Immediate early response 3 gene promotes aggressive progression and autophagy of AML by negatively regulating AKT/mTOR

Yimin Chen; Zhenqian Huang; Shuyi Chen; Li Tan; Lang He; Danyun Yuan; Lixia Zheng; Jing hua Zhong; Anqiao Li; Heng Zhang; Huo Tan; Lihua Xu

doi:10.1016/j.tranon.2023.101711

. 2023 Jun 14;35:101711. doi: 10.1016/j.tranon.2023.101711

Immediate early response 3 gene promotes aggressive progression and autophagy of AML by negatively regulating AKT/mTOR

Yimin Chen ^a,^*, Zhenqian Huang ^a,^*, Shuyi Chen ^b, Li Tan ^a, Lang He ^a, Danyun Yuan ^a, Lixia Zheng ^a, Jing hua Zhong ^c,^e, Anqiao Li ^a, Heng Zhang ^a, Huo Tan ^d,^†, Lihua Xu ^a,^e,^†

PMCID: PMC10285281 PMID: 37327583

Highlights

•
Immediate early response 3 gene promotes aggressive progression and autophagy of AML by negatively regulating AKT/mTOR.

Keywords: IER3, acute myeloid leukemia, proliferation, autophagy, AKT/mTOR

Abstract

Background

Immediate early response 3 (IER3) plays a vital role in many tumors. This study aims to explore the function and mechanism of IER3 in Acute myeloid leukemia (AML).

Methods

The expression of IER3 in AML was performed by bioinformatics analysis. CCK-8 proliferation assay, flow cytometry cycle assay, clone formation assay, and tumorigenic ability were used to investigate the effect of IER3 on AML cells. Unbiased label-free quantitative proteomics and label-free quantitative phosphoproteomics analysis were performed. The regulatory relationship between SATB1(Special AT-rich sequence binding protein 1) and IER3 was investigated by Real time-PCR, Western blot, Chromatin immunoprecipitation (CHIP), and PCR.

Results

The result indicated that the prognosis of the high IER3 expression group was significantly worse than that of the low expression group. CCK-8 assay showed that IER3 enhanced the proliferation ability. Cell cycle analysis showed IER3 could promote HL60 cells to enter the S phase of DNA synthesis from the quiescent phase. IER3 could stimulate HEL cells to enter mitosis. Clone-formation experiments suggested that IER3 enhanced clonogenic ability.IER3 promoted the tumorigenesis of AML. Further experimental investigation revealed that IER3 promoted autophagy and induced the occurrence and development of AML by negatively regulating the phosphorylation activation of AKT/mTOR pathway. SATB1 was found to bind to the promoter region of IER3 gene and negatively regulate its transcription.

Conclusion

IER3 could promote the development of AML and induce autophagy of AML cells by negatively regulating the phosphorylation and activation of AKT/mTOR. By the way, SATB1 may negatively target regulates IER3 transcription.

Introduction

As a member of hematological malignancy, acute myeloid leukemia (AML) is a heterogeneous disease characterized by immature myeloid stem cell cloning and expansion, abnormal proliferation, and differentiation, resulting in hematopoietic impairment and bone marrow failure [1]. AML is the most common acute leukemia in adult patients, involving bone marrow, peripheral blood, and extramedullary tissue, and its incidence increases with age [2]. In 2021, the American Cancer Society estimated that there were nearly 20,000 new cases of AML, including about 11,000 deaths [3].

With continuous research on the molecular structure of AML, the treatment of AML has developed from traditional chemotherapy to later targeted therapy [4]. Targeted therapy provides a new therapeutic approach for AML patients, and cytogenetic markers have become the most important markers for risk stratification and treatment of AML patients. However, even with the emergence of new treatment regimens, the problems of drug resistance and disease recurrence remain unresolved, and the majority of AML patients do not eventually recover [4]. Therefore, at the basic level, current research still focuses on AML disease from the molecular perspective and finding new targets for treating AML.

Immediate Early Response 3 (IER3) is a stress-inducing gene that plays a key role in cell survival under stress conditions [5]. IER3 is highly expressed in skin, gastrointestinal tract, vascular endothelial, bladder, kidney, and other epithelial tissues, but weakly expressed in nerves and islets [6].

The role of IER3 in other tumors has been studied. IER3 regulates various cellular processes, including proliferation, DNA repair, apoptosis, and differentiation, with responses that vary depending on the cell environment. There is growing evidence that IER3 can promote or inhibit cancer in different types of cancers. IER3 acts as a cancer suppressor gene in cervical cancer [7], ovarian cancer [8], pancreatic cancer [9], liver cancer [10] and colon cancer [11]. Nevertheless, IER3 promotes the proliferation of some tumors, such as tongue cancer [12], bladder cancer [13], and breast cancer [14]. However, the correlation between IER3 expression in acute myeloid leukemia is not fully determined. In this study, we showed that IER3 mRNA expression in the peripheral blood of AML patients was significantly higher than that of normal controls. The prognosis of AML patients with high IER3 expression was significantly worse than that of patients with low IER3 expression. Moreover, IER3 promoted autophagy and induced the development of AML by negatively regulating the phosphorylation and activation of AKT/mTOR.

Materials and methods

Bioinformatics analysis

RNA-seq data with AML was acquired from The Cancer Genome Atlas (TCGA) database [15] and Gene Expression Omnibus (GEO) database [16]. The UALCAN (http://ualcan.path.uab.edu/) database [17] and OncoLnc (http://www.oncolnc.org/) were used to analyze the correlation of IER3 with clinical characteristics in the TCGA database and the survival analysis.

Cell Lines and Culture Conditions

Acute myeloid leukemia cell lines (HL60, HEL, NB4, THP1) and 293FT cells were purchased from the Cell bank of the Chinese Academy of Sciences. Cell lines were cultured in RPMI 1640 medium (AML cell lines) and DMEM (293FT cell) (HyClone; Cytiva). All cell lines were maintained at 37°C in a 5% CO2 humidified atmosphere incubator.

Plasmid construction

The PBABE-puro plasmid vector was selected to construct a plasmid overexpressing IER3, while the pSuper-Retro-puro plasmid was for knockdown plasmid construction. The successful plasmid construction was verified by DNA sequencing. (Supplementary Table 1).

Construction of stable cell lines

For stable overexpressed IER3 cell line, pBABE-puro, pBABE-IER3-puro, pSuper-Retro-puro, IER3 shRNA1-puro, IER3 shRNA2-puro, IER3 shRNA3-puro, and the packing plasmid pCL-Ampho were co-transfected into 293FT cells using TransIntro™ EL Transfection Reagent (TransGen Biotech Co., Ltd,Beijing, China.) per the manufacturer's protocol, the same as the knockdown stable cell line construction. HL60, HEL cells were infected by virus solution with 4ug/ml polybrene, add puromycin to the final concentration of 1ug/ml for drug screening, and continue to culture until the cells were in good condition.

Western blot analysis

Cells were lysed in RIPA lysis buffer (Beyotime Institute of Biotechnology, Shanghai, China), while concentration was determined using a BCA protein assay kit (Thermo, USA). The proteins were separated on 10% and 12% SDS-PAGE gels (Bio-Rad Laboratories, Inc.Shanghai, China) and transferred to PVDF membranes (EMD Millipore,USA), which were blocked with 5% skim milk. Moreover, the membranes were subsequently incubated overnight with antibodies against IER3, p-AKT, p-mTOR, SATB1, and β-actin; and then incubated with the corresponding secondary antibodies at room temperature for 1h. Finally, the protein bands were visualized with ECL solution (Beyotime Institute of Biotechnology, Shanghai, China)).

