Skip to main content
NCBI home page
Veterinary Research Forum logoLink to Veterinary Research Forum
. 2023 May 15;14(5):243–248. doi: 10.30466/vrf.2022.551346.3434

Molecular detection of methicillin-resistant Staphylococcus aureus isolated from different foodstuffs in Egypt

Doha Elsayed Naeim 1,*, Ibrahim Elsayed Eldesoukey 1, Amgad Ahmed Moawad 1, Ashraf Mohammed Ahmed 1
PMCID: PMC10278902  PMID: 37342285

Abstract

Methicillin-resistant Staphylococcus aureus (MRSA) infection is a major public health problem. Therefore, this study was aimed to estimate the prevalence of MRSA in various food products. A total number of 204 food samples including raw milk (n = 30), cheese (n = 60), chicken (n = 25), beef (n = 24) and fish (n = 65) were collected from August to November of 2021 within different localities in Kafr El-Sheikh governorate, the northern region of Egypt. All samples were assessed through a series of bacteriological and biochemical techniques to identify MRSA. Out of 204 samples, 52(25.49%) isolates were presumptively identified as MRSA on oxacillin resistance screening agar base media. Of these 52 isolates, 17(32.69%) were characterized as coagulase-positive. For the molecular confirmation of MRSA, all isolates were subjected to polymerase chain reaction assays to detect mecA and mecC. In addition, mecA was identified in all the isolates (100%), whereas, none was positive for mecC. Therefore, based on the detection of mecA, the overall occurrence rate of MRSA among the samples was 8.33%. The isolates were also subjected to antimicrobial susceptibility tests. Cefoxitin, cefuroxime, oxacillin and amoxicillin-clavulanic acid were completely resistant (100%) to the isolates, however, susceptible to vancomycin and ciprofloxacin. Raw milk had the highest prevalence of MRSA (13.30%), followed by chicken (12.00%), fish (9.20%), cheese (5.00%) and beef (4.20%). Due to the possibility of transmission of these strains to humans, the high prevalence of MRSA in various foodstuffs in Egypt poses a potential public health risk.

Key Words: Egypt, Food, MRSA, Polymerase chain reaction

Introduction

Antimicrobial resistance is one of the most serious worldwide issue today. It leads to millions of fatalities, long-term impairments and higher medical expenditures. It also has a negative influence on livelihoods, poses a danger to food security and causes animal deaths.1 Antimicrobial resistance is widely regarded as one of the most serious threat to humanity in the 21st century.2 Epidemiological investigation has demonstrated a direct relationship between the extensive use of antimicrobials, whether in human or veterinary medicine, and the spread of resistant bacterial strains.3 These resistant bacteria have the potential to infect humans, thereby, causing severe systemic infections. Most Staphylococcus aureus strains are penicillin- and derivative-resistant due to penicillinase production.4 Also, certain strains, known as methicillin-resistant S. aureus (MRSA), are resistant to methicillin.5 The MRSA strains induce resistance through a highly transmissible mobile genetic element-staphylococcal cassette chromosome mec (SCCmec)-which harbors mecA and its analog mecC encode penicillin-binding protein 2a (PBP2a).6 By interfering with the drugs ability to bind to cell wall proteins, both genes provide resistance to methicillin and other beta-lactam antibiotics.7

Recently, MRSA has emerged as a significant public healthcare concern and a potentially lethal infective agent due to its ineffective response to various antibiotic classes.7 Moreover, it is regarded as the most prevalent pathogen in human nosocomial infections.3 The MRSA is frequently found in animal-sourced foodstuffs intended for human consumption, especially meat.8 Therefore, the presence of MRSA in animal-sourced foodstuffs such as meat, milk, dairy products and fish strongly suggests the potential transmission of these resistant strains to humans,9 which adds to the evidence of its zoonotic potential.10 Globally, many studies have identified MRSA in several animal-sourced foodstuffs including raw milk,11 dairy products,12 retail meat and meat products,13 retail chicken,14,15 and fish,16 with varying prevalence rates. Currently, data on the presence of MRSA in food, especially in dairy products, meat products and fish are scarce. Therefore, this study conducted a molecular investigation of MRSA strains in some foodstuffs including raw milk, cheese, chicken, beef and fish in Egypt.

