]. In contrast, sheep, goats, cattle, deer, and humans, which are prion-susceptible animals, show high genetic diversity for the PRNP gene [8, 28–31]. This phenomenon may provide clues to explain the high genetic diversity of the elk PRNP gene. Moreover, given that this population was originally imported from Canada, it is possible that the observed phenomenon is a result of its unique history, specific management practices, or animal relocation. Therefore, further investigation of this issue would be highly valuable in the future.
We also identified a strong association between PRNP polymorphisms and susceptibility to CWD in elk (Tables 1 and 2). Among those SNP, the S100G SNP is the only non-synonymous SNP. In addition, c.298A > G (S100G) did not have strong LD in CWD-positive and CWD-negative elk (Table 3). Since the non-synonymous SNP directly affects the structural features of the protein, we generated the template of elk PrP according to the S100G SNP by AlphaFold and analyzed the 3D structure and electrostatic potential (Figure 3A). Although the 3D structure of wild-type elk PrP was not significantly different from that of elk PrP with the G100 allele, notably, the positive charge of elk PrP with the G100 allele was decreased compared to that of wild-type elk PrP. In addition, the free energy of elk PrP with the G100 allele was decreased compared to that of wild-type PrP (Figure 3B). Previous studies have reported that the electrostatic potential of PrP plays an important role in PrP oligomerization [32]. In addition, a large free energy barrier is a crucial factor affecting protein stability, and unstable PrP is related to amyloid propensity [33, 34]. Thus, the S100G SNP was predicted to alter the electrostatic structure of elk PrP and provide a susceptible feature to CWD. Further validation using prion infection in transgenic mice and protein misfolding cyclic amplification (PMCA) and RT-QuIC assays with elk PrP carrying S100G is needed to evaluate the relationship between the S100G SNP and susceptibility to CWD in the future.
CWD is the most potent infectious property among prion diseases [35]. CWD is regarded to be transmitted through direct animal contact or by indirect exposure to contaminated environmental factors [36]. In addition, recent studies have reported that sporadic forms of CWD have emerged in Northern European countries [35, 37]. Furthermore, several cases of transmission by overcoming the interspecies barrier have been reported, and experimental infection of CWD agents caused CWD-related phenotypes in nonhuman primates [38]. In Korea, meat and antlers derived from Cervidae species are frequently consumed for food or oriental medicine. Thus, careful preemptive control of CWD is needed. For the preemptive control of CWD in elk, culling for individuals with CWD-related genotypes is also a good method, and the S100G SNP presented in this study is also proposed as a potential candidate for the construction of a selective breeding system. Since PRNP polymorphisms are related to not only susceptibility to CWD but also modulation of strain selection [39, 40], it is highly desirable to investigate the characteristics of S100G SNP as a novel CWD strain to construct the selective breeding system in the future.
In conclusion, we found 23 novel SNP of the elk PRNP gene. We identified a strong association between PRNP SNP and susceptibility to CWD in elk. S100G SNP is predicted to decrease the electrostatic potential and free energy of elk PrP. To the best of our knowledge, this is the first report of a strong association between the S100G SNP and susceptibility to CWD.
Acknowledgements
This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT) (2021R1A2C1013213, 2022R1C1C2004792). This research was supported by the Basic Science Research Program through the National Research Foundation (NRF) of Korea funded by the Ministry of Education (2017R1A6A1A03015876, 2021R1A6A3A01086488). This research was supported by APQA, Ministry for Agriculture, Food and Rural Affairs (B-1543085-22-24-01).
Authors' contributions
Y-RL, Y-CK, H-JS and B-HJ conceived and designed the experiment. Y-RL, Y-CK, S-YW, M-JJ, K-JP, H-CP and I-SR performed the experiments. Y-CK, S-YW, H-EK and B-HJ analyzed the data. Y-RL, Y-CK, H-JS and B-HJ wrote the paper. All authors read and approved the final manuscript.
Funding
National Research Foundation of Korea,2021R1A2C1013213,Byung-Hoon Jeong,2022R1C1C2004792,Yong-Chan Kim,2017R1A6A1A03015876,Byung-Hoon Jeong,2021R1A6A3A01086488,Yong-Chan Kim,APQA,Ministry for Agriculture,Food and Rural Affairs,B-1543085-22-24-01,Hyun-Joo Sohn
Data availability
All data are available from the corresponding authors upon reasonable request.