Quantitative real time PCR (qRT-PCR)

RNA was extracted using TRIzol® reagent (Invitrogen; Thermo Fisher Scientifc, Inc.USA), and the PrimeScript™ RT reagent Kit (Takara Biotechnology Co., Ltd.Japan) was used to yield cDNA from each RNA population. The iQTM SYBR® Green Supermix with the CFX384 Real-Time System (both Bio-Rad Laboratories, Inc.Shanghai, China) was used in the qPCR reactions. The mRNA expression was quantified using the following primers, SATB1 Forward: TGCAAAGGTTGCAGCAACCAAAAGC, SATB1 Reverse: AACATGGATAATGTGGGGCGGCCT; IER3 Forward: CAGTCGAGGAACCGAACCC, IER3 Reverse: GATCTGGCAGAAGACGATGGT; GAPDH Forward: AGGGGCCATCCACAGTCTT, GAPDH Reverse: AGCCAAAAGGGTCATCATCTCT. The relative expression ratio was calculated using the 2−ΔΔCq method.

Cell proliferation assay

Cell proliferation was detected by Cell Counting Kit-8 (CCK-8; TransGen Biotech Co., Ltd.Beijing, China.) according to the manufacturer's instructions. 1000 cells/well were seeded into 96-well plates and cultured. The 10 uL CCK-8 solution was added every 24 hours. After 2-hour incubation, we detected the absorbency at a test wavelength of 450nm.

Flow cytometric analysis

Take 10⁶ logarithmically growing cells from each sample, and wash the cells twice with pre-cooled PBS. Then add 70% ethanol overnight at 4°C. Add 500ul of staining buffer, 25ul of propidium iodide (PI), and 10ul of RNase A to each sample, and incubate at 4°C for 30 minutes in the dark. The stained cells were analyzed by FACSCalibur flow cytometer (Becton, Dickinson and Company,USA) and Flowjo software.

Colony formation assay

Take the logarithmically growing cells and count the cells, add 2% FBS medium to dilute to 1*10³/ml. Add 300ul of the cell suspension to 3ml of MethoCult medium (Guangzhou Squirrel Biotechnology Co.LTD,China), shake and mix. The cell suspensions were evenly divided into three 35mm dishes. Take 3-4ml of ddH2O into another 35mm petri dish (no lid is required), put three 35mm petri dishes into a 100mm petri dish together, and incubate in a 37°C incubator. After 14 days, take out the petri dish and count the clones.

Mouse human tumor xenograft model

HL60 shCtrl and shRNA3 cells (1× 10⁶ cells/100ul/mouse) were subcutaneously transplanted into 4–6-week-old BALB/C nude mice (Animal experimental center, Guangdong, China). The mice were divided into two groups (n=5 each). The volumes of tumors were evaluated every day: Tumor volume (mm³) = (length × width²)/2. Finally, the mice were euthanized after 15 days, and the tumors were removed. This study was conducted in accordance with the guidelines approved by the Animal Experiment Ethics Committee of the First Affiliated Hospital of Guangzhou Medical University.

Protein extraction

SDT buffer (4%SDS, 100 mM Tris-HCl, pH 7.6) was added to the sample. The lysate was sonicated and then boiled for 10 min. After centrifuging at 14000g for 15 min, the supernatant was quantified with the BCA Protein Assay Kit (P0012, Beyotime).

SDS-PAGE Separation

The proteins were separated on 12% SDS-PAGE gel. Protein bands were visualized by Coomassie Blue R-250 staining.

Mass Spectrometry analysis

Samples were analyzed on a nanoElute (Bruker, Bremen, Germany) coupled to a timsTOF Pro (Bruker, Bremen, Germany) equipped with a CaptiveSpray source. The timsTOF Pro (Bruker, Bremen, Germany) was operated in PASEF mode.

Gene Ontology (GO) Annotation and KEGG Pathway Annotation

All protein sequences were aligned to the database downloaded and analyzed from NCBI (ncbi-blast-2.2.28+-win32.exe), and only the sequences in the top 10 and E-value<=1e-3 were kept. Pathway analysis was performed using KEGG database.

ChIP assays

Cells were treated with formaldehyde to cross-link chromatin-associated proteins to DNA. Cells were collected and lysed by sonication. Then an equal amount of chromatin supernatant was incubated overnight with flag antibody and IgG antibody, respectively. Moreover, DNA was extracted and amplified by PCR. Sequences of the PCR primers were listed in Supplemental Table 2.

Immunofluorescence

Cells were collected and washed twice with PBS. The -20℃ pre-cooled methanol was fixed for 10min. Then cells were blocked in PBS with 5% BSA for 20 minutes, which were incubated with primary antibody at 1:200 overnight at 4°C, and then incubated with the corresponding fluorescently secondary antibodies at room temperature for 1h. Finally, sealed the sides with DAPI-containing mounting fluid and observed with a fluorescence microscope.

Statistical analysis

All data was analyzed using GraphPad Prism 8.0 (GraphPad Software, Inc.) and SPSS 22.0 (IBM Corp).

Results

IER3 may be a potential factor for poor prognosis in AML patients

OncoLnc collected 21 types of tumors in the TCGA (The Cancer Genome Atlas) database, including the survival data of 8647 patients and the corresponding miRNA and mRNA expression profile data. In this study, AML patients were grouped according to the level of IER3 expression, the top 50% of the expression was the high-expression group, and the last 50% was the low-expression group. Through univariate survival analysis (Kaplan-Meier method), the trend of survival analysis curves of the two groups was roughly equal, and there was no significant crossover. The survival curve of patients in the high expression group of IER3 was slightly steeper, and the survival period was shorter. The survival curve of patients in the low-expression group was slightly flatter, and the survival period was longer. Overall, the prognosis of AML patients in the high-expression group of IER3 was significantly worse than that in the low-expression group (P<0.0001) (Fig 1A). Download the matrix data and platform annotation information of the GSE9476 dataset. Analysis result showed that the expression of IER3 mRNA in the peripheral blood of AML patients was significantly higher than that of normal people (P<0.01) (Fig 1B). At the same time, UALCAN was used to assess IER3 mRNA expression levels in AML patients with different clinical characteristics. The results indicated that IER3 expression might be associated with FAB type, while there were no obvious differences in IER3 expression between different gender, age, race, presence or absence of FLT3 mutation, presence or absence of PML-RAR gene fusion, presence or absence of RAS gene activation (Fig S1). The expression of IER3 in AML cell lines was evaluated by Western blot. The results showed that IER3 was highly expressed in NB4 cells, low in HL60 and HEL, and even lower in THP1 cells (Fig 1C-D). We first overexpressed IER3 in HL60 and HEL cells, and selected HL60 to construct IER3 knockdown cell lines (Fig 1E-J).

Fig. 1 — IER3 expression was up-regulated in AML and predicted poor prognosis.

A, The prognosis of AML patients with high IER3 expression was significantly worse than that with low IER3 expression (P<0.0001). B, The expression level of IER3 mRNA in the peripheral blood of AML patients was significantly higher than that of normal controls (P=0.0028). C, The expression level of IER3 protein in AML cell lines. D, Gray level analysis of Fig1C. E, Western blot analysis of IER3 expression in HL60-IER3 cell lines. F, Western blot analysis of IER3 expression in HEL-IER3 cell lines. G, Western blot analysis of IER3 expression in HL60 knockdown cell lines. H, Gray level analysis of Fig1E. I, Gray level analysis of Fig1F. J, Gray level analysis of Fig1G.