Materials and Methods

Sample collection . From August to November of 2021, a total number of 204 samples including 90 dairy products (30 milk, and 60 cheese samples), 49 meat products (25 chicken, and 24 beef samples), and 65 fish samples were collected from local markets within different localities in Kafr El-Sheikh governorate, the northern region of Egypt. Each sample was labeled, placed in an icebox and trans-ferred immediately to bacteriology laboratory, Faculty of Veterinary Medicine, Kafrelsheikh University, Kafr El-Sheikh, Egypt for bacteriological examination. Ethical approval was obtained from Research, Publication and Ethics Committee of the Faculty of Veterinary Medicine, Kafrelsheikh University, Kafr El-Sheikh, Egypt. The committee ensures compliance with all relevant Egyptian legislations.

Preparation of samples. Briefly, samples (25.00 g or mL) were placed in stomacher bags containing 225 mL of buffered peptone water. After homogenization of the samples at 320 rpm for 2 min and overnight incubation at 37.00 ˚C, 0.10 mL aliquots were inoculated into tubes containing 10.00 mL of tryptic soy broth (TSB; Oxoid, Basingstoke, UK) supplemented with 6.50% NaCl, as previously described by Tang et al.17

Isolation and identification of S. aureus and MRSA . The MRSA was isolated as previously described by Aklilu and Chia22 with some modifications. Briefly, 0.10 mL of the inoculated TSB was plated on oxacillin resistance screening agar base plates (ORSAB; Oxoid). After incubation at 37.00 ˚C for 24 to 48 hr, representative intense blue-colored colonies on ORSAB (presumptive identified as MRSA) were further subjected to Gram staining for morphological confirmation and standard biochemical tests including catalase and coagulase tests for confirmation of S. aureus.

Antimicrobial susceptibility testing . The antibiotic sensitivity phenotypes of bacterial isolates were determined using the Kirby-Bauer disc diffusion assay on Mueller-Hinton agar according to Clinical and Laboratory Standards Institute (CLSI) interpretive criteria.18 The following anti-microbials were used: sulfamethoxazole/trimethoprim (SXT) 23.75/1.25 μg; cefoxitin (FOX) 30.00 μg; oxacillin (OXA) 1.00 μg; cefuroxime (CXM) 30.00 μg; amoxicillin (AMX) 10.00 μg; amoxicillin/clavulanic acid (AMC) 20.00/10.00 μg; vancomycin (VAN) 30.00 μg; ampicillin (AMP) 10.00 μg; ciprofloxacin (CIP) 5.00 μg; and cefazolin (CFZ) 30.00 μg. The discs were purchased from Oxoid and the results were recorded in accordance with CLSI guidelines.18

DNA extraction and molecular detection of mecA and mecC . Following the manufacturer's instructions, DNA was extracted from all isolates using the QIAamp DNA micro kit (Qiagen, Hilden, Germany) and bacterial coagulase-positive status was confirmed. Polymerase chain reaction (PCR) assays were used to detect mecA and mecC responsible for resistance to methicillin and other beta-lactam antibiotics in S. aureus strains. To detect mecA, PCR with primers (Fisher Scientific Company LLC., Pittsburgh, USA) mecA-F (5′ GTAGAAATGACTGAACGTCCGATAA ′3) and mecA-R (5′ CCAATTCCACATTGTTTCGGTCTA A ′3) was performed to amplify the 310 bp gene as previously described by McClure et al.19 To detect mecC, mecC-F (5′ GCTCCTAATGCTAATGCA′3) and mecC-R (5′ TAAGCAATAA TGACTACC ′3) primers were used to amplify the 304 bp gene according to a previously described protocol by Cuny et al.20 The negative control for mecA and mecC was deionized water. All PCR assays were performed in a total volume of 25.00 μL which included 12.50 μL of Emerald Amp GT PCR master mix (2X premix), 1.00 μL of 20.00 pmol of each forward and reverse primer, 5.00 μL of bacterial DNA template, and 5.50 μL nuclease-free water. The PCR assays were performed as uniplex reactions using a T3 Thermal cycler (Master cycler; Eppendorf, Hamburg, Germany) under the following cycling conditions: Initial denaturation at 94.00 ˚C for 5 min followed by 35 cycles of denaturation at 94.00 ˚C for 30 sec, annealing at 50.00 ˚C for 30 sec, extension at 72.00 ˚C for 30 sec and a final extension at 72.00 ˚C for 10 min. Finally, each amplified PCR product was electrophoresed on 1.50% agarose (Sigma-Aldrich, St. Louis, USA) prepared in 1X Tris Borate EDTA (TBE) buffer (New England BioLabs Inc., Ipswich, USA) and then stained with 0.50 µg mL-1 ethidium bromide (Sigma-Aldrich). The gel was then examined and photographed under a UV transilluminator (Fisher Scientific Company LLC).