Declarations
Ethics approval and consent to participate
All experimental procedures were approved by the Institutional Animal Care and Use Committee of Jeonbuk National University (IACUC Number: JBNU-2019–0076). All experiments were carried out following the Korea Experimental Animal Protection Act.
Competing interests
The authors declare that they have no competing interests.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Yu-Ran Lee and Yong-Chan Kim contributed equally to this work.
Contributor Information
Hyun-Joo Sohn, Email: shonhj@korea.kr.
Byung-Hoon Jeong, Email: bhjeong@jbnu.ac.kr.
References
- 1.Prusiner SB. Prion biology and diseases. Science. 1991;252:1515–1522. doi: 10.1126/science.1675487. [DOI] [PubMed] [Google Scholar]
- 2.Will RG, Ironside JW. Sporadic and infectious human prion diseases. Cold Spring Harb Perspect Med. 2017;7:a024364. doi: 10.1101/cshperspect.a024364. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Kim YC, Won SY, Jeong BH. Altered expression of glymphatic system-related proteins in prion diseases: implications for the role of the glymphatic system in prion diseases. Cell Mol Immunol. 2021;18:2281–2283. doi: 10.1038/s41423-021-00747-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Benestad SL, Telling GC. Chronic wasting disease: an evolving prion disease of cervids. Handb Clin Neurol. 2018;153:135–151. doi: 10.1016/B978-0-444-63945-5.00008-8. [DOI] [PubMed] [Google Scholar]
- 5.Haley NJ, Hoover EA. Chronic wasting disease of cervids: current knowledge and future perspectives. Annu Rev Anim Biosci. 2015;3:305–325. doi: 10.1146/annurev-animal-022114-111001. [DOI] [PubMed] [Google Scholar]
- 6.Ferreira NC, Charco JM, Plagenz J, Orru CD, Denkers ND, Metrick MA, 2nd, Hughson AG, Griffin KA, Race B, Hoover EA, Castilla J, Nichols TA, Miller MW, Caughey B. Detection of chronic wasting disease in mule and white-tailed deer by RT-QuIC analysis of outer ear. Sci Rep. 2021;11:7702. doi: 10.1038/s41598-021-87295-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.O’Rourke KI, Besser TE, Miller MW, Cline TF, Spraker TR, Jenny AL, Wild MA, Zebarth GL, Williams ES. PrP genotypes of captive and free-ranging Rocky Mountain elk (Cervus elaphus nelsoni) with chronic wasting disease. J Gen Virol. 1999;80:2765–2769. doi: 10.1099/0022-1317-80-10-2765. [DOI] [PubMed] [Google Scholar]
- 8.Roh IS, Kim YC, Won SY, Jeong MJ, Park KJ, Park HC, Lee YR, Kang HE, Sohn HJ, Jeong BH. First report of a strong association between genetic polymorphisms of the prion protein gene (PRNP) and susceptibility to chronic wasting disease in sika deer (Cervus nippon) Transbound Emerg Dis. 2022;69:2073–2083. doi: 10.1111/tbed.14543. [DOI] [PubMed] [Google Scholar]
- 9.Robinson SJ, Samuel MD, O’Rourke KI, Johnson CJ. The role of genetics in chronic wasting disease of North American cervids. Prion. 2012;6:153–162. doi: 10.4161/pri.19640. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Arifin MI, Hannaoui S, Chang SC, Thapa S, Schatzl HM, Gilch S. Cervid prion protein polymorphisms: role in chronic wasting disease pathogenesis. Int J Mol Sci. 2021;22:2271. doi: 10.3390/ijms22052271. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Monello RJ, Galloway NL, Powers JG, Madsen-Bouterse SA, Edwards WH, Wood ME, O’Rourke KI, Wild MA. Pathogen-mediated selection in free-ranging elk populations infected by chronic wasting disease. Proc Natl Acad Sci U S A. 2017;114:12208–12212. doi: 10.1073/pnas.1707807114. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Haley NJ, Donner R, Henderson DM, Tennant J, Hoover EA, Manca M, Caughey B, Kondru N, Manne S, Kanthasamay A, Hannaoui S, Chang SC, Gilch S, Smiley S, Mitchell G, Lehmkuhl AD, Thomsen BV. Cross-validation of the RT-QuIC assay for the antemortem detection of chronic wasting disease in elk. Prion. 