Increased expression of IER3 promotes the proliferation of AML cells

Empty vector-transfected cells served as controls. The results of the CCK-8 cell proliferation assay (Fig 2A-C) showed that the proliferation ability of HL60-IER3 and HEL-IER3 cells were significantly enhanced compared with the control group (P<0.05), while in the HL60 shRNA1 and HL60 shRNA3 cells, the proliferation ability was significantly lower (P<0.05). These results suggest that IER3 can promote the proliferation of AML cells (HL60, HEL).

IER3 modulated the cell cycle of HL60 and HEL cells

Flow cytometry was used to analyze the role of IER3 in the cell cycle of HL60 and HEL cells. The results (Fig 2D) showed that the proportion of cells in G0/1 phase of HL60 IER3 cells decreased compared with the control (P<0.000001), and the proportion of cells in S phase was increased (P=0.000002). Fig 2E shows that the proportion of cells in G2/M phase of HEL IER3 cells increased compared with the control (P=0.003028). Consistently, the proportion of cells in G0/1 phase of HL60 shRNA1 and shRNA3 cells was increased compared with the control, both P<0.000001. Similarly, the proportion of cells in S phase of shRNA1 (P=0.0079) and shRNA3(P<0.000001) cells decreased (Fig 2F).

IER3 promoted the clonogenic ability of AML cells

Detection by clone formation assay (Fig 2G-H), HL60 IER3 (P=0.0413) and HEL IER3 (P=0.0229) cells formed more clones and larger shapes compared with HL60 vector and HEL vector cells. Similarly, compared with HL60 shCtrl, HL60 shRNA1 (P=0.0026) and HL60 shRNA3 (P=0.0021) cells formed fewer clones and smaller shapes Fig 2I.

Knockdown of IER3 inhibited the tumorigenic ability of AML in vivo

In the previous results, we found that IER3 could promote the proliferation and colony-forming ability of AML cells, and then we explored its effect in vivo. Nude mice were equally divided into two groups: one group was inoculated with HL60-shCtrl cells (N=5), and the other group was inoculated with HL60-shRNA3 cells (N=5) (Fig 3A). The mean time for tumor formation in 5 HL60-shCtrl mice and 4 HL60-shRNA3 was 9±1 day and 10±1 day, respectively. Consistent with the proliferation assay results from day 9 to day 15, tumors with HL60-shRNA3 cells grew significantly slower than the other group (Fig 3B).

Fig. 3 — Knockdown of IER3 inhibited the tumorigenic ability of AML in vivo

A, HL60-shCtrl and HL60-shRNA3(1×10⁶) cells were injected subcutaneously in the two group mice, respectively. Tumor was formed in 5 HL60-shCtrl mice and 4 HL60-shRNA3 mice. B, Tumors were removed from mice after inoculation for 15 days. C, Growth curve (P=0.009) of xenografted tumors showed that decrease-expression of IER3 reduced tumor growth and size. * P< 0.05 * * P< 0.01 * * * P< 0.001

Identification of proteins and key events regulated by IER3 based on proteomics analysis

To investigate the possible functions and underlying mechanism of IER3 in AML cells, HL60 shCtrl and HL60 shRNA3 cell lines were performed labled-free proteomic and phosphorylated proteomic analysis followed by bioinformation analysis according to P<0.05 and |log2FC|≥2, 148 up-regulated and 144 down-regulated differentially expressed proteins were screened (FigS2A).TOP9 up-regulated differentially expressed proteins were ATP5MJ, RWDD1, CARD9, POLE4, EI24, EIF4EBP2, SLC30A7, EFR3A and MED29(Fig S2B); TOP9 down-regulated differentially expressed proteins were GPD2, RNASE3, COX17, ARL8B, ELANE, CBX4, CHD2, BIRC5, CASP1(Fig S2C).The KEGG database was used to analyze the biological functions of those differentially expressed genes, and the results showed that the differential genes were mainly involved in cancer pathways, phagocytosis, oxidative phosphorylation, and other biological functions(Fig4A).To further explore the interaction of those differentially expressed genes, protein-protein interaction was created(Fig S3A). In the phosphor proteomic analysis, we screened out 26 up-regulated differentially expressed phosphorylation sites, and 62 down-regulated differentially expressed phosphorylation sites, using P<0.05 and |log2FC| 2 as the cut-off criteria (Fig S2D). The top 9 phosphorylation sites with the most dramatic up-regulation changes were SRRM1_9508_S636, SRRM2_14870_S398, UBE4B_1665_S101, MRGBP_13543_S195, TXLNA_3467_S18, EXOC1_13544_S470, NOLC1_6323_S397, ASXL2_8493_S440, EIF4B_2919_S597 (Fig S2E); The top 9 phosphorylation sites with the most dramatic down-regulation were AAK1_6912_S678, SPTBN1_4867_S2165, SF1_6647_S82, MEPCE_8534_S216, NOP2_3729_S67, PPIG_5724_S696, ATP11C_9848_S445, ZC3H18_9035_S613, SLC1A4_3656_S521 (Fig S2F). We used the Gene Ontology (GO) database to analyze the biological functions of differential genes. Differentially expressed phosphorylated proteins were associated with cellular processes, biological regulation, proliferation, and development. The KEGG database was used to analyze the pathway of differential phosphorylated genes. The result showed that these differential phosphorylated genes were associated with autophagy, ubiquitin-mediated proteolysis, MAPK signaling pathway, and acute myeloid leukemia. (Fig 4B-C).To further explore the interaction of those differentially expressed phosphorylation sites, protein-protein interaction was created(Fig S3B).

Fig. 4 — The KEGG analysis of proteomic results

A, Annotation of KEGG pathway of the differentially expressed gene between HL60-shCtrl and HL60-shRNA3. B, KEGG pathway annotation results of proteins with differential phosphorylation sites (TOP 20). C, Statistical Histogram of KEGG Pathway Enrichment of proteins with differential phosphorylation Sites (TOP 20).

IER3 promoted autophagy of AML cells

Autophagy is often thought of as an adaptive response to inadequate energy supply for AML and other tumor progression. Here IER3 was found to promote autophagy based on proteomic and phosphorylation assays in HL60-CTR and HL60-IER3 shRNA cells. To verify this result, the expression of autophagy-related protein LC3B in HL60 vector, HL60 IER3, and HEL vector, HEL IER3 cell lines was verified by western blot. The result showed the expression of LC3B II was increased in HL60-IER3 and HEL-IER3 cell lines (Fig 5A-B). Similarly, the expression of LC3B II was decreased in HL60-IER3-shRNA cells compared with the control group. Immunofluorescence test also showed consistent results (Fig 5C-D). The green fluorescence brightness of the autophagy marker LC3B II was significantly higher in HL60-IER3 and HEL-IER3 cells than that of the control group.

Fig. 5 — IER3 promoted autophagy by negatively regulating the phosphorylation and activation of the AKT/mTOR pathway.

A, Western blot was used to detect the expression of autophagy protein in overexpressed and knockdown cells. B, Gray level analysis of A by Western blot. C, The green fluorescence brightness of autophagy marker LC3BⅡ was significantly higher in HL60-IER3 cells than that of control cells. D, the green fluorescence brightness of autophagy marker LC3BⅡ was significantly higher in HEL-IER3 cells than that in control cells. E-F, IER3 may promote autophagy by negatively regulating the phosphorylation and activation of the AKT/mTOR pathway.