Results

Prevalence of MRSA in foodstuffs. A total number of 204 samples of different foodstuffs of animal origin were screened for MRSA among which 52 (25.49%) isolates were presumptively identified on ORSAB media as MRSA. Of these 52 isolates, 17(32.69%) were identified as coagulase-positive S. aureus (Table 1).

PCR-based molecular detection of mecA and mecC by PCR. For the molecular detection of MRSA, all coagulase-positive S. aureus identified in this study were screened for the presence of both mecA and mecC using uniplex PCR assays. Interestingly, mecA (gene responsible of methicillin-resistance) was identified in all the isolates examined (100%; Fig. 1), whereas, mecC was not detected in any isolate. Consequently, based on the detection of mecA, the overall prevalence of MRSA in the examined samples was 8.33%. Raw milk had the highest prevalence of MRSA (13.30%) followed by chicken (12.00%), fish (9.20%), cheese (5.00%), and beef (4.20%) (Table 1).

Fig. 1.

Fig. 1

Open in a new tab

Agarose gel electrophoresis patterns of the PCR product of amplicon (310 bp) of mecA (Lane L: 100 bp DNA ladder as a molecular-size DNA marker, Lane P: Positive control for mecA, Lane N: Negative control (deionized water) for mecA, Lanes (1-17): Analyzed samples of S. aureus isolates showing the positive 310 bp amplicon of mecA

Table 1.

Prevalence of methicillin-resistant Staphylococcus aureus (MRSA) in foodstuffs of animal origin. Data are presented as number (%) of samples.

Sample No. ORSAB media Coagulase test mecA mecC
Dairy products
Milk 30 10 (33.33) 4(13.33) 4(13.33) 0(0.00)
Cheese 60 10(16.66) 3(5.00) 3(5.00) 0(0.00)
Meat products
Beef 24 8(33.33) 1(4.16) 1(4.16) 0(0.00)
Chicken 25 8(32.00) 3(12.00) 3(12.00) 0(0.00)
Fish 65 21(32.30) 6(9.23) 6(9.23) 0(0.00)
Total 204 50(24.50) 17(8.33) 17(8.33) 0(0.00)
Open in a new tab

Antimicrobial susceptibility testing of MRSA isolates. Antimicrobial susceptibility testing revealed variable rates of MRSA isolates resistance to the tested antimicrobial agents. Overall, absolute resistance (100%) was observed against cefoxitin, cefuroxime, oxacillin and amoxicillin/clavulanic acid, whereas, perceptible resistance was observed against ampicillin, amoxicillin, cefazolin and sulfamethoxazole/trimethoprim with 63.46%, 61.53%, 42.30% and 36.53% of the isolates being resistant, respectively. Conversely, lower resistance was observed against vancomycin and ciprofloxacin by 28.84% and 25.00%, respectively (Table 2). All isolates were found to be multidrug-resistant (MDR) indicating they were resistant to at least three different classes of antibiotics.

Table 2.

Antimicrobial susceptibility testing of S. aureus isolates. Data are presented as number (%) of samples.