2020;14:47–55. doi: 10.1080/19336896.2020.1716657. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.White SN, Spraker TR, Reynolds JO, O’Rourke KI. Association analysis of PRNP gene region with chronic wasting disease in Rocky Mountain elk. BMC Res Notes. 2010;3:314. doi: 10.1186/1756-0500-3-314. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Perucchini M, Griffin K, Miller MW, Goldmann W. PrP genotypes of free-ranging wapiti (Cervus elaphus nelsoni) with chronic wasting disease. J Gen Virol. 2008;89:1324–1328. doi: 10.1099/vir.0.83424-0. [DOI] [PubMed] [Google Scholar]
- 15.Roh IS, Kim YC, Won SY, Park KJ, Park HC, Hwang JY, Kang HE, Sohn HJ, Jeong BH. Association study of the M132L single nucleotide polymorphism with susceptibility to chronic wasting disease in Korean elk: a meta-analysis. Front Vet Sci. 2021;8:804325. doi: 10.3389/fvets.2021.804325. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Moore SJ, Vrentas CE, Hwang S, West Greenlee MH, Nicholson EM, Greenlee JJ. Pathologic and biochemical characterization of PrPSc from elk with PRNP polymorphisms at codon 132 after experimental infection with the chronic wasting disease agent. BMC Vet Res. 2018;14:80. doi: 10.1186/s12917-018-1400-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Roh IS, Kim YC, Kim HJ, Won SY, Jeong MJ, Kang HE, Sohn HJ, Jeong BH. Identification of the prion-related protein gene (PRNT) sequences in various species of the Cervidae family. Mol Biol Rep. 2020;47:6155–6164. doi: 10.1007/s11033-020-05697-9. [DOI] [PubMed] [Google Scholar]
- 18.Roh IS, Kim YC, Kim HJ, Won SY, Jeong MJ, Hwang JY, Kang HE, Sohn HJ, Jeong BH. Polymorphisms of the prion-related protein gene are strongly associated with cervids' susceptibility to chronic wasting disease. Vet Rec. 2021;190:e940. doi: 10.1002/vetr.940. [DOI] [PubMed] [Google Scholar]
- 19.Sohn HJ, Kim JH, Choi KS, Nah JJ, Joo YS, Jean YH, Ahn SW, Kim OK, Kim DY, Balachandran A. A case of chronic wasting disease in an elk imported to Korea from Canada. J Vet Med Sci. 2002;64:855–858. doi: 10.1292/jvms.64.855. [DOI] [PubMed] [Google Scholar]
- 20.Fersht AR. AlphaFold - a personal perspective on the impact of machine learning. J Mol Biol. 2021;433:167088. doi: 10.1016/j.jmb.2021.167088. [DOI] [PubMed] [Google Scholar]
- 21.Guex N, Peitsch MC, Schwede T. Automated comparative protein structure modeling with SWISS-MODEL and Swiss-PdbViewer: a historical perspective. Electrophoresis. 2009;30:S162–173. doi: 10.1002/elps.200900140. [DOI] [PubMed] [Google Scholar]
- 22.Parthiban V, Gromiha MM, Schomburg D. CUPSAT: prediction of protein stability upon point mutations. Nucleic Acids Res. 2006;34:239–242. doi: 10.1093/nar/gkl190. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Capriotti E, Fariselli P, Casadio R. I-Mutant2.0: predicting stability changes upon mutation from the protein sequence or structure. Nucleic Acids Res. 2005;33:306–310. doi: 10.1093/nar/gki375. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Polziehn RO, Hamr J, Mallory FF, Strobeck C. Microsatellite analysis of North American wapiti (Cervus elaphus) populations. Mol Ecol. 2000;9:1561–1576. doi: 10.1046/j.1365-294x.2000.01033.x. [DOI] [PubMed] [Google Scholar]