IER3 promoted autophagy by negatively regulating the phosphorylation and activation of the AKT/mTOR pathway.

Our previous results showed that IER3 could promote autophagy, but the specific mechanism has not been discovered. We verified the autophagy-related pathways by Western blot, and the results were displayed in Fig 5E-F. Compared with the control group, the expressions of phosphorylated AKT (T308) and phosphorylated mTOR (Ser2448) were significantly decreased in IER3 overexpressed HL60 cells. In the autophagy pathway, phosphorylated AKT activates the mTOR pathway and then inhibits the occurrence of autophagy. Our results suggested that IER3 can inhibit the phosphorylation of AKT and mTOR and subsequently promote the development of autophagy of AML cells.

SATB1 directly targets IER3 and negatively regulates IER3 expression

In the previous study, we found that IER3 was one of the downstream differentially expressed genes of SATB1 in the HL60 cell line. Real-time PCR and Western blot were performed to further verify the relationship between SATB1 and IER3 at the mRNA and protein levels. Regarding mRNA expression level, IER3 expression was significantly higher in HL60-SATB1-shRNA cells than in control cells (Fig 6A-B). At the protein level, the expression of IER3 in the HL60-SATB1 cells was lower than that of the control group, while the expression of IER3 in HL60-SATB1-shRNA cells was significantly higher than that of the control group (Fig 6C-D). Again, this result suggested that the expression of IER3 was negatively regulated by SATB1.

Fig. 6 — IER3 was negatively regulated by SATB1

A-B, Real-time PCR was used to detect the expression of IER3 after knockdown of SATB1. C-D, The expression of IER3 after overexpression and knockdown of SATB1 was detected by Western blot. E, Schematic diagram of SATB1 binding affinity of different sites in IER3 promoter region. The direction of the arrow indicates the direction of transcription initiation. F, CHIP - PCR assay validation results. The results showed that the products amplified by primer7-9 primers, the corresponding bands could be amplified in the Input and flag groups, and the negative pairs were also detected. No bands were detected in the IgG samples. In other primers, only the Input group could amplify corresponding bands.

To further explore the role of SATB1 in the transcriptional regulation of IER3, we designed nine pairs of primers in the IER3 promoter region to detect the binding site of SATB1 (Supplementary Table 2). ChIP assays revealed that SATB1 was able to bind the IRE3 promoter. SATB1 can bound to primer 7 (-1985- -2153bp), primer 8 (-2138- -2331bp), and primer9 (-2316- -2453bp) region upstream of IER3.(Fig 6E-F). Taken together, our results indicated that SATB1 could directly inhibit the expression of IER3.

Discussion

Acute myeloid leukemia, a clonal hematopoietic disease affecting hematopoietic stem and progenitor cells, has seen an increasing incidence over the past few years, and this disease has a poor prognosis [2]. With the continuous exploration of the genomic, molecular structure, and the identification of mutated genes related to the pathogenesis of acute myeloid leukemia, the treatment of this disease has mainly relied on cytarabine, anthracycline, and targeted therapy [18]. However, the pathogenesis of acute myeloid leukemia has not been fully explained, and the drug resistance of chemotherapeutic drugs still needs to be explored and solved [4,19]. Further research on the drug resistance and high recurrence rate of AML still needs to be done.

IER3 (Immediate early response 3) is an immediate early response protein, which regulates various cellular processes, including proliferation, apoptosis, DNA repair, and differentiation, and its response varies with the cellular environment. Nevertheless, the mechanism of IER3 in the occurrence and development of AML has not been studied.

Subsequently, based on the univariate survival analysis of AML patients, we found that the prognosis of the IER3 low-expression group was better than that of the high-expression group. The results suggest that IER3 may be associated with the prognosis of AML.

Cell proliferation is one of the fundamental features of tumor growth [19]. The CCK-8 proliferation analysis showed that the proliferation ability of HL60 and HEL was faster than that of the control group after overexpression of IER3, while the proliferation ability of HL60 cells was slower than that of the control group after knockdown of IER3. It showed that IER3 could enhance the proliferation ability of AML cell lines HL60 and HEL. Similarly, we confirmed this result through clonogenic experiments. The number of clones formed by the HL60 IER3 and HEL IER3 cell lines was higher than that of the vector group. Moreover, the clones formed by the HL60 shRNA cells were fewer and smaller than that of the HL60 shCtrl. and the shape was smaller. This result showed that IER3 enhanced the clonogenic ability of AML cell lines HL60 and HEL. Subsequently, IER3 was confirmed that could improve the tumorigenicity of HL60 cells in vivo. In summary, IER3 enhances the proliferation and clone formation of AML cells, which may promote tumors’ occurrence and development.

Generally speaking, the cell cycle of eukaryotic cells is divided into two main stages, namely the interphase and the mitotic phase (M phase), and the interphase includes three subphases: G1, S, and G2[20]. In this study, flow cytometry was used to monitor the effect of IER3 on AML, and the results showed that the proportion of cells in G0/1 phase of HL60 IER3 cells decreased, and the proportion of cells in S phase increased compared control cells. The proportion of cells in G0/1 phase increased, and the proportion of cells in S phase decreased in HL60 shRNA1 and shRNA3 cells compared control cells. The results suggest that IER3 promotes HL60 cells from G0/1 phase to the DNA synthesis phase S phase, and promotes cell proliferation. Knockdown of IER3 resulted in cell arrest in G0/1 phase, and the number of cells entering S phase of DNA synthesis phase decreased. Compared with HEL vector, the proportion of cells in G2/M phase of HEL IER3 cells was increased. The results suggest that IER3 promotes HEL cells from stationary phase G0/1 phase and DNA synthesis phase S phase to G2 phase, and finally promotes the proliferation of HEL. In general, IER3 promotes the proliferation and division of AML cells by promoting the quiescent phase of AML cells to enter the DNA synthesis or G2 phase, thereby promoting the occurrence and development of the disease.

To further understand the mechanism by which IER3 promotes AML proliferation, HL60 shCtrl and HL60 shRNA3 cell lines were performed labled-free proteomic and phosphorylated proteomic analysis followed by bioinformation analysis. According to the results of bioinformatics analysis, we screened out 88 differentially expressed phosphorylation sites. Using the Gene Ontology (GO) database to analyze the biological functions associated with differential genes, we found that in terms of biological functions, differentially phosphorylated genes were mainly involved in biological functions such as cellular processes, biological regulation, proliferation, and developmental processes. Using the KEGG database to conduct pathway analysis of differentially phosphorylated genes, we found that these differentially phosphorylated genes were related to autophagy, ubiquitin-mediated proteolysis, MAPK signaling pathway, and acute myeloid leukemia. The results suggest that IER3 may promote the development of AML by promoting autophagy.

Autophagy is an intracellular catabolic degradation process in which damaged organelles or pathogens are delivered to lysosomes, where they are degraded [21]. Autophagy plays an essential role in cell development, differentiation, and maintenance of homeostasis [22]. There are three pathways for delivering damaged cytoplasmic material to lysosomes: microautophagy, chaperone-mediated autophagy, and macroautophagy [21]. Depending on the disease stage and tumor microenvironment, autophagy plays a dual role in tumors; it can both promote tumorigenesis and inhibit tumor growth. In most cancers, autophagy promotes tumorigenesis by regulating nutrients required for cancer cell growth [23], [24], [25]. However, the induction of autophagy may inhibit tumor growth by maintaining cellular integrity, preventing cellular damage, and attenuating cancer stem cells [26]. In acute myeloid leukemia, autophagy promotes the disease's progression and may be associated with chemoresistance [27].