Antimicrobials Milk (n = 16) Cheese (n =9) Chicken (n = 5) Beef (n = 8) Fish (n = 14) Total (n = 52)
Cefoxitin 16 (100) 9 (100) 5 (100) 8 (100) 14 (100) 52 (100)
Cefuroxime 16 (100) 9 (100) 5 (100) 8 (100) 14 (100) 52 (100)
Amoxicillin/clavulanic acid 16 (100) 9 (100) 5 (100) 8 (100) 14 (100) 52 (100)
Oxacillin 16 (100) 9 (100) 5 (100) 8 (100) 14 (100) 52 (100)
Ampicillin 8 (50.00) 5 (55.55) 4 (80.00) 6 (75.00) 9 (64.29) 33 (63.46)
Amoxicillin 10 (62.50) 5 (55.55) 3 (60.00) 5 (62.50) 9 (64.29) 32 (61.53)
Cefazolin 6 (37.50) 3 (33.33) 4 (80.00) 3 (37.50) 5 (35.71) 22 (42.30)
Sulfamethoxazole/trimethoprim 5 (31.20) 2 (22.22) 1 (20.00) 4 (50.00) 7 (50.00) 19 (36.53)
Vancomycin 4 (25.00) 3 (33.33) 3 (60.00) 2 (25.00) 3 (21.42) 15 (28.84)
Ciprofloxacin 1 (6.25) 1 (11.11) 2 (40.00) 4 (50.00) 4 (28.57) 13 (25.00)
Open in a new tab

Discussion

MRSA is widely regarded as one of the most serious threat to healthcare facilities worldwide due to the emergence and dissemination of resistant isolates that are resistant to methicillin, other β-lactams, andalso several antibiotic classes.21 Recently, several reports have documented the widespread of these strains outside the hospital environment in animals and the community.22 In addition, MRSA is a major public health concern because of its ability to contaminate animal-origin foods and infect humans and animals.23

 The detection of mecA or its analog mecC is the gold standard for identifying MRSA species.24 Recently, it has been discovered that methicillin resistance in S. aureus is caused by factors other than mecA. A novel mecA homolog, mecC, was discovered in bovine and human isolates from the United Kingdom and Denmark.25 Only 70.00% of the nucleotides in this gene is identical to those in mecA and only 63.00% of the amino acids is identical to those in the original PBP2a (encoded by mecA).10 Interestingly, mecA was identified in all the examined isolates in this study, whereas, mecC was not detected in any of them which was in agreement with the findings of recent investigations.26,27

This study investigated the prevalence of MRSA in different foodstuffs, raw milk, cheese, chicken, beef and fish. Based on the PCR amplification results of mecA and mecC, only 17(8.33%) samples out of 204 tested were contaminated by MRSA. From beef, chicken, cheese, raw milk and fish samples, 1(4.20%), 3(12.00%), 3(5.00%), 4(13.30%) and 6(9.20%) isolates were obtained, respectively. Similar findings were reported in India by Mohanta and Mazumder28 and in Italy by Basanisi et al.29 with prevalence rates of 8.93% and 8.33%, respectively. Nevertheless, a higher prevalence of MRSA in foodstuffs was reported in Brazil by Costa et al. (28.10%),8 in Sudan by Yahya Ahmed et al.30 (17.00%), and in Algeria by Chaalal et al.31 (16.90%), whereas, lower prevalence rates of 5.60% and 4.10% were recorded in China by Song et al.32 and in Algeria by Titouche et al.,33 respectively. These variations in the prevalence rate of MRSA could be attributed to many factors including sample type and area of sampling. 

The MRSA is frequently found in meat and meat products and it plays a substantial role in human food poisoning infection.34 In this study, four MRSA strains were identified out of the examined 49(8.16%) chicken and beef samples. Previous estimates of the worldwide prevalence of MRSA in meat have ranged from < 1.00% in the Netherlands as reported by de Boer et al.35 to 11.90% in Korea as reported by Kwon et al.36 In Egypt, Whole chicken carcasses had a higher prevalence rate (44.00%).37 Meat contamination with MRSA could indicate improper handling and processing by individuals.38 Dressed carcasses sanitary state is mainly determined by slaughterhouse hygiene and worker skill.39

Out of 30 raw milk samples, 4(13.30%) MRSA isolates were identified in this study. These results were consistent with the findings of a recent study in Brazil by Silva et al.3 that identified MRSA in raw milk with a prevalence rate of 13.70%. Nevertheless, other studies in Egypt reported high 100% and 87.50% prevalence rates. 31,40 However, a lower prevalence rate was previously reported in China (2.74%) by Wang et al.41 and in South Africa (1.20%) by Pekana and Green.42

Regarding the prevalence of MRSA in cheese, our findings revealed a rate of 5.00%. A higher prevalence rate of MRSA (40.00%) was reported in Egypt by Al-Ashmawy et al.12 However, in a more recent investigation in Brazil, a prevalence rate (of MRSA) of 13.70% in cheese was reported by Silva et al.3 Compared to other food products, the low prevalence of MRSA in cheese might be attributed partially to the acidity of the product which could limit survival of most bacteria including S. aureus.12