- 25.Kim DJ, Kim YC, Kim AD, Jeong BH. Novel polymorphisms and genetic characteristics of the prion protein gene (PRNP) in dogs-a resistant animal of prion disease. Int J Mol Sci. 2020;21:4160. doi: 10.3390/ijms21114160. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Kim YC, Won SY, Do K, Jeong BH. Identification of the novel polymorphisms and potential genetic features of the prion protein gene (PRNP) in horses, a prion disease-resistant animal. Sci Rep. 2020;10:8926. doi: 10.1038/s41598-020-65731-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Kim YC, Jeong BH. The first report of polymorphisms and genetic characteristics of the prion protein gene (PRNP) in horses. Prion. 2018;12:245–252. doi: 10.1080/19336896.2018.1513316. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Adeola AC, Bello SF, Abdussamad AM, Mark AI, Sanke OJ, Onoja AB, Nneji LM, Abdullahi N, Olaogun SC, Rogo LD, Mangbon GF, Pedro SL, Hiinan MP, Mukhtar MM, Ibrahim J, Saidu H, Dawuda PM, Bala RK, Abdullahi HL, Salako AE, Kdidi S, Yahyaoui MH, Yin TT. Scrapie-associated polymorphisms of the prion protein gene (PRNP) in Nigerian native goats. Gene. 2022;855:147121. doi: 10.1016/j.gene.2022.147121. [DOI] [PubMed] [Google Scholar]
- 29.Kim SK, Kim YC, Won SY, Jeong BH. Potential scrapie-associated polymorphisms of the prion protein gene (PRNP) in Korean native black goats. Sci Rep. 2019;9:15293. doi: 10.1038/s41598-019-51621-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Haley N, Donner R, Merrett K, Miller M, Senior K. Selective breeding for disease-resistant PRNP variants to manage chronic wasting disease in farmed whitetail deer. Genes. 2021;12:1396. doi: 10.3390/genes12091396. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Mead S, Lloyd S, Collinge J. Genetic factors in mammalian prion diseases. Annu Rev Genet. 2019;53:117–147. doi: 10.1146/annurev-genet-120213-092352. [DOI] [PubMed] [Google Scholar]
- 32.Wang B, Lou Z, Zhang H, Xu B. Effect of the electrostatic surface potential on the oligomerization of full-length human recombinant prion protein at single-molecule level. J Chem Phys. 2016;144:114701. doi: 10.1063/1.4943878. [DOI] [PubMed] [Google Scholar]
- 33.Naganathan AN, Doshi U, Fung A, Sadqi M, Munoz V. Dynamics, energetics, and structure in protein folding. Biochemistry. 2006;45:8466–8475. doi: 10.1021/bi060643c. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Singh J, Kumar H, Sabareesan AT, Udgaonkar JB. Rational stabilization of helix 2 of the prion protein prevents its misfolding and oligomerization. J Am Chem Soc. 2014;136:16704–16707. doi: 10.1021/ja510964t. [DOI] [PubMed] [Google Scholar]
- 35.Rivera NA, Brandt AL, Novakofski JE, Mateus-Pinilla NE. Chronic wasting disease in cervids: prevalence, impact and management strategies. Vet Med. 2019;10:123–139. doi: 10.2147/VMRR.S197404. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Otero A, Velasquez CD, Aiken J, McKenzie D. Chronic wasting disease: a cervid prion infection looming to spillover. Vet Res. 2021;52:115. doi: 10.1186/s13567-021-00986-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Guere ME, Vage J, Tharaldsen H, Kvie KS, Bardsen BJ, Benestad SL, Vikoren T, Madslien K, Rolandsen CM, Tranulis MA, Roed KH. Chronic wasting disease in Norway-A survey of prion protein gene variation among cervids. Transbound Emerg Dis. 2021;69:e20–e31. doi: 10.1111/tbed.14258. [DOI] [PubMed] [Google Scholar]
- 38.Marsh RF, Kincaid AE, Bessen RA, Bartz JC. Interspecies transmission of chronic wasting disease prions to squirrel monkeys (Saimiri sciureus) J Virol. 2005;79:13794–13796. doi: 10.1111/tbed.14258. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Otero A, Duque Velasquez C, McKenzie D, Aiken J. Emergence of CWD strains. Cell Tissue Res. 2022 doi: 10.1007/s00441-022-03688-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Moore J, Tatum T, Hwang S, Vrentas C, West Greenlee MH, Kong Q, Nicholson E, Greenlee J. Novel strain of the chronic wasting disease agent isolated from experimentally inoculated elk with LL132 prion protein. Sci Rep. 2020;10:3148. doi: 10.1038/s41598-020-59819-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All data are available from the corresponding authors upon reasonable request.