Autophagy is mainly a cellular mechanism mediated by the autophagy-related gene ATG, which was first discovered in yeast and has evolved to mammals [28]. Several mammalian ATG8 homologous genes have been identified as the LC3/GABARAP ubiquitin-like protein family, of which the most studied is LC3B [29]. Autophagosome formation refers to the binding of soluble LC3-I to phosphatidylethanolamine to form LC3-II and attach to the membrane. LC3-II is localized only in autophagic vacuoles, and converting LC3-I to LC3-II is a key step in autophagosome generation [30]. LC3-II is an essential marker for evaluating autophagy activity and is also a reliable autophagy marker at present [29]. In conclusion, the LC3 gene can be used to verify the autophagy phenomenon.

Through proteomic analysis, we discovered that the gene IER3 was related to autophagy. Through experimental verification, we found that IER3 promotes the proliferation of AML, and the expression of IER3 was positively correlated with autophagy. Our results indicated that IER3 might promote the occurrence of autophagy and thus may participate in the accelerating proliferation of AML cells and the progression of AML. This needs to be confirmed by more experimental results, which we will investigate further. In the HL60 cell line, after overexpression of IER3, the expressions of phosphorylated AKT (T308) and phosphorylated mTOR (Ser2448) were significantly decreased. The results suggest that IER3 can inhibit the phosphorylation of AKT and mTOR, and in the autophagy pathway, phosphorylated AKT activated the mTOR pathway and then inhibited the occurrence of autophagy. Overexpression of IER3 prevented this process, promoting the occurrence and development of autophagy. Thus IER3 may promote the occurrence of autophagy by negatively regulating the phosphorylation and activation of the AKT/mTOR pathway, thereby regulating the progression of AML.

Special AT-rich sequence binding protein 1 (SATB1) is a protein that selectively binds to the nuclear matrix and regulates genome structure at the chromatin level. SATB1 acts as a platform for various chromatin remodeling/modifying enzymes by binding fragments of AT-enriched sequences, folding chromatin into circular domains, and regulating the expression of 1000 genes in human tumors through epigenetics [31,32]. Studies have shown that SATB1 was abnormally expressed in tumors such as liver cancer [33], breast cancer [34], gastric cancer [35], colon cancer [36], and skin melanoma [37]. Our study also found that reducing SATB1 expression promoted AML cell proliferation by activating NF-κB [38]. Overall, the research on the SATB1 gene has become increasingly apparent. In the previous study, we found that IER3 was a downstream gene of SATB1 through gene expression profiling chip analysis. Western blot and real-time PCR results showed that the expression of IER3 was negatively regulated by SATB1. Here CHIP-PCR was used to further demonstrate that SATB1 can bind to the IER3 promoter region and regulate IER3 transcription. The results showed that SATB1 could bound to primer 7 (-1985- -2153bp), primer 8 (-2138- -2331bp), and primer9 (-2316- -2453bp) region upstream of IER3, which was also a fragment enriched for AT sequences. Taken together, SATB1 was reported downregulated in AML. As the upstream gene of IER3, SATB1 directly inhibited IER3 expression. Low expression of SATB1 can reduce the transcriptional inhibition of IER3 and promote IER3 expression in AML.

In general, the high expression of IER3 promotes autophagy, which in turn stimulates the proliferation function and promotes the occurrence and development of AML diseases. IER3 is likely to be a new target in treating acute myeloid leukemia.

Author Contributions

Yimin Chen and Zhengqian Huang performed the experiments., analysed the data,and wrote the manuscript..Shuyi Chen and Li Tan contributed the Western blot and real-time PCR. Lang He and Danyun Yuan contributed to the Mouse human tumor xenograft model. Lixia Zheng and Anqiao Li contributed to the Flow cytometric analysis. Lihua Zhong and Heng Zhang Participate in plasmid construction .Lihua Xu and Huo Tan conceived the idea and designed the research. All authors contributed to the final manuscript and approved it for submission.

Funding

This study was supported by the National Natural Science Foundation of China (Grant no. 81672661, 81870113) and Guangzhou Science and Technology Project (2023A03J0347, 2023A03J0348, 20221A011078).

Data Availability

The data used to support findings of this study are available from the corresponding author upon request.

Ethics approval and consent to participate

Animals were purchased from Animal experimental center, Guangdong, China. The protocol was approved by the Committee on the Ethics of the First Afliated Hospital of Guangzhou Medical University.

Declaration of Competing Interest

The authors have declared that no competing interest exists.

Acknowledgments

The authors thank the TCGA and GEO databases for sharing the AML sequencing dataset. And corresponding survival profiles.

Footnotes

Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.tranon.2023.101711.