In the present study, the prevalence of MRSA in fish was 9.20% which was consistent with the findings obtained in Nigeria43 (6.60%) and Malaysia44 (8.75%). Although higher prevalence rates of 35.00% and 30.00% were reported in other studies in Brazil and Malaysia, respectively. 8,45

Furthermore, all MRSA isolates in this study were examined for antimicrobial resistance against 10 anti-microbial agents belonging to different classes of antibiotics. There was absolute resistance to cefoxitin, cefuroxime, oxacillin, amoxicillin/clavulanic acid, ampicillin, amoxicillin and cefazolin. These observations supported the findings of earlier studies.46,47 The observed resistance was probably due to a plasmid-encoded penicillinase β-lactamase produced by S. aureus with bla.48 However, we detected significant susceptibility against vancomycin and ciprofloxacin. MRSA strains frequently develop MDR as reported by Shahid et al.27 and Fri et al.49 In the current study, MDR (resistance to at least three different antibiotic classes) was observed among MRSA isolates. This finding was consistent with those of previous studies.46,50 In our investigation, we found that milk was the most important dietary source for antibiotic resistance in humans followed by cheese, fish, chicken and meat in the order. This variation in antibiotic resistance patterns could be due to the differences in the sources of isolates, geographical locations and the overall antibiotics used. 

The MRSA was found in 8.33% of the samples tested. It was the most prevalent in raw milk (13.30%) followed by chicken (12.00%), fish (9.20%), cheese (5.00%) and beef (4.20%). These findings suggested that antibiotic-resistant S. aureus strains were not only nosocomial, but also prevalent in food. Our investigation was confined to the presence of S. aureus in various meals and the items examined were often consumed by locals in the area. As a consequence, we believed that resistance rates against tested antibiotics were found to be high among the isolates. Presence of multidrug-resistant S. aureus strains was a significant issue that should be highlighted in terms of public health and food safety.

Conflict of interest

The authors declare that they have no conflict of interest.

Acknowledgments

The authors are thankful to The Department of Bacteriology, Mycology and Immunology, Faculty of Veterinary Medicine, Kafrelsheikh University, Kafr El-Sheikh, Egypt.

References

  • 1.WHO. UNEP. Antimicrobial resistance and the United Nations Sustainable Development Cooperation Frame-work. 2021. [Google Scholar]
  • 2.Mahdi WKM, Hassuna NA, Esmail MA, et al. Molecular typing of methicillin resistant Staphylococcus aureus colonizing Egyptian healthcare workers and patients. Int J Curr Microbiol Appl Sci. 2016;5(6):687–698. [Google Scholar]
  • 3.Silva V, Capelo JL, Igrejas G, et al. Molecular epidemiology of Staphylococcus aureus lineages in wild animals in Europe: a review. Antibiotics (Basel) 2020;9(3):122. doi: 10.3390/antibiotics9030122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Peacock SJ, Paterson GK. Mechanisms of methicillin resistance in Staphylococcus aureus. Annu Rev Biochem. 2015;84:577–601. doi: 10.1146/annurev-biochem-060614-034516. [DOI] [PubMed] [Google Scholar]
  • 5.Gajdács M. The continuing threat of methicillin-resistant Staphylococcus aureus. Antibiotics (Basel) 2019;8(2):52. doi: 10.3390/antibiotics8020052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Paterson GK, Morgan FJ, Harrison EM, et al. Prevalence and properties of mecC methicillin-resistant Staphylo-coccus aureus (MRSA) in bovine bulk tank milk in Great Britain. J Antimicrob Chemother. 2014;69(3):598–602. doi: 10.1093/jac/dkt417. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Kamal RM, Bayoumi MA, Abd El Aal SFA. MRSA detection in raw milk, some dairy products and hands of dairy workers in Egypt, a mini-survey. Food Control. 2013;33(1):49–53. [Google Scholar]
  • 8.Costa WL, Ferreira Jdos S, Carvalho JS, et al. Methicillin-resistant Staphylococcus aureus in raw meats and prepared foods in public hospitals in salvador, Bahia, Brazil. J Food Sci. 2015;80(1):M147–M150. doi: 10.1111/1750-3841.12723. [DOI] [PubMed] [Google Scholar]
  • 9.Huber H, Ziegler D, Pflüger V, et al. Prevalence and characteristics of methicillin-resistant coagulase-negative staphylococci from livestock, chicken carcasses, bulk tank milk, minced meat, and contact persons. BMC Vet Res. 2011;7(1):6 . doi: 10.1186/1746-6148-7-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Aires-de-Sousa M. Methicillin-resistant Staphylococcus aureus among animals: current overview. Clin Microbiol Infect. 2017;23(6):373–380. doi: 10.1016/j.cmi.2016.11.002. [DOI] [PubMed] [Google Scholar]
  • 11.Ben Said M, Abbassi MS, Bianchini V, et al. Genetic characterization and antimicrobial resistance of Staphylococcus aureus isolated from bovine milk in Tunisia. Lett Appl Microbiol. 2016;63(6):473–481. doi: 10.1111/lam.12672. [DOI] [PubMed] [Google Scholar]
  • 13.Chairat S, Gharsa H, Lozano C, et al. Characterization of Staphylococcus aureus from raw meat samples in Tunisia: Detection of clonal lineage ST398 from the African continent. Foodborne Pathog Dis. 2015;12(8):686–692. doi: 10.1089/fpd.2015.1958. [DOI] [PubMed] [Google Scholar]
  • 14.Abolghait SK, Fathi AG, Youssef FM, et al. Methicillin-resistant Staphylococcus aureus (MRSA) isolated from chicken meat and giblets often produces staphylo-coccal enterotoxin B (SEB) in non-refrigerated raw chicken livers. Int J Food Microbiol. 2020;328:108669. doi: 10.1016/j.ijfoodmicro.2020.108669. [DOI] [PubMed] [Google Scholar]
  • 15.Okorie-Kanu OJ, Anyanwu MU, Ezenduka EV, et al. Molecular epidemiology, genetic diversity and antimicrobial resistance of Staphylococcus aureus isolated from chicken and pig carcasses, and carcass handlers. PLoS One. 2020;15(5):e0232913. doi: 10.1371/journal.pone.0232913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Hammad AM, Watanabe W, Fujii T, et al. Occurrence and characteristics of methicillin-resistant and -susceptible Staphylococcus aureus and methicillin-resistant coagulase-negative staphylococci from Japanese retail ready-to-eat raw fish. Int J Food Microbiol. 2012;156(3):286–289. doi: 10.1016/j.ijfoodmicro.2012.03.022. [DOI] [PubMed] [Google Scholar]
  • 17.Tang Y, Qiao Z, Wang Z, et al. The prevalence of Staphylococcus aureus and the occurrence of MRSA CC398 in monkey feces in a zoo park in eastern China. Animals (Basel) 2021;11(3):732. doi: 10.3390/ani11030732. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.CLSI. Performance standards for antimicrobial susceptibility testing, 30th ed. CLSI supplement M100. Clinical and Laboratory Standards Institute. 2020. [Google Scholar]