Appendix. Supplementary materials

mmc1.docx^{(899.8KB, docx)}

mmc2.docx^{(12.2KB, docx)}

mmc3.docx^{(12.9KB, docx)}

References

1.Newell LF, Cook RJ. Advances in acute myeloid leukemia. BMJ. 2021;375:n2026. doi: 10.1136/bmj.n2026. [DOI] [PubMed] [Google Scholar]
2.Narayanan D, Weinberg OK. How I investigate acute myeloid leukemia. Int J Lab Hematol. 2020;42(1) doi: 10.1111/ijlh.13135. [DOI] [PubMed] [Google Scholar]
3.Siegel RL, Miller KD, Fuchs HE, Jemal A. Cancer Statistics. CA Cancer J Clin. 2021;71(1) doi: 10.3322/caac.21654. 2021. [DOI] [PubMed] [Google Scholar]
4.Liu H. Emerging agents and regimens for AML. J Hematol Oncol. 2021;14(1):49. doi: 10.1186/s13045-021-01062-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Shen L, Guo J, Santos-Berrios C, Wu MX. Distinct domains for anti- and pro-apoptotic activities of IEX-1. J Biol Chem. 2006;281(22):15304–15311. doi: 10.1074/jbc.M600054200. [DOI] [PubMed] [Google Scholar]
6.Feldmann KA, Pittelkow MR, Roche PC, Kumar R, Grande JP. Expression of an immediate early gene, IEX-1, in human tissues. Histochem Cell Biol. 2001;115(6):489–497. doi: 10.1007/s004180100284. [DOI] [PubMed] [Google Scholar]
7.Jin H, Lee K, Kim YH, Oh HK, Maeng YI, Kim TH, Suh DS, Bae J. Scaffold protein FHL2 facilitates MDM2-mediated degradation of IER3 to regulate proliferation of cervical cancer cells. Oncogene. 2016;35(39):5106–5118. doi: 10.1038/onc.2016.54. [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Han L, Geng L, Liu X, Shi H, He W, Wu MX. Clinical significance of IEX-1 expression in ovarian carcinoma. Ultrastruct Pathol. 2011;35(6):260–266. doi: 10.3109/01913123.2011.608916. [DOI] [PubMed] [Google Scholar]
9.Sasada T, Azuma K, Hirai T, Hashida H, Kanai M, Yanagawa T, Takabayashi A. Prognostic significance of the immediate early response gene X-1 (IEX-1) expression in pancreatic cancer. Ann Surg Oncol. 2008;15(2):609–617. doi: 10.1245/s10434-007-9669-0. [DOI] [PubMed] [Google Scholar]
10.Liu S, Qiu J, He G, He W, Liu C, Cai D, Pan H. TRAIL promotes hepatocellular carcinoma apoptosis and inhibits proliferation and migration via interacting with IER3. Cancer Cell Int. 2021;21(1):63. doi: 10.1186/s12935-020-01724-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Stachel I, Geismann C, Aden K, Deisinger F, Rosenstiel P, Schreiber S, Sebens S, Arlt A, Schäfer H. Modulation of nuclear factor E2-related factor-2 (Nrf2) activation by the stress response gene immediate early response-3 (IER3) in colonic epithelial cells: a novel mechanism of cellular adaption to inflammatory stress. J Biol Chem. 2014;289(4):1917–1929. doi: 10.1074/jbc.M113.490920. [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Xiao F, Dai Y, Hu Y, Lu M, Dai Q. Expression profile analysis identifies IER3 to predict overall survival and promote lymph node metastasis in tongue cancer. Cancer Cell Int. 2019;19:307. doi: 10.1186/s12935-019-1028-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Ye J, Zhang Y, Cai Z, Jiang M, Li B, Chen G, Zeng Y, Liang Y, Wu S, Wang Z, et al. Increased expression of immediate early response gene 3 protein promotes aggressive progression and predicts poor prognosis in human bladder cancer. BMC Urol. 2018;18(1):82. doi: 10.1186/s12894-018-0388-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Yang C, Trent S, Ionescu-Tiba V, Lan L, Shioda T, Sgroi D, Schmidt EV. Identification of cyclin D1- and estrogen-regulated genes contributing to breast carcinogenesis and progression. Cancer Res. 2006;66(24):11649–11658. doi: 10.1158/0008-5472.CAN-06-1645. [DOI] [PubMed] [Google Scholar]
15.Tomczak K, Czerwinska P, Wiznerowicz M. The Cancer Genome Atlas (TCGA): an immeasurable source of knowledge. Contemp Oncol (Pozn) 2015;19(1A):A68–A77. doi: 10.5114/wo.2014.47136. [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Barrett T, Wilhite SE, Ledoux P, Evangelista C, Kim IF, Tomashevsky M, Marshall KA, Phillippy KH, Sherman PM, Holko M, et al. NCBI GEO: archive for functional genomics data sets–update. Nucleic Acids Res. 2013;41:D991–D995. doi: 10.1093/nar/gks1193. (Database issue) [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Chandrashekar DS, Bashel B, Balasubramanya SAH, Creighton CJ, Ponce-Rodriguez I, Chakravarthi B, Varambally S. UALCAN: A Portal for Facilitating Tumor Subgroup Gene Expression and Survival Analyses. Neoplasia. 2017;19(8):649–658. doi: 10.1016/j.neo.2017.05.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Yang X, Wang J. Precision therapy for acute myeloid leukemia. J Hematol Oncol. 2018;11(1):3. doi: 10.1186/s13045-017-0543-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Matson JP, Cook JG. Cell cycle proliferation decisions: the impact of single cell analyses. FEBS J. 2017;284(3):362–375. doi: 10.1111/febs.13898. [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Sun Y, Liu Y, Ma X, Hu H. The Influence of Cell Cycle Regulation on Chemotherapy. Int J Mol Sci. 2021;(13):22. doi: 10.3390/ijms22136923. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Behrends C, Sowa ME, Gygi SP, Harper JW. Network organization of the human autophagy system. Nature. 2010;466(7302):68–76. doi: 10.1038/nature09204. [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Mizushima N, Komatsu M. Autophagy: renovation of cells and tissues. Cell. 2011;147(4):728–741. doi: 10.1016/j.cell.2011.10.026. [DOI] [PubMed] [Google Scholar]
23.Thorburn A, Thamm DH, Gustafson DL. Autophagy and cancer therapy. Mol Pharmacol. 2014;85(6):830–838. doi: 10.1124/mol.114.091850. [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Zong W-X, Rabinowitz JD, White E. Mitochondria and Cancer. Mol Cell. 2016;61(5):667–676. doi: 10.1016/j.molcel.2016.02.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Chang JY, Yi H-S, Kim H-W, Shong M. Dysregulation of mitophagy in carcinogenesis and tumor progression. Biochim Biophys Acta Bioenerg. 2017;1858(8):633–640. doi: 10.1016/j.bbabio.2016.12.008. [DOI] [PubMed] [Google Scholar]
26.Lei Y, Zhang D, Yu J, Dong H, Zhang J, Yang S. Targeting autophagy in cancer stem cells as an anticancer therapy. Cancer Lett. 2017;393:33–39. doi: 10.1016/j.canlet.2017.02.012. [DOI] [PubMed] [Google Scholar]
27.Chen S-J, Bao L, Keefer K, Shanmughapriya S, Chen L, Lee J, Wang J, Zhang X-Q, Hirschler-Laszkiewicz I, Merali S, et al. Transient receptor potential ion channel TRPM2 promotes AML proliferation and survival through modulation of mitochondrial function, ROS, and autophagy. Cell Death Dis. 2020;11(4):247. doi: 10.1038/s41419-020-2454-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Bravo-San Pedro JM, Pietrocola F, Sica V, Izzo V, Sauvat A, Kepp O, Maiuri MC, Kroemer G, Galluzzi L. High-Throughput Quantification of GFP-LC3 Dots by Automated Fluorescence Microscopy. Methods Enzymol. 2017;587:71–86. doi: 10.1016/bs.mie.2016.10.022. [DOI] [PubMed] [Google Scholar]
29.Klionsky DJ, Abdelmohsen K, Abe A, Abedin MJ, Abeliovich H, Acevedo Arozena A, Adachi H, Adams CM, Adams PD, Adeli K, et al. Guidelines for the use and interpretation of assays for monitoring autophagy. 2016;(1):12. [Google Scholar]
30.Koyama-Honda I, Itakura E, Fujiwara TK, Mizushima N. Temporal analysis of recruitment of mammalian ATG proteins to the autophagosome formation site. Autophagy. 2013;9(10):1491–1499. doi: 10.4161/auto.25529. [DOI] [PubMed] [Google Scholar]
31.Yasui D, Miyano M, Cai S, Varga-Weisz P, Kohwi-Shigematsu T. SATB1 targets chromatin remodelling to regulate genes over long distances. Nature. 2002;419(6907):641–645. doi: 10.1038/nature01084. [DOI] [PubMed] [Google Scholar]
32.Pavan Kumar P, Purbey PK, Sinha CK, Notani D, Limaye A, Jayani RS, Galande S. Phosphorylation of SATB1, a global gene regulator, acts as a molecular switch regulating its transcriptional activity in vivo. Mol Cell. 2006;22(2):231–243. doi: 10.1016/j.molcel.2006.03.010. [DOI] [PubMed] [Google Scholar]
33.Tu W, Luo M, Wang Z, Yan W, Xia Y, Deng H, He J, Han P, Tian D. Upregulation of SATB1 promotes tumor growth and metastasis in liver cancer. Liver Int. 2012;32(7):1064–1078. doi: 10.1111/j.1478-3231.2012.02815.x. [DOI] [PubMed] [Google Scholar]
34.Han H-J, Russo J, Kohwi Y, Kohwi-Shigematsu T. SATB1 reprogrammes gene expression to promote breast tumour growth and metastasis. Nature. 2008;452(7184):187–193. doi: 10.1038/nature06781. [DOI] [PubMed] [Google Scholar]
35.Lu X, Cheng C, Zhu S, Yang Y, Zheng L, Wang G, Shu X, Wu K, Liu K, Tong Q. SATB1 is an independent prognostic marker for gastric cancer in a Chinese population. Oncol Rep. 2010;24(4):981–987. doi: 10.3892/or.2010.981. [DOI] [PubMed] [Google Scholar]
36.Zhang Y, Tian X, Ji H, Guan X, Xu W, Dong B, Zhao M, Wei M, Ye C, Sun Y, et al. Expression of SATB1 promotes the growth and metastasis of colorectal cancer. PLoS One. 2014;9(6) doi: 10.1371/journal.pone.0100413. [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Zhang L, Cheng F, He R, Chen H, Liu Y, Sun J. Inhibition of SATB1 by shRNA suppresses the proliferation of cutaneous malignant melanoma. Cancer Biother Radiopharm. 2014;29(2):77–82. doi: 10.1089/cbr.2013.1502. [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Luo X, Xu L, Wu X, Tan H, Liu L. Decreased SATB1 expression promotes AML cell proliferation through NF-κB activation. Cancer Cell Int. 2019;19:134. doi: 10.1186/s12935-019-0850-x. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