  • 19.McClure JA, Conly JM, Lau V, et al. Novel multiplex PCR assay for detection of the staphylococcal virulence marker Panton-Valentine leukocidin genes and simultaneous discrimination of methicillin-susceptible from -resistant staphylococci. J Clin Microbiol. 2006;44(3):1141–1144. doi: 10.1128/JCM.44.3.1141-1144.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Cuny C, Layer F, Strommenger B, et al. Rare occurrence of methicillin-resistant Staphylococcus aureus CC130 with a Novel mecA homologue in humans in Germany. PLoS One. 2011;6(9):e24360 . doi: 10.1371/journal.pone.0024360. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Islam MA, Alam MM, Uddin MS, et al. Detection of methicillin-resistant staphylococcus aureus (MRSA) from animal and human origin in Bangladesh by poly-merase chain reaction. Bangl J Vet Med. 2011;9(2):161–166. [Google Scholar]
  • 22.Aklilu E, Chia HY. First mecC and mecA positive livestock-associated methicillin resistant Staphylococcus aureus (mecC MRSA/LA-MRSA) from dairy cattle in Malaysia. Microorganisms. 2020;8(2):147. doi: 10.3390/microorganisms8020147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Petinaki E, Spiliopoulou I. Methicillin-resistant Staphylococcus aureus among companion and food-chain animals: impact of human contacts. Clin Microbiol Infect. 2012;18(7):626–634. doi: 10.1111/j.1469-0691.2012.03881.x. [DOI] [PubMed] [Google Scholar]
  • 24.Aljahani AH, Alarjani KM, Hassan ZK, et al. Molecular detection of methicillin heat-resistant Staphylococcus aureus strains in pasteurized camel milk in Saudi Arabia. Biosci Rep. 2020;40(4):BSR20193470. doi: 10.1042/BSR20193470. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.García-Álvarez L, Holden MT, Lindsay H, et al. Meticillin-resistant Staphylococcus aureus with a novel mecA homologue in human and bovine populations in the UK and Denmark: a descriptive study. Lancet Infect Dis. 2011;11(8):595–603. doi: 10.1016/S1473-3099(11)70126-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Venugopal N, Mitra S, Tewari R, et al. Molecular detection and typing of methicillin-resistant Staphylococcus aureus and methicillin-resistant coagulase-negative staphylococci isolated from cattle, animal handlers, and their environment from Karnataka, Southern Province of India. Vet world. 2019;12(11):1760–1768. doi: 10.14202/vetworld.2019.1760-1768. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Shahid AH, Nazir KHMNH, El Zowalaty ME, et al. Molecular detection of vancomycin and methicillin resistance in Staphylococcus aureus isolated from food processing environments. One Health. 2021;13:100276. doi: 10.1016/j.onehlt.2021.100276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Mohanta A, Mazumder PB. Detection of staphylococci in raw milk and milk products and evaluation of their antibiotic sensitivity: a report from Southern Assam, Indian. IOSR J Environ Sci Toxicol Food Technol. 2015;9(1):17–22. [Google Scholar]
  • 29.Basanisi MG, La Bella G, Nobili G, et al. Genotyping of methicillin-resistant Staphylococcus aureus (MRSA) isolated from milk and dairy products in South Italy. Food Microbiol. 2017;62:141–146. doi: 10.1016/j.fm.2016.10.020. [DOI] [PubMed] [Google Scholar]
  • 30.Yahya Ahmed MY, Abdalbagi Ali H, Mohammed Taher Gorish B, et al. Molecular detection of Staphylococcal enterotoxins and mecA genes products in selected food samples collected from different areas in Khartoum State. Int J Microbiol. 2021;2021:5520573. doi: 10.1155/2021/5520573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Song M, Bai Y, Xu J, et al. Genetic diversity and virulence potential of Staphylococcus aureus isolates from raw and processed food commodities in Shanghai. Int J Food Microbiol. 2015;195:1–8. doi: 10.1016/j.ijfoodmicro.2014.11.020. [DOI] [PubMed] [Google Scholar]
  • 33.Titouche Y, Hakem A, Houali K, et al. Emergence of methicillin-resistant Staphylococcus aureus (MRSA) ST8 in raw milk and traditional dairy products in the Tizi Ouzou area of Algeria. J Dairy Sci. 2019;102(8):6876–6884. doi: 10.3168/jds.2018-16208. [DOI] [PubMed] [Google Scholar]
  • 34.Datta S, Akter A, Shah IG, et al. Microbiological quality assessment of raw meat and meat products, and antibiotic susceptibility of isolated Staphylococcus aureus. Agric Food Anal Bacteriol. 2012;2(3):187–194. [Google Scholar]
  • 35.de Boer E, Zwartkruis-Nahuis JTM, Wit B, et al. Prevalence of methicillin-resistant Staphylococcus aureus in meat. Int J Food Microbiol. 2009;134(1-2):52–56. doi: 10.1016/j.ijfoodmicro.2008.12.007. [DOI] [PubMed] [Google Scholar]
  • 36.Kwon NH, Park KT, Jung WK, et al. Characteristics of methicillin resistant Staphylococcus aureus isolated from chicken meat and hospitalized dogs in Korea and their epidemiological relatedness. Vet Microbiol. 2006;117(2-4):304–312. doi: 10.1016/j.vetmic.2006.05.006. [DOI] [PubMed] [Google Scholar]
  • 37.Karmi M. Prevalence of methicillin-resistant Staphylococcus aureus in poultry meat in Qena, Egypt. Vet World. 2013;6(10):711–715. [Google Scholar]
  • 38.Hatakka M, Björkroth KJ, Asplund K, et al. Genotypes and enterotoxicity of Staphylococcus aureus isolated from the hands and nasal cavities of flight-catering employees. J Food Prot. 2000;63(11):1487–1491. doi: 10.4315/0362-028x-63.11.1487. [DOI] [PubMed] [Google Scholar]
  • 39.Manna SK, Brahmane MP, Manna C, et al. Occurrence, virulence characteristics and antimicrobial resistance of Escherichia coli O157 in slaughtered cattle and diarrhoeic calves in West Bengal, India. Lett Appl Microbiol. 2006;43(4):405–409. doi: 10.1111/j.1472-765X.2006.01975.x. [DOI] [PubMed] [Google Scholar]
  • 40.Algammal AM, Hetta HF, Elkelish A, et al. Methicillin-resistant Staphylococcus aureus (MRSA): One health perspective approach to the bacterium epidemiology, virulence factors, antibiotic-resistance, and zoonotic impact. Infect Drug Resist. 2020;13:3255–3265. doi: 10.2147/IDR.S272733. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Wang D, Wang Z, Yan Z, et al. Bovine mastitis Staphylococcus aureus: antibiotic susceptibility profile, resistance genes and molecular typing of methicillin-resistant and methicillin-sensitive strains in China. Infect Genet Evol. 2015;31:9–16. doi: 10.1016/j.meegid.2014.12.039. [DOI] [PubMed] [Google Scholar]
  • 42.Pekana A, Green E. Antimicrobial resistance profiles of Staphylococcus aureus isolated from meat carcasses and bovine milk in abattoirs and dairy farms of the Eastern Cape, South Africa. Int J Environ Res Public Health. 2018;15(10):2223 . doi: 10.3390/ijerph15102223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Grema HA, Geidam YA, Gadzama GB, et al. Methicillin resistant Staphyloccus aureus (MRSA): a review. Adv Anim Vet Sci. 2015;3(2):79–98. [Google Scholar]
  • 44.Atyah MA, Zamri-Saad M, Siti-Zahrah A. First report of methicillin-resistant Staphylococcus aureus from cage-cultured tilapia (Oreochromis niloticus) Vet Microbiol. 2010;144(3-4):502–504. doi: 10.1016/j.vetmic.2010.02.004. [DOI] [PubMed] [Google Scholar]
  • 45.Othman BR, Kuan CH, Mohammed AS, et al. Occurrence of methicillin-resistant Staphylococcus aureus in raw shellfish at retail markets in Malaysia and antibacterial efficacies of black seed (Nigella sativa) oil against MRSA. Food Control. 2018;90:324–331. [Google Scholar]
  • 46.El-Deeb W, Fayez M, Elmoslemany A, et al. Methicillin resistant Staphylococcus aureus among goat farms in Eastern province, Saudi Arabia: Prevalence and risk factors. Prev Vet Med. 2018;156:84–90. doi: 10.1016/j.prevetmed.2018.05.005. [DOI] [PubMed] [Google Scholar]
  • 47.Abdel-Moein KA, Zaher HM. Occurrence of multidrug-resistant methicillin-resistant Staphylococcus aureus among healthy farm animals: a public health concern. Int J Vet Sci Med. 2019;7(1):55–60. doi: 10.1080/23144599.2019.1689630. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Babic M, Hujer AM, Bonomo RA. What's new in antibiotic resistance? Focus on beta-lactamases. Drug Resist Updat. 2006;9(3):142–156. doi: 10.1016/j.drup.2006.05.005. [DOI] [PubMed] [Google Scholar]
  • 49.Fri J, Njom HA, Ateba CN, et al. Antibiotic resistance and virulence gene characteristics of methicillin-resistant Staphylococcus aureus (MRSA) isolated from healthy edible marine fish. Int J Microbiol. 2020;2020:803903. doi: 10.1155/2020/9803903. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.El-Adawy H, Ahmed M, Hotzel H, et al. Characterization of methicillin-resistant Staphylococcus aureus isolated from healthy turkeys and broilers using DNA microarrays. Front microbiol. 2016;7:2019. doi: 10.3389/fmicb.2016.02019. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Veterinary Research Forum are provided here courtesy of Faculty of Veterinary Medicine, Urmia University, Urmia, Iran

RESOURCES