mmc1.docx^{(899.8KB, docx)}

mmc2.docx^{(12.2KB, docx)}

mmc3.docx^{(12.9KB, docx)}

Data Availability Statement

The data used to support findings of this study are available from the corresponding author upon request.

[bib0001] 1.Newell LF, Cook RJ. Advances in acute myeloid leukemia. BMJ. 2021;375:n2026. doi: 10.1136/bmj.n2026. [DOI] [PubMed] [Google Scholar]

[bib0002] 2.Narayanan D, Weinberg OK. How I investigate acute myeloid leukemia. Int J Lab Hematol. 2020;42(1) doi: 10.1111/ijlh.13135. [DOI] [PubMed] [Google Scholar]

[bib0003] 3.Siegel RL, Miller KD, Fuchs HE, Jemal A. Cancer Statistics. CA Cancer J Clin. 2021;71(1) doi: 10.3322/caac.21654. 2021. [DOI] [PubMed] [Google Scholar]

[bib0004] 4.Liu H. Emerging agents and regimens for AML. J Hematol Oncol. 2021;14(1):49. doi: 10.1186/s13045-021-01062-w. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0005] 5.Shen L, Guo J, Santos-Berrios C, Wu MX. Distinct domains for anti- and pro-apoptotic activities of IEX-1. J Biol Chem. 2006;281(22):15304–15311. doi: 10.1074/jbc.M600054200. [DOI] [PubMed] [Google Scholar]

[bib0006] 6.Feldmann KA, Pittelkow MR, Roche PC, Kumar R, Grande JP. Expression of an immediate early gene, IEX-1, in human tissues. Histochem Cell Biol. 2001;115(6):489–497. doi: 10.1007/s004180100284. [DOI] [PubMed] [Google Scholar]

[bib0007] 7.Jin H, Lee K, Kim YH, Oh HK, Maeng YI, Kim TH, Suh DS, Bae J. Scaffold protein FHL2 facilitates MDM2-mediated degradation of IER3 to regulate proliferation of cervical cancer cells. Oncogene. 2016;35(39):5106–5118. doi: 10.1038/onc.2016.54. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0008] 8.Han L, Geng L, Liu X, Shi H, He W, Wu MX. Clinical significance of IEX-1 expression in ovarian carcinoma. Ultrastruct Pathol. 2011;35(6):260–266. doi: 10.3109/01913123.2011.608916. [DOI] [PubMed] [Google Scholar]

[bib0009] 9.Sasada T, Azuma K, Hirai T, Hashida H, Kanai M, Yanagawa T, Takabayashi A. Prognostic significance of the immediate early response gene X-1 (IEX-1) expression in pancreatic cancer. Ann Surg Oncol. 2008;15(2):609–617. doi: 10.1245/s10434-007-9669-0. [DOI] [PubMed] [Google Scholar]

[bib0010] 10.Liu S, Qiu J, He G, He W, Liu C, Cai D, Pan H. TRAIL promotes hepatocellular carcinoma apoptosis and inhibits proliferation and migration via interacting with IER3. Cancer Cell Int. 2021;21(1):63. doi: 10.1186/s12935-020-01724-8. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0011] 11.Stachel I, Geismann C, Aden K, Deisinger F, Rosenstiel P, Schreiber S, Sebens S, Arlt A, Schäfer H. Modulation of nuclear factor E2-related factor-2 (Nrf2) activation by the stress response gene immediate early response-3 (IER3) in colonic epithelial cells: a novel mechanism of cellular adaption to inflammatory stress. J Biol Chem. 2014;289(4):1917–1929. doi: 10.1074/jbc.M113.490920. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0012] 12.Xiao F, Dai Y, Hu Y, Lu M, Dai Q. Expression profile analysis identifies IER3 to predict overall survival and promote lymph node metastasis in tongue cancer. Cancer Cell Int. 2019;19:307. doi: 10.1186/s12935-019-1028-2. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0013] 13.Ye J, Zhang Y, Cai Z, Jiang M, Li B, Chen G, Zeng Y, Liang Y, Wu S, Wang Z, et al. Increased expression of immediate early response gene 3 protein promotes aggressive progression and predicts poor prognosis in human bladder cancer. BMC Urol. 2018;18(1):82. doi: 10.1186/s12894-018-0388-6. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0014] 14.Yang C, Trent S, Ionescu-Tiba V, Lan L, Shioda T, Sgroi D, Schmidt EV. Identification of cyclin D1- and estrogen-regulated genes contributing to breast carcinogenesis and progression. Cancer Res. 2006;66(24):11649–11658. doi: 10.1158/0008-5472.CAN-06-1645. [DOI] [PubMed] [Google Scholar]

[bib0015] 15.Tomczak K, Czerwinska P, Wiznerowicz M. The Cancer Genome Atlas (TCGA): an immeasurable source of knowledge. Contemp Oncol (Pozn) 2015;19(1A):A68–A77. doi: 10.5114/wo.2014.47136. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0016] 16.Barrett T, Wilhite SE, Ledoux P, Evangelista C, Kim IF, Tomashevsky M, Marshall KA, Phillippy KH, Sherman PM, Holko M, et al. NCBI GEO: archive for functional genomics data sets–update. Nucleic Acids Res. 2013;41:D991–D995. doi: 10.1093/nar/gks1193. (Database issue) [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0017] 17.Chandrashekar DS, Bashel B, Balasubramanya SAH, Creighton CJ, Ponce-Rodriguez I, Chakravarthi B, Varambally S. UALCAN: A Portal for Facilitating Tumor Subgroup Gene Expression and Survival Analyses. Neoplasia. 2017;19(8):649–658. doi: 10.1016/j.neo.2017.05.002. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0018] 18.Yang X, Wang J. Precision therapy for acute myeloid leukemia. J Hematol Oncol. 2018;11(1):3. doi: 10.1186/s13045-017-0543-7. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0019] 19.Matson JP, Cook JG. Cell cycle proliferation decisions: the impact of single cell analyses. FEBS J. 2017;284(3):362–375. doi: 10.1111/febs.13898. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0020] 20.Sun Y, Liu Y, Ma X, Hu H. The Influence of Cell Cycle Regulation on Chemotherapy. Int J Mol Sci. 2021;(13):22. doi: 10.3390/ijms22136923. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0021] 21.Behrends C, Sowa ME, Gygi SP, Harper JW. Network organization of the human autophagy system. Nature. 2010;466(7302):68–76. doi: 10.1038/nature09204. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0022] 22.Mizushima N, Komatsu M. Autophagy: renovation of cells and tissues. Cell. 2011;147(4):728–741. doi: 10.1016/j.cell.2011.10.026. [DOI] [PubMed] [Google Scholar]

[bib0023] 23.Thorburn A, Thamm DH, Gustafson DL. Autophagy and cancer therapy. Mol Pharmacol. 2014;85(6):830–838. doi: 10.1124/mol.114.091850. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0024] 24.Zong W-X, Rabinowitz JD, White E. Mitochondria and Cancer. Mol Cell. 2016;61(5):667–676. doi: 10.1016/j.molcel.2016.02.011. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0025] 25.Chang JY, Yi H-S, Kim H-W, Shong M. Dysregulation of mitophagy in carcinogenesis and tumor progression. Biochim Biophys Acta Bioenerg. 2017;1858(8):633–640. doi: 10.1016/j.bbabio.2016.12.008. [DOI] [PubMed] [Google Scholar]

[bib0026] 26.Lei Y, Zhang D, Yu J, Dong H, Zhang J, Yang S. Targeting autophagy in cancer stem cells as an anticancer therapy. Cancer Lett. 2017;393:33–39. doi: 10.1016/j.canlet.2017.02.012. [DOI] [PubMed] [Google Scholar]

[bib0027] 27.Chen S-J, Bao L, Keefer K, Shanmughapriya S, Chen L, Lee J, Wang J, Zhang X-Q, Hirschler-Laszkiewicz I, Merali S, et al. Transient receptor potential ion channel TRPM2 promotes AML proliferation and survival through modulation of mitochondrial function, ROS, and autophagy. Cell Death Dis. 2020;11(4):247. doi: 10.1038/s41419-020-2454-8. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0028] 28.Bravo-San Pedro JM, Pietrocola F, Sica V, Izzo V, Sauvat A, Kepp O, Maiuri MC, Kroemer G, Galluzzi L. High-Throughput Quantification of GFP-LC3 Dots by Automated Fluorescence Microscopy. Methods Enzymol. 2017;587:71–86. doi: 10.1016/bs.mie.2016.10.022. [DOI] [PubMed] [Google Scholar]

[bib0029] 29.Klionsky DJ, Abdelmohsen K, Abe A, Abedin MJ, Abeliovich H, Acevedo Arozena A, Adachi H, Adams CM, Adams PD, Adeli K, et al. Guidelines for the use and interpretation of assays for monitoring autophagy. 2016;(1):12. [Google Scholar]

[bib0030] 30.Koyama-Honda I, Itakura E, Fujiwara TK, Mizushima N. Temporal analysis of recruitment of mammalian ATG proteins to the autophagosome formation site. Autophagy. 2013;9(10):1491–1499. doi: 10.4161/auto.25529. [DOI] [PubMed] [Google Scholar]

[bib0031] 31.Yasui D, Miyano M, Cai S, Varga-Weisz P, Kohwi-Shigematsu T. SATB1 targets chromatin remodelling to regulate genes over long distances. Nature. 2002;419(6907):641–645. doi: 10.1038/nature01084. [DOI] [PubMed] [Google Scholar]

[bib0032] 32.Pavan Kumar P, Purbey PK, Sinha CK, Notani D, Limaye A, Jayani RS, Galande S. Phosphorylation of SATB1, a global gene regulator, acts as a molecular switch regulating its transcriptional activity in vivo. Mol Cell. 2006;22(2):231–243. doi: 10.1016/j.molcel.2006.03.010. [DOI] [PubMed] [Google Scholar]

[bib0033] 33.Tu W, Luo M, Wang Z, Yan W, Xia Y, Deng H, He J, Han P, Tian D. Upregulation of SATB1 promotes tumor growth and metastasis in liver cancer. Liver Int. 2012;32(7):1064–1078. doi: 10.1111/j.1478-3231.2012.02815.x. [DOI] [PubMed] [Google Scholar]

[bib0034] 34.Han H-J, Russo J, Kohwi Y, Kohwi-Shigematsu T. SATB1 reprogrammes gene expression to promote breast tumour growth and metastasis. Nature. 2008;452(7184):187–193. doi: 10.1038/nature06781. [DOI] [PubMed] [Google Scholar]

[bib0035] 35.Lu X, Cheng C, Zhu S, Yang Y, Zheng L, Wang G, Shu X, Wu K, Liu K, Tong Q. SATB1 is an independent prognostic marker for gastric cancer in a Chinese population. Oncol Rep. 2010;24(4):981–987. doi: 10.3892/or.2010.981. [DOI] [PubMed] [Google Scholar]

[bib0036] 36.Zhang Y, Tian X, Ji H, Guan X, Xu W, Dong B, Zhao M, Wei M, Ye C, Sun Y, et al. Expression of SATB1 promotes the growth and metastasis of colorectal cancer. PLoS One. 2014;9(6) doi: 10.1371/journal.pone.0100413. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0037] 37.Zhang L, Cheng F, He R, Chen H, Liu Y, Sun J. Inhibition of SATB1 by shRNA suppresses the proliferation of cutaneous malignant melanoma. Cancer Biother Radiopharm. 2014;29(2):77–82. doi: 10.1089/cbr.2013.1502. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0038] 38.Luo X, Xu L, Wu X, Tan H, Liu L. Decreased SATB1 expression promotes AML cell proliferation through NF-κB activation. Cancer Cell Int. 2019;19:134. doi: 10.1186/s12935-019-0850-x. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Immediate early response 3 gene promotes aggressive progression and autophagy of AML by negatively regulating AKT/mTOR

Yimin Chen

Zhenqian Huang

Shuyi Chen

Li Tan

Lang He

Danyun Yuan

Lixia Zheng

Jing hua Zhong

Anqiao Li

Heng Zhang

Huo Tan

Lihua Xu

Highlights

Abstract

Background

Methods

Results

Conclusion

Introduction

Materials and methods

Bioinformatics analysis

Cell Lines and Culture Conditions

Plasmid construction

Construction of stable cell lines

Western blot analysis

Quantitative real time PCR (qRT-PCR)

Cell proliferation assay

Flow cytometric analysis

Colony formation assay

Mouse human tumor xenograft model

Protein extraction

SDS-PAGE Separation

Mass Spectrometry analysis

Gene Ontology (GO) Annotation and KEGG Pathway Annotation

ChIP assays

Immunofluorescence

Statistical analysis

Results

IER3 may be a potential factor for poor prognosis in AML patients

Fig. 1.

Increased expression of IER3 promotes the proliferation of AML cells

Fig. 2.

IER3 modulated the cell cycle of HL60 and HEL cells

IER3 promoted the clonogenic ability of AML cells

Knockdown of IER3 inhibited the tumorigenic ability of AML in vivo

Fig. 3.

Identification of proteins and key events regulated by IER3 based on proteomics analysis

Fig. 4.

IER3 promoted autophagy of AML cells

Fig. 5.

SATB1 directly targets IER3 and negatively regulates IER3 expression

Fig. 6.

Discussion

Author Contributions

Funding

Data Availability

Ethics approval and consent to participate

Declaration of Competing Interest

Acknowledgments

Footnotes

Appendix. Supplementary materials

References